taxonID	type	description	language	source
03A3B16BFFDBFF8063E20C95FA184B7D.taxon	description	(all of the following are new species)	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFDAFF8363E20DF7FE404D40.taxon	description	(Fig. 16) Diagnostic description. Female. Fore wing length 7.4 – 8.1 mm. Malar space about 0.6 × basal mandibular width; combined face and clypeus (from clypeal apex to level of antennal sockets) about 1.6 × as high as wide (shortest distance between the eyes); posterior ocellus separated from eye by 0.6 × its own maximum diameter; antenna with 29 – 30 flagellomeres. Posterior projections of ventral mesothorax flattened and sharply pointed. Coloration. Black mark on occiput reaching laterally well beyond inner eye margin, with dorsal margin of black mark more or less parallel to eye margin; lower 0.6 of pronotum black; ventral mesothorax completely yellow; hind coxa with black mark on both internal and external surfaces; propodeum with longitudinal black line that is about as wide as propodeal orifice; tergite I with median black line reaching middle of tergite, sometimes vestigial anteriorly. Male. Similar to female.	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFDAFF8363E20DF7FE404D40.taxon	discussion	Comments. Both C. alanflemingi and C. christhompsoni have a relatively broad longitudinal black line in the center of the propodeum, but the former can be distinguished by tergite I having a simple black line that is usually not expanded laterally.	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFDAFF8363E20DF7FE404D40.taxon	biology_ecology	Hosts. This species was found in the Pocosol, Santa Rosa, Rincon Rain Forest, Del Oro, Pitilla, and Mundo Nuevo Sectors. It has been reared on 76 occasions from Ategumia lotanalis, Patania Solis 01, and Patania Solis 04 (Crambidae) feeding on Cecropia obtusifolia, C. peltata, Pourouma bicolor (Urticaceae), Conostegia xalapensis, Graffenrieda galeottii, and Miconia argentea (Melastomataceae).	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFDAFF8363E20DF7FE404D40.taxon	etymology	Etymology. This species is named in honor of Al Fleming of the Canadian National Collection of Insects, in recognition of his contributions to the ACG tachinid fly inventory	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFDAFF8363E20DF7FE404D40.taxon	materials_examined	Material. Holotype. ♀. Deposited at EMUS. Specimen labels: 1. DHJPAR 0014080. 2. Caterpillar Voucher: D. H. Janzen & W. Hallwachs, DB: http: // Janzen. sas. upenn. edu, Area de Conservation Guanacaste, Costa Rica, 00 - SRNP- 18639. Database information: Costa Rica, ACG, Guanacaste Prov., Sector Santa Rosa, Aréa Administrativa, 10.83764, - 85.61871, 295 m (Ruth Franco) caterpillar feeding on Cecropia peltata (Urticaceae) coll. 01. x. 2000 wasp eclosed 27. x. 2000. Paratypes. 70 ♀, 5 ♂, (EMUS, MNCR, MZUCR, USNM). COSTA RICA, ACG database codes: 94 - SRNP- 6318.1: DHJPAR 0024416 (♀); 94 - SRNP- 6318.5: DHJPAR 0024415 (♀); 94 - SRNP- 6318.6: DHJPAR 0024417 (♀); 00 - SRNP- 18629: DHJPAR 0014088 (♀); 00 - SRNP- 18632: DHJPAR 0014077 (♀); 00 - SRNP- 18640 DHJPAR 0014078 (♂); 00 - SRNP- 18646: DHJPAR 0014073 (♀); 00 - SRNP- 18651: DHJPAR 0014090 (♀); 00 - SRNP- 18762: DHJPAR 0014084 (♀); 00 - SRNP- 18763; DHJPAR 0014074 (♀); 00 - SRNP- 14017: DHJPAR 0024412 (♀); 00 - SRNP- 14133; DHJPAR 0014086 (♂); 00 - SRNP- 14261: DHJPAR 0024411 (♀); 00 - SRNP- 14909: DHJPAR 0014079 (♀); 00 - SRNP- 14912: DHJPAR 0024410 (♀); 01 - SRNP- 5548: DHJPAR 0014091 (♀); 01 - SRNP- 23296: DHJPAR 0014071 (♀); 02 - SRNP- 6116: DHJPAR 0024408 (♀); 02 - SRNP- 6386: DHJPAR 0014066 (♀); 02 - SRNP- 6387: DHJPAR 0014081 (♀); 02 - SRNP- 6411: DHJPAR 0014067 (♀); 02 - SRNP- 6418: DHJPAR 0014065 (♀); 02 - SRNP- 6702.06: DHJPAR 0014063 (♀); 02 - SRNP- 6116: DHJPAR 0014064 (♀); 03 - SRNP- 10611, 03 - SRNP- 11302: DHJPAR 0024409 (♀); 03 - SRNP- 11303: DHJPAR 0014087 (♀); 03 - SRNP- 11322: DHJPAR 0014070 (♀); 04 - SRNP- 23953: DHJPAR 0014057 (♀); 04 - SRNP- 23959: DHJPAR 0014058 (♀); 04 - SRNP- 24690: DHJPAR 0014032 (♀); 04 - SRNP- 24695: DHJPAR 0014062 (♀); 04 - SRNP- 24874: DHJPAR 0014035 (♀); 04 - SRNP- 24879: DHJPAR 0014029 (♀); 04 - SRNP- 34602: DHJPAR 0014043 (♀); 04 - SRNP- 34606: DHJPAR 0014056 (♀); 04 - SRNP- 34611: DHJPAR 0014044 (♀); 04 - SRNP- 34612: DHJPAR 0014045 (♀); 04 - SRNP- 41949: DHJPAR 0014039 (♀); 04 - SRNP- 42119: DHJPAR 0014039 (♂); 04 - SRNP- 42323: DHJPAR 0014040 (♀); 04 - SRNP- 42326: DHJPAR 0014061 (♀); 05 - SRNP- 1474: DHJPAR 0036921 (♀); 05 - SRNP- 7700: DHJPAR 0009781 (♀); 05 - SRNP- 33873: DHJPAR 0009714 (♀); 05 - SRNP- 33875: DHJPAR 0009719 (♀); 05 - SRNP- 33877: DHJPAR 0009716 (♀); 05 - SRNP- 33888: DHJPAR 0009712 (♀); 05 - SRNP- 33901: DHJPAR 0036919 (♀); 05 - SRNP- 33906: DHJPAR 0009715 (♀); 05 - SRNP- 34006: DHJPAR 0009718 (♀); 05 - SRNP- 34022: DHJPAR 0009717 (♀); 05 - SRNP- 34025: DHJPAR 0009711 (♀); 05 - SRNP- 34033: DHJPAR 0009710 (♀); 05 - SRNP- 34040: DHJPAR 0009829 (♀); 06 - SRNP- 1232: DHJPAR 0009625 (♀); 06 - SRNP- 40288: DHJPAR 0009635 (♀); 06 - SRNP- 40290: DHJPAR 0009634 (♂); 06 - SRNP- 40295: DHJPAR 00009637 (♀); 06 - SRNP- 41421: DHJPAR 0010095 (♀); 06 - SRNP- 41424: DHJPAR 0010100 (♀); 09 - SRNP- 69255: DHJPAR 00035993 (♀); 11 - SRNP- 81743: DHJPAR 0046771 (♀): 12 - SRNP- 68608: DHJPAR 0050883 (♀); 12 - SRNP- 68600: DHJPAR 0050885 (♀); 12 - SRNP- 68622: DHJPAR 0050884 (♀); 12 - SRNP- 68593: DHJPAR 0050906 (♀); 13 - SRNP- 69943: DHJPAR 0052803 (♀); 12 - SRNP- 68618: DHJPAR 0050907 (♂); 13 - SRNP- 43233: DHJPAR 0053531 (♀); 13 - SRNP- 77699: DHJPAR 0053543 (♀); 13 - SRNP- 69942: DHJPAR 0052756 (♀); 13 - SRNP- 69937: DHJPAR 0052800 (♀); 13 - SRNP- 69938: DHJPAR 0052802 (♀); 13 - SRNP- 69949: DHJPAR 0052733 (♀); 13 - SRNP- 69943: DHJPAR 0052803 (♀). Barcode. Holotype DHJPAR 0014080 (626 bp): CAATTGGAACTTCTACAAGTATAATTATTCGAATTCAACTTATAAATCCAATAAAACCATTAATTATTAATGATCA AATATATAATTCTTTAGTAACAATACATGCATTCTTAATAATTTTTTTTTTAGTTATACCTACAATAATTGGAGGA TTTGGAAATTGATTAATTCCATTAATATTAGGAACTCCTGATATAGCATTTCCACGTATAAATAATATAAGATTCT GACTGCTACCCCCCTCAATAATTATATTATTAATAAGTAGAATTATTAATCAAGGACCAGGTACTGGATGAACAAT TTACCCGCCATTATCATCAAATATTAGACATGAAGGAATATCAGTCGATTACGCTATTTTCTCCCTTCATATTGCA GGATCTTCTTCTATTATAGGTGCAATTAACTTTATTACAACTATTTTTAATTTAAAAATTAAAAATTTAAAAATAA GACAATTAACACTTTTCTCATGATCAATTATTATTACATCAATTTTACTCCTATTAGCTGTACCTGTTTTAGCAGG AGCTCTAACAATATTAATTTTTGATCGAAACTTAAATACATCATTCTTTGATCCTTCCGGAGGAGGAGATCCAATT CTCTTCCAACATCTCTTC	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD9FF8263E20BE4FDE84BD4.taxon	description	(Fig. 17) Diagnostic description. Female. Fore wing length 6.9 – 8.3 mm. Malar space about 0.6 × basal mandibular width; combined face and clypeus (from clypeal apex to level of antennal sockets) about 1.6 × as high as wide (shortest distance between the eyes); posterior ocellus separated from eye by 0.6 × its own maximum diameter; antenna with 28 – 30 flagellomeres. Posterior projections of ventral mesothorax flattened and sharply pointed. Coloration. Black mark on occiput reaching laterally well beyond inner eye margin, with dorsal margin of black mark more or less parallel to eye margin; lower 0.6 of pronotum black; ventral mesothorax completely yellow; hind coxa with black mark on both internal and external surfaces; propodeum with a longitudinal black line that is about as wide as propodeal orifice; tergite I with median black line reaching middle of tergite, with posterior portion greatly expanded laterally. Male. Similar to female.	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD9FF8263E20BE4FDE84BD4.taxon	discussion	Comments. Cubus christhompsoni is quite similar to Cubus alanflemingi but the black line on tergite I becomes very wide in the middle of the tergite. It is also similar to C. gracewoodae, from which it can be distinguished by genitalic characters and by the form of the black mark on the occiput.	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD9FF8263E20BE4FDE84BD4.taxon	biology_ecology	Hosts. This species was found in the San Cristobal, Cacao, Rincon Rain Forest, and Brasilia Sectors. It has been reared on nine occasions from Pantographa suffusalis, Pantographa Solis 116, spiloBioLep 01 BioLep 243 (Crambidae) feeding on Hampea appendiculata, Triumfetta bogotensis, Wissadula excelsior (Malvaceae), and Lycianthes synanthera (Solanaceae)	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD9FF8263E20BE4FDE84BD4.taxon	etymology	Etymology. This species is named in honor of the late Chris Thompson, formerly of the U. S. National Museum of Natural History, in recognition of his contributions to the ACG tachinid fly inventory.	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD9FF8263E20BE4FDE84BD4.taxon	materials_examined	Material. Holotype. ♀. Deposited at EMUS. Specimen labels: 1. DHJPAR 0009782. 2. Caterpillar Voucher: D. H. Janzen & W. Hallwachs, DB: http: // Janzen. sas. upenn. edu, Area de Conservation Guanacaste, Costa Rica, 05 - SRNP- 7719. Database information: Costa Rica, ACG, Guanacaste Prov., Sector San Cristobal, Sendero Pinyal, 10.87161 - 85.39333, 2630 m (Anabelle Cordoba) caterpillar feeding on Hampea appendiculata (Malvaceae) coll. 07. xii. 2005 wasp eclosed 05. i. 2006. Paratypes. 5 ♀, 1 ♂, (MNCR, MZUCR, USNM). COSTA RICA, ACG database codes: 05 - SRPN- 7717: DHJPAR 00099752 (♀); 05 - SRPN- 7720: DHJPAR 0009746 (♀); 07 - SRPN- 65970: DHJPAR 0023356 (♀); 05 - SRPN- 65967: DHJPAR 0023304 (♀); 04 - SRPN- 48231: DHJPAR 0014060 (♀); 09 - SRPN- 3153: DHJPAR 0036008 (♀); 04 - SRPN- 48228: DHJPAR 0014059 (♀); 07 - SRPN- 65963: DHJPAR 0023355 (♂). Barcode. DNA barcode of female holotype DHJPAR 0009782 (560 bp): TTAATGATCAAATATATAATTCTTTAGTTACAATACATGCATTCTTGATAATTTTTTTTTTAGTTATACCTACAAT AATTGGAGGTTTCGGAAATTGATTAATTCCATTAATATTAGGAACTCCTGATATAGCATTCCCTCGAATAAATAAT ATAAGATTCTGACTTTTACCTCCCTCAATAATTATATTATTAATAAGAAGAATTATTAATCAAGGACCAGGCACTG GGTGAACTGTTTACCCCCCATTATCATCAAATATTAGACATGAAGGTATATCAGTTGATTACGCTATTTTCTCCTT ACATATTGCGGGATCCTCATCTATTATAGGAGCAATTAATTTTATCACAACAATTTTTAATTTAAAAATTAAAAAT TTAAAAATAAGGCAATTAACTCTTTTCTCATGATCAATTATTATTACATCAATTTTACTTCTTTTAGCCGTACCTG TTTTAGCTGGCGCTCTAACAATATTAATTTTTGATCGAAATTTAAATACATCATTCTTTGATCCTTCAGGGGGAGG AGACCCAATTCTTTTCCAACATCTATTC	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD7FF8C63E20FD1FA114CD8.taxon	description	(Figs. 6, 12, 18) Diagnostic description. Female. Fore wing length 8.5 – 9.4 mm. Malar space about 0.6 × basal mandibular width; combined face and clypeus (from clypeal apex to level of antennal sockets) about 1.6 × as high as wide (shortest distance between the eyes); posterior ocellus separated from eye by 0.6 × its own maximum diameter; antenna with 28 – 29 flagellomeres. Posterior projections of ventral mesothorax conical and blunt. Coloration. Black mark on occiput reaching laterally well beyond inner eye margin, with dorsal margin of black mark diverging from eye margin; lateral pronotum, in addition to black mark on lower 0.6, with a black lobe extending anteriorly from middle of posterior margin; ventral mesothorax completely yellow; hind coxa with black mark on both internal and external surfaces; propodeum with a chalice-shaped or triangular black mark that is widest anteriorly, narrowing posteriorly, then widening slightly at posterior margin; tergite I with median black line reaching middle of tergite, with posterior portion greatly expanded laterally. Male. Similar to female.	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD7FF8C63E20FD1FA114CD8.taxon	discussion	Comments. Cubus curtsabrowskyi and C. manuelzumadoi are the only two species having the posterior mesosternal projections stout and cone-like, as opposed to flat and more sharply pointed at the apex. The former can be readily distinguished by having a larger black mark on the occiput and by having a black mark on both surfaces of the hind coxa, as opposed to just the internal surface in C. manuelzumadoi.	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD7FF8C63E20FD1FA114CD8.taxon	biology_ecology	Hosts. This species was found in Rincon Rain Forest, Mundo Nuevo, and Santa Rosa Sectors. It has been reared on 69 occasions from Omiodes cuniculalis (Crambidae) feeding on Gliricidia sepium and Platymiscium parviflorum (Fabaceae).	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD7FF8C63E20FD1FA114CD8.taxon	etymology	Etymology. This species is named in honor of Curt Sabrowsky of the U. S. National Museum of Natural History, in recognition of his contributions to the ACG tachinid fly inventory.	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD7FF8C63E20FD1FA114CD8.taxon	materials_examined	Material. Holotype. ♀. Deposited at EMUS. Specimen labels: 1. DHJPAR 0009953. 2. Caterpillar Voucher: D. H. Janzen & W. Hallwachs, DB: http: // Janzen. sas. upenn. edu, Area de Conservation Guanacaste, Costa Rica, 05 - SRNP- 66072. Database information: Costa Rica, ACG, Guanacaste Prov., Sector Mundo Nuevo, Punta Plancha, 10.74160, - 85.42734, 420 m (Mariano Pereira) caterpillar feeding on Gliricidia sepium (Fabaceae) coll. 25. xi. 2005 wasp eclosed 28. xii. 2005. Paratypes. 