Megaselia reductizona New Species Figs. 8, 13, 25.

urn:lsid:zoobank.org:act: EB3086EA-8500-4592-B322- 63B3A65ECDDE

Holotype. Male. USA: Arizona: Coconino Co., 20 mi. N Flagstaff, Bonito Park, 5–8.viii.1984, B.V. Brown, Malaise trap, ponderosa pine/meadow [LACM ENT 366240] (LACM).

Other Specimens. None.

Diagnosis. Differs from the other species by the virtual absence of hypandrial processes and the restriction of the white coloring on tergite 5 to a fingernail-shaped area (Fig. 13).

In Borgmeier’s (1964) key to North American phorid flies, this specimen would be placed in his Group VII (specimens with an episternum bare, two enlarged scutellar setae, and costa long (equal to or greater than 0.44 wing length)). In the key to Group VII species (Borgmeier 1966), it runs to couplet 25, where a user is confronted with the choice of “costal setae short to moderately long” versus “costal setae long”. In his preamble to Megaselia in first part of the revision of North American Megaselia, Borgmeier (1964) unhelpfully wrote:

“The length of costal cilia may vary in different species from 0,04 to 0, 20 mm. It is difficult to establish a dividing line between short and long, as I tried to do in a previous paper (1962), considering the cilia of 0, 1 mm or more as long; actually I would say that cilia of 0, 1 mm are moderately short. In many cases, of course, it is easy to say if the costal cilia are short or long, and only in such cases these characters should be used in keys for the determination of species. “

As costal setae in our specimen are 0.08 mm, we consider this to be in the “short to moderately long” category. Thereafter, it runs to couplet 38, which contrasts body color and size of two species, Megaselia rotundula Borgmeier, which is brown and 1.6 mm in body length, and M. piccola Borgmeier, which is black and 1 mm in body length. Of these, the closest match is M. rotundula, known only from a female specimen from Tacoma, Washington, U.S. Borgmeier (1966, p. 90) notes that the long seta of the base of the Rs vein might help in recognition of the male, but M. reductizona lacks such a seta.

This species is based on one specimen that was only partially (157 bp fragment) sequenced from one of the hind legs.

Partial Holotype Barcode TTCATTGACTCTATTATTAGCAAGAAGT ATAGTAGAAAATGGNGCTGGAACAGGATGAACCGTTTACCCA CCTTTATCGTCTAGAATTGCTCATAGAGGTTCATCTGTAGATC TTGCAATTTTTTCCCTTCATCTTGTAGGAATTTCATCAATTTTA

Etymology. From Latin reductus for “reduced”, referring to the extent of light color on tergite 5.