identifier	taxonID	type	CVterm	format	language	title	description	additionalInformationURL	UsageTerms	rights	Owner	contributor	creator	bibliographicCitation
5E1B3975FF9DAC6A4D793FE6FE9DF05E.text	5E1B3975FF9DAC6A4D793FE6FE9DF05E.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Data	<div><p>Data analysis</p><p>Complementary strands of the sequenced region were assembled using Gene Runner v. 3.05 (Hastings Software Inc., USA) and manually trimmed to obtain a clean sequence. The obtained sequences were deposited in GenBank. A homology check was carried out using NCBI BLAST program (http://blast. ncbi.nlm.nih.gov/Blast.cgi) to identify the presence of species with similar sequence combination. Nucleotide multiple align- ments were conducted with ClustalW embedded in MEGA6 (Tamura et al. 2013). Genetic distances were generated using the Kimura 2-parameter model (Kimura 1980), with all gaps treated as missing (complete deletion option). Unweighted Pair Group Method with Arithmetic Mean (UPGMA) cluster trees were constructed using MEGA6, with bootstrap consensus of 1 000 replicates.</p></div>	https://treatment.plazi.org/id/5E1B3975FF9DAC6A4D793FE6FE9DF05E	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Lee, S. Y.;Mohamed, R.	Lee, S. Y., Mohamed, R. (2016): Rediscovery of Aquilaria rostrata (Thymelaeaceae), a species thought to be extinct, and notes on Aquilaria conservation in Peninsular Malaysia. Blumea 61 (1): 13-19, DOI: 10.3767/000651916X691196, URL: https://doi.org/10.3767/000651916x691196
5E1B3975FF9DAC6A4D793A7EFEC4FE7C.text	5E1B3975FF9DAC6A4D793A7EFEC4FE7C.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Dna extraction PCR	<div><p>DNA extraction, PCR and sequencing</p><p>For fresh leaves, genomic DNA was extracted from a total of 1 g fresh tissue using the DNeasy® Plant Mini Kit (Qiagen, USA), according to the manufacturer’s protocol. For herbarium specimens, genomic DNA was extracted from 20 mg of the dried leaf tissue using the same extract kit based on a modified and optimized protocol suggested by Costa &amp; Roberts (2014). The quantity and quality were determined using NanoPho- tometerTM (IMPLEN, Germany). For PCR amplification, the nrITS region was amplified using the forward primer, ITS92, 5’AAGGTTTCCGTAGGTGAAC3’ and reverse primer, ITS75, 5’TATGCTTAAACTCAGCGGG3’ (Baldwin 1992); while the trn L- trn F region was amplified using the forward primer, e, 5’GGTTCAAGTCCCTCTATCCC3’ and reverse primer, f, 5’ATTTGAACTGGTGACACGAG3’ (Taberlet et al. 1991). The final reaction volume was 25 µL, containing 12.5 µL of 2 × PCRBIO Taq Mix Red (PCRBiosystems, UK), 0.4 µM for both forward and reverse primers, and 15 ng genomic DNA template. A negative control (without DNA template) was included in each run to verify the absence of contamination. PCR amplifications were conducted using MyCyclerTM Thermal Cycler (Bio-Rad, USA), programmed for 1 min at 95 °C; 40 cycles for 15 s at 95 °C, 15 s at T a and 1 min at 72 °C, with a final 3 min extension at 72 °C (T a: ITS 50°C; trn L- trn F 55 °C). Amplification products were separated using electrophoresis on 1 % agarose gels in 1 × TAE buffer, stained with ethidium bromide and photographed under UV light. PCR products were sent for direct Sanger sequencing (1st Base Laboratory Sdn. Bhd, Malaysia) using an ABI PRISM 3730xl Genetic Analyzer (Applied Biosystems, USA) from both ends.</p></div>	https://treatment.plazi.org/id/5E1B3975FF9DAC6A4D793A7EFEC4FE7C	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Lee, S. Y.;Mohamed, R.	Lee, S. Y., Mohamed, R. (2016): Rediscovery of Aquilaria rostrata (Thymelaeaceae), a species thought to be extinct, and notes on Aquilaria conservation in Peninsular Malaysia. Blumea 61 (1): 13-19, DOI: 10.3767/000651916X691196, URL: https://doi.org/10.3767/000651916x691196