67 ♀, 1 ♂, (EMUS, MNCR, MZUCR, USNM). COSTA RICA, ACG database codes: 00 - SRNP- 14512: DHJPAR 0014075 (♀); 00 - SRNP- 14513: DHJPAR 0014083 (♀); 00 - SRNP- 14527: DHJPAR 0014085 (♀); 00 - SRNP- 14534: DHJPAR 0014076 (♀); 00 - SRNP- 14547: DHJPAR 0014072 (♀); 05 - SRNP- 66036: DHJPAR 0009947 (♀); 05 - SRNP- 66037: DHJPAR 0009735 (♀); 05 - SRNP- 66038: DHJPAR 0009950 (♀); 05 - SRNP- 66039: DHJPAR 0009949 (♀); 05 - SRNP- 66040: DHJPAR 0009739 (♀); 05 - SRNP- 66042: DHJPAR 0009946 (♀); 05 - SRNP- 66043: DHJPAR 0024421 (♀); 05 - SRNP- 66045: DHJPAR 0009734 (♀); 05 - SRNP- 66047: DHJPAR 0024423 (♀); 05 - SRNP- 66048: DHJPAR 0024419 (♀); 05 - SRNP- 66050: DHJPAR 0024420 (♀); 05 - SRNP- 66051: DHJPAR 0009954 (♀); 05 - SRNP- 66052: DHJPAR 0009733 (♀); 05 - SRNP- 66055: DHJPAR 0009948 (♀); 05 - SRNP- 66056: DHJPAR 0009738 (♀); 05 - SRNP- 66058: DHJPAR 0009740 (♀); 05 - SRNP- 66059: DHJPAR 0009737 (♀); 05 - SRNP- 66060: DHJPAR 0009952 (♀); 05 - SRNP- 66061: DHJPAR 0009732 (♀); 05 - SRNP- 66063: DHJPAR 0024422 (♀); 05 - SRNP- 66070: DHJPAR 0009736 (♀); 05 - SRNP- 66071: DHJPAR 0009951 (♀); 05 - SRNP- 66072: DHJPAR 0009953 (♀); 05 - SRNP- 66074: DHJPAR 0009731 (♀); 05 - SRNP- 66141: DHJPAR 0009730 (♀); 08 - SRNP- 15743: DHJPAR 0028345 (♂); 08 - SRNP- 15744: DHJPAR 0028363 (♀); 08 - SRNP- 15745: DHJPAR 0028342 (♀); 08 - SRNP- 15755: DHJPAR 0028350 (♀); 08 - SRNP- 15756: DHJPAR 0028357 (♀); 08 - SRNP- 15760: DHJPAR 0028368 (♀); 08 - SRNP- 15761: DHJPAR 0028370 (♀); 08 - SRNP- 15762: DHJPAR 0028361 (♀); 08 - SRNP- 15764: DHJPAR 0028371 (♀); 08 - SRNP- 15767: DHJPAR 0028348 (♀); 08 - SRNP- 15773: DHJPAR 0028372 (♀); 08 - SRNP- 15779: DHJPAR 0028362 (♀); 08 - SRNP- 15782: DHJPAR 0028358 (♀); 08 - SRNP- 15786: DHJPAR 0028365 (♀); 08 - SRNP- 15788: DHJPAR 0028347 (♀); 08 - SRNP- 15791: DHJPAR 0028353 (♀); 08 - SRNP- 15794: DHJPAR 0028346 (♀); 08 - SRNP- 15803: DHJPAR 0028344 (♀); 08 - SRNP- 15805: DHJPAR 0028369 (♀); 08 - SRNP- 15807: DHJPAR 0028349 (♀); 08 - SRNP- 15809: DHJPAR 0028366 (♀); 08 - SRNP- 15810: DHJPAR 0028351 (♀); 08 - SRNP- 15812: DHJPAR 0028367 (♀); 08 - SRNP- 15813: DHJPAR 0028356 (♀); 08 - SRNP- 15820: DHJPAR 0028354 (♀); 08 - SRNP- 15826: DHJPAR 0028364 (♀); 08 - SRNP- 15786: DHJPAR 0028360 (♀) 09 - SRNP- 14797: DHJPAR 0035995 (♀); 09 - SRNP- 14801: DHJPAR 0036243 (♀); 09 - SRNP- 14802: DHJPAR 0035994 (♀); 09 - SRNP- 14818: DHJPAR 0036043 (♀); 09 - SRNP- 14824: DHJPAR 0036247 (♀); 09 - SRNP- 14844: DHJPAR 0036292 (♀); 09 - SRNP- 14851: DHJPAR 0036288 (♀); 09 - SRNP- 14912: DHJPAR 0039123 (♀); 09 - SRNP- 14904: DHJPAR 0039124 (♀); 09 - SRNP- 14903: DHJPAR 0039128 (♀); 12 - SRNP- 12607: DHJPAR 0050847 (♀); 12 - SRNP- 12594: DHJPAR 0050808 (♀); 12 - SRNP- 12607: DHJPAR 0050847 (♀). Barcode. DNA barcode of female holotype DHJPAR 0009953 (532 bp): TTAATGATCAAACATATAATTCTTTAGTAACAATACATGCATTTTTAATAATTTTTTTTTTAGTTATACCTACAAT AATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAACACCTGATATAGCATTTCCTCGAATAAATAAT ATAAGATTTTGACTTTTACCTCCTTCAATAATTTTACTATTTATAAGTAGAATTATTAATCAAGGTCCAGGTACTG GATGAACAATATATCCACCATTATCATCTAATATTAGTCATGAAGGAATATCAGTTGATTATGCTATTTTCTCTCT TCATATTGCAGGATCTTCTTCAATTATGGGAGCAATTAATTTTATTACAACAATTTTTAATTTAAAAATTAAAAAT TTAAAAATAAGACAATTAACCCTTTTCTCATGATCAATTATAATTACATCAATTTTACTTCTTTTAGCTGTTCCTG TTCTAGCAGGAGCACTAACAATATTAATTTTTGATCGAAATTTAAATACATCATTTTTTGATCCATCAGGTGGAGG	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD6FF8F63E20954FDD84AE6.taxon	description	(Figs. 14, 19) Diagnostic description. Female. Fore wing length 6.4 mm. Malar space about 0.4 × basal mandibular width; combined face and clypeus (from clypeal apex to level of antennal sockets) about 1.4 × as high as wide (shortest distance between the eyes); posterior ocellus separated from eye by 0.6 × its own maximum diameter; antenna with 28 flagellomeres. Posterior projections of ventral mesothorax flattened and sharply pointed. Coloration. Black mark on occiput reaching laterally well beyond inner eye margin, with dorsal margin of black mark more or less parallel to eye margin; lower 0.6 of pronotum black; ventral mesothorax completely yellow; hind coxa with black mark on internal surface only; tergite I with median black line reaching middle of tergite, with posterior portion greatly expanded laterally, or with black mark restricted to middle. Male. Similar to female.	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD6FF8F63E20954FDD84AE6.taxon	discussion	Comments. Cubus duvalierbricenoi and C. manuelzumadoi are the only species lacking a black spot on the external surface of the hind coxa but having a black spot on the internal surface. However, these two species are readily distinguished by the form of the posterior mesosternal projections and the size of the black spot on the occiput.	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD6FF8F63E20954FDD84AE6.taxon	biology_ecology	Hosts. This species was found in Mundo Nuevo Sector. It has been reared on three occasions from Phaedropsis Solis 348 (Crambidae) feeding on Triplaris melaenodendron (Polygonaceae).	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD6FF8F63E20954FDD84AE6.taxon	etymology	Etymology. This species is named in honor of Duvalier Briceño, an ACG parataxonomist, in recognition of his contributions to the ACG tachinid fly inventory	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD6FF8F63E20954FDD84AE6.taxon	materials_examined	Material. Holotype. ♀. Deposited at EMUS. Specimen labels: 1. DHJPAR 0041062. 2. Caterpillar Voucher: D. H. Janzen & W. Hallwachs, DB: http: // Janzen. sas. upenn. edu, Area de Conservation Guanacaste, Costa Rica, 10 - SRNP- 57323. Database information: Costa Rica, ACG, Guanacaste Prov., Sector Nuevo Mundo, Sendero Mora, 10.76828, - 85.42567, 480 (Jose Cortez) caterpillar feeding on Triplari s melaenodendron (Polygonaceae) coll. 12. xi. 2010 wasp eclosed 20. xii. 2010. Paratypes. 2 ♀, (MNCR). COSTA RICA, ACG database codes: 13 - SRNP- 57596: DHJPAR 0054911 (♀); 13 - SRNP- 57592: DHJPAR 0054907 (♀). Barcode. DNA barcode of female holotype DHJPAR 0041062 (636 bp): TGATCAGGAACAATTGGAACTTCAACAAGTATAATTATTCGAATTCAACTTATAAATCCAATAAAACCATTAATTA TTAATGATCAAATATACAATTCTTTAGTAACAATACATGCATTTTTAATAATTTTTTTTTTAGTTATACCTACAAT AATTGGAGGATTTGGAAACTGACTAGTACCATTAATATTAGGAACACCCGATATAGCTTTTCCTCGAATAAATAAT ATAAGATTTTGACTTTTACCACCTTCAATAATTCTACTATTAATAAGTAGAATTATTAATCAAGGTCCAGGTACTG GATGAACAGTATATCCACCATTATCATCTAATATTAGTCATGAAGGAATATCAGTTGATTATGCTATTTTCTCCCT TCACATTGCAGGGTCTTCTTCAATTATAGGAGCAATTAATTTTATTACAACAATTTTTAATTTAAAAATTAAAAAT TTAAAAATAAGACAATTAAACCTCTTTTCATGATCAATTATTATTACATCAATTTTACTTCTTTTAGCTGTTCCTG TTCTTGCAGGTGCTTTAACAATACTATTTTTGATCGAAACTTAAATACATCATTCTTTGATCCATCAGGTGGAGGT GATCCAATTCTTTTTCAACATTTATTT	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD5FF8E63E20B14FB844A73.taxon	description	(Figs. 4, 15, 20) Diagnostic description. Female. Fore wing length 6.8 – 7.6 mm. Malar space about 0.6 × basal mandibular width; combined face and clypeus (from clypeal apex to level of antennal sockets) about 1.6 × as high as wide (shortest distance between the eyes); posterior ocellus separated from eye by 0.6 × its own maximum diameter; antenna with 29 – 30 flagellomeres. Posterior projections of ventral mesothorax flattened and sharply pointed. Coloration. Black mark on occiput reaching laterally well beyond inner eye margin, with dorsal margin of black mark diverging from eye margin; lower 0.6 of pronotum black; ventral mesothorax completely yellow; hind coxa with black mark on both internal and external surfaces; propodeum with a longitudinal black mark that is chalice-shaped (narrower near the middle); tergite I with median black line reaching middle of tergite, with posterior portion greatly expanded laterally. Male. Similar to female.	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD5FF8E63E20B14FB844A73.taxon	discussion	Comments. Cubus gracewoodae is one of three species that has the dorsal margin of black mark on the occiput diverging from eye margin (Table 1). It can be distinguished from these other two species by the size of the black mark on the lateral pronotum and the form of the black mark on the propodeum.	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD5FF8E63E20B14FB844A73.taxon	biology_ecology	Hosts. This species was found in the San Cristobal, Oro, and Brasilia Sectors. It has been reared on 23 occasions from Pantographa suffusalis and Pantographa Solis 116 (Crambidae) feeding on Allosidastrum pyramidatum, Hampea appendiculata, Wissadula excelsior (Malvaceae).	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD5FF8E63E20B14FB844A73.taxon	etymology	Etymology. This species is named in honor of Grace Wood of the Canadian National Collection of Insects, in recognition of her contributions to the ACG tachinid fly inventory.	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD5FF8E63E20B14FB844A73.taxon	materials_examined	Material. Holotype. ♀. Deposited at EMUS. Specimen labels: 1. DHJPAR 0014030. 2. Caterpillar Voucher: D. H. Janzen & W. Hallwachs, DB: http: // Janzen. sas. upenn. edu, Area de Conservation Guanacaste, Costa Rica, 04 - SRNP- 24207. Database information: Costa Rica, ACG, Guanacaste Prov., Sector Del Oro, Quebrada Raiz, 11.02865, - 85.48669, 280 m. (Lucia Rios) caterpillar feeding on Allosidastrum pyramidatum (Malvaceae) coll. 21. xiii. 2004 wasp eclosed 16. xi. 2004. Paratypes. 20 ♀, 2 ♂, (EMUS, MNCR, MZUCR, USNM). COSTA RICA, ACG database codes: 04 - SRNP- 24259: DHJPAR 0014026 (♀); 04 - SRNP- 24261: DHJPAR 0014027 (♂); 04 - SRNP- 24792: DHJPAR 0014034 (♀); 04 - SRNP- 26119: DHJPAR 0014053 (♀); 04 - SRNP- 26120: DHJPAR 0014031 (♀); 04 - SRNP- 26125: DHJPAR 0014033 (♀); 04 - SRNP- 26132: DHJPAR 0014049 (♀); 04 - SRNP- 26135: DHJPAR 0014042 (♀); 04 - SRNP- 26387: DHJPAR 0014046 (♀); 04 - SRNP- 26394: DHJPAR 0014047 (♀); 04 - SRNP- 26471: DHJPAR 0014038 (♀); 04 - SRNP- 26540: DHJPAR 0014051 (♀); 04 - SRNP- 26541: DHJPAR 0014041 (♀); 04 - SRNP- 26547: DHJPAR 0014054 (♀); 04 - SRNP- 26549: DHJPAR 0014050 (♀); 04 - SRNP- 26550: DHJPAR 0014048 (♀); 04 - SRNP- 26552: DHJPAR 0014055 (♀); 05 - SRNP- 7853: DHJPAR 0009753 (♀); 09 - SRNP- 23374: DHJPAR 0038419 (♂); 05 - SRNP- 33461: DHJPAR 0028562 (♀); 07 - SRNP- 65964: DHJPAR 0023305 (♀); 13 - SRNP- 540: DHJPAR 0051744 (♀). Barcode. DNA barcode of female holotype DHJPAR 0014030 (660 bp): ATATTATATTTTATTTTAGGAATCTGATCAGGTACAATTGGAACTTCTACAAGTATAATTATTCGAATTCAACTTA TAAATCCAATAAAACCATTAATTATTAATGATCAAATATATAATTCTTTAGTAACAATACATGCATTCTTAATAAT TTTTTTTTTAGTTATACCTACAATAATTGGAGGTTTCGGAAATTGATTAATTCCATTAATACTAGGAACTCCTGAT ATAGCATTCCCTCGAATAAATAATATAAGATTCTGACTTTTACCCCCCTCAATAATCATATTATTAATAAGAAGAA TTATTAATCAAGGACCAGGTACTGGGTGAACTATTTACCCCCCATTATCATCAAATATTAGACATGAAGGAATATC AGTTGATTATGCTATTTTCTCCCTACATATTGCGGGATCCTCATCTATTATAGGAGCAATTAATTTTATCACAACA ATTTTTAATTTAAAAATTAAAAATTTAAAAATAAGACAATTAACTCTTTTCTCATGATCAATTATTATTACATCAA TTTTACTTCTTTTAGCTGTTCCTGTTTTAGCTGGTGCTCTAACAATATTAATTTTTGATCGAAATTTAAATACATC ATTCTTTGACCCCTCAGGAGGGGGAGACCCAATTCTTTTCCAACATCTATTC	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD4FF8963E20CF9FE404B78.taxon	description	(Figs. 2, 10, 21) Diagnostic description. Female. Fore wing length 7.5 – 9 mm. Malar space about 0.6 × basal mandibular width; combined face and clypeus (from clypeal apex to level of antennal sockets) about 1.6 × as high as wide (shortest distance between the eyes); posterior ocellus separated from eye by 0.6 × its own maximum diameter; antenna with 32 – 34 flagellomeres. Posterior projections of ventral mesothorax flattened and sharply pointed. Coloration. Black mark on occiput small, barely reaching level of inner eye margin; lower 0.6 of pronotum black; ventral mesothorax completely yellow; hind coxa with black mark on both internal and external surfaces; propodeum with a longitudinal black mark that is narrower near the middle (chalice- or hourglass-shaped); tergite I with median black line reaching middle of tergite, with posterior portion greatly expanded laterally. Male. Similar to female.	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD4FF8963E20CF9FE404B78.taxon	discussion	Comments. Cubus jeffcummingi can be recognized by the combination of the small black mark on the occiput and the lateral pronotum with the ventral black area reaching beyond half the pronotal height. In one specimen (DHJPAR 0050790, reared from Desmia Solis 19) the black mark on the occiput is large, nonetheless it groups with C. jeffcummingi in the NJ tree.	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD4FF8963E20CF9FE404B78.taxon	biology_ecology	Hosts. This species was found in the San Cristobal, Orosi, Rincon Rain Forest, and Pitilla Sectors. It has been reared on 12 occasions from Desmia ploralis DHJ 01, Desmia Janzen 09, Desmia Solis 19, Syllepte Solis 22, Trichaea pilicornis, and spiloBioLep 01 BioLep 498 (Crambidae) feeding on Faramea multiflora, Psychotria chagrensis, P. grandis, and P. panamensis (Rubiaceae).	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD4FF8963E20CF9FE404B78.taxon	etymology	Etymology. This species is named in honor of Jeff Cumming of the Canadian National Collection of Insects, in recognition of his contributions to the ACG tachinid fly inventory.	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD4FF8963E20CF9FE404B78.taxon	materials_examined	Material. Holotype. ♀. Deposited at EMUS. Specimen labels: 1. DHJPAR 0014089. 2. Caterpillar Voucher: D. H. Janzen & W. Hallwachs, DB: http: // Janzen. sas. upenn. edu, Area de Conservation Guanacaste, Costa Rica, 01 - SRNP- 11830. Database information: Costa Rica, ACG, Guanacaste Prov., Sector Del Oro, Mena Central, 11.02991, - 85.45364, 345 m (Tonny Lara) caterpillar feeding on Psychotria panamensis (Rubiaceae) coll. 31. x. 2001 wasp eclosed 30. xi. 2001. Paratypes. 10 ♀, 1 ♂, (EMUS, MNCR, MZUCR, USNM). COSTA RICA, ACG database codes: (05 - SRNP- 4173: DHJPAR 0009713 (♀); 06 - SRNP- 33766: DHJPAR 0016379 (♀); 06 - SRNP- 33767: DHJPAR 0016385 (♂); 07 - SRNP- 22365: DHJPAR 0021637 (♀); 07 - SRNP- 22366: DHJPAR 0021660 (♀); 09 - SRNP- 3191: DHJPAR 0035973 (♀); 09 - SRNP- 3791: DHJPAR 0036775 (♀); 10 - SRNP- 1948: DHJPAR 0039367 (♀); 13 - SRNP- 4707: DHJPAR 0053488 (♀); 13 - SRNP- 30943: DHJPAR 0053527 (♀); 12 - SRNP- 5502: DHJPAR 0050790 (♀). Barcode. DNA barcode of female holotype DHJPAR 0014089 (626 bp): C AATTGGAACTTCTACAAGTATAATTATTCGAATTCAACTTATAAATCCAATAAAACCATTAATTACTAATGATCA AATATACAATTCTTTAGTAACAATACATGCATTTTTAATAATTTTTTTTTTAGTTATACCTACAATAATTGGAGGA TTTGGAAATTGATTAGTTCCATTAATATTAGGAACACCTGATATAGCATTTCCTCGAATAAATAATATAAGATTTT GACTTTTACCACCTTCAATAATTCTATTATTAATAAGTAGAATCATTAATCAAGGTCCAGGAACTGGATGAACAAT ATATCCACCATTATCATCTAATATTAGTCATGAAGGAATATCCGTTGATTATGCTATTTTTTCTCTTCATATTGCA GGATCTTCCTCAATTATAGGAGCAATTAATTTTATTACAACAATTTTTAATTTAAAAATTAAAAATTTAAAAATAA GACAATTAAATCTTTTTTCATGATCAATTATTATTACATCAATCTTACTTCTTTTAGCTGTTCCTGTATTAGCAGG TGCTTTAACAATATTAATTTTTGATCGAAATTTAAATACTTCATTCTTTGATCCATCAGGAGGGGGAGATCCTATT CTTTTTCAACATTTATTT	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD3FF8863E20DF5FC754825.taxon	description	(Figs. 11, 13, 22) Diagnostic description. Female. Fore wing length 7.4 – 8.4 mm. Malar space about 0.6 × basal mandibular width; combined face and clypeus (from clypeal apex to level of antennal sockets) about 1.6 × as high as wide (shortest distance between the eyes); posterior ocellus separated from eye by 0.6 × its own maximum diameter; antenna with 30 – 33 flagellomeres. Posterior projections of ventral mesothorax flattened and sharply pointed. Coloration. Black mark on occiput reaching laterally well beyond inner eye margin, with dorsal margin of black mark diverging from eye margin; lower 0.3 or 0.4 of pronotum black; ventral mesothorax completely yellow; hind coxa with black mark on external surface only; propodeum with a somewhat diamond-shaped black mark covering more than half the length of the propodeum, separated from much smaller black mark at posterior end; tergite I with black mark restricted to middle, yellow anteriorly. Male. Similar to female.	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD3FF8863E20DF5FC754825.taxon	discussion	Comments. No other species has a broken black mark on the propodeum, i. e. consisting of two parts. Cubus jimoharai, like C. manuelzumbadoi, has the lateral pronotum predominantly yellow, i. e. the ventral black mark covers less than half the height of the pronotum. However, the hind coxa of the former has a black mark only on the external surface, whereas the latter has a black mark only on the internal surface.	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD3FF8863E20DF5FC754825.taxon	biology_ecology	Hosts. This species was found in the San Cristobal, del Oro, Rincon Rain Forest, Santa Rosa, Pocosol, and Pitilla Sectors. It has been reared on 10 occasions from Omiodes humeralis, Phaedropsis Solis 03 DHJ 01, and Phaedropsis Solis 348 (Crambidae) feeding on Inga oerstediana, I. sapindoides, I. vera (Fabaceae), Trumfetta lappula (Malvaceae), and Triplaris melaenodendron (Polygonaceae).	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD3FF8863E20DF5FC754825.taxon	etymology	Etymology. This species is named in honor of Jim O'Hara of the Canadian National Collection of Insects, in recognition of his contributions to the ACG tachinid fly inventory.	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD3FF8863E20DF5FC754825.taxon	materials_examined	Material. Holotype. ♀. Deposited at EMUS. Specimen labels: 1. DHJPAR 0014068. 2. Caterpillar Voucher: D. H. Janzen & W. Hallwachs, DB: http: // Janzen. sas. upenn. edu, Area de Conservation Guanacaste, Costa Rica, 03 - SRNP- 10316. Database information: Costa Rica, ACG, Guanacaste Prov., Sector Rincon Rain Forest, Finca Hugo, 10.88068, - 85.26968, 540 m (Armando Rios) caterpillar feeding on Inga sapindoides (Fabaceae) coll. 10. ii. 2003 wasp eclosed 07. v. 2003. Paratypes. 8 ♀, 1 ♂, (EMUS, MNCR, MZUCR, USNM). COSTA RICA, ACG database codes: 99 - SRNP- 11316: DHJPAR 0024398 (♀); 99 - SRNP- 11319: DHJPAR 0024413 (♀); 04 - SRNP- 61275: DHJPAR 0036920 (♂); 07 - SRNP- 24369: DHJPAR 0027715 (♀); 07 - SRNP- 31220: DHJPAR 0017247 (♀); 07 - SRNP- 34128: DHJPAR 0023325 (♀); 08 - SRNP- 5380: DHJPAR 0030305 (♀); 13 - SRNP- 5069: DHJPAR 0053506 (♀); 99 - SRNP- 11314: DHJPAR 0024404 (♀). Barcode. DNA barcode of female holotype DHJPAR 0014068 (660 bp): ATATTATATTTCATTTTAGGAATTTGATCAGGAACAATTGGAACTTCTACAAGTATAATTATTCGAATCCAACTTA TAAATCCAATAAAACCATTAATTACTAATGATCAAATATATAATTCTTTAGTAACAATACATGCATTTTTAATAAT TTTTTTTTTAGTTATACCTACAATAATTGGAGGATTTGGAAATTGATTAATTCCATTAATATTAGGAACACCTGAT ATAGCATTCCCACGAATAAATAATATAAGATTTTGACTTTTACCGCCTTCAATAATTCTATTATTAATAAGTAGAA TTATCAATCAAGGCCCAGGTACTGGATGAACAGTATATCCACCTTTATCATCTAATATTAGTCATGAAGGAATATC AGTTGATTATGCTATTTTCTCACTTCATATTGCAGGATCTTCCTCAATTATAGGAGCAATTAATTTTATTACAACA ATTTTTAATTTAAAAATTAAAAACTTAAAAATAAGCAATTAACCCTTTTTTCATGATCAATTATTATCACATCAAT TTTACTTCTTTTAGCTGTTCCTGTATTAGCAGGTGCTTTAACAATATTAATTTTTGATCGAAATTTAAATACTTCA TTCTTTGATCCTTCAGGAGGAGGAGATCCAATTCTTTTTCAACATTTATTT	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD2FF8863E20ED6FE7D4E75.taxon	description	(Figs. 1, 7, 23) Diagnostic description. Female. Fore wing length 6.8 – 7.4 mm. Malar space about 0.6 × basal mandibular width; combined face and clypeus (from clypeal apex to level of antennal sockets) about 1.6 × as high as wide (shortest distance between the eyes); posterior ocellus separated from eye by 0.6 × its own maximum diameter; antenna with 28 – 30 flagellomeres. Posterior projections of ventral mesothorax flattened and sharply pointed. Coloration. Black mark on occiput reaching laterally well beyond inner eye margin, with dorsal margin of black mark more or less parallel to eye margin; lower 0.6 of pronotum black; ventral mesothorax with at least some black; hind coxa completely yellow, without black marks; propodeum with a longitudinal black line that is narrower than propodeal orifice; tergite I with dark mark restricted to middle, yellow anteriorly. Male. Unknown.	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD2FF8863E20ED6FE7D4E75.taxon	discussion	Comments. Cubus johnstiremani and C. montywoodi are the only species having completely yellow legs, without any dark marks, not even on the hind coxa. Both species are also unique in having at least some black on the ventral mesothorax. However, they are easily distinguished by the form of the black mark on the propodeum (Table 1). Cubus johnstiremani and C. normwoodleyi are the only species having a very narrow longitudinal black line on the propodeum. The former differs by the absence of black marks on the hind coxa.	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD2FF8863E20ED6FE7D4E75.taxon	biology_ecology	Hosts. This species was found in the San Cristobal, Oro, and Rincon Rain Forest Sectors. It has been reared on 12 occasions from Ategumia lotanalis and Rhectocraspeda periusalis (Crambidae) feeding on Conostegia xalapensis (Melastomataceae), Piper auritum, P. peltatum, and P. umbellatum (Piperaceae).	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD2FF8863E20ED6FE7D4E75.taxon	etymology	Etymology. This species is named in honor of John Stireman of Wright State University, in recognition of his contributions to the ACG tachinid fly inventory.	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD2FF8863E20ED6FE7D4E75.taxon	materials_examined	Material. Holotype. ♀. Deposited at EMUS. Specimen labels: 1. DHJPAR 0035199. 2. Caterpillar Voucher: D. H. Janzen & W. Hallwachs, DB: http: // Janzen. sas. upenn. edu, Area de Conservation Guanacaste, Costa Rica, 09 - SRNP- 2196. Database information: Costa Rica, ACG, Guanacaste Prov., Sector Del Oro, Sendero Puertas, 11.01087, - 85.48817, 400 m (Elieth Cantillano) caterpillar feeding on Tapirira mexicana (Anacardiaceae) coll. 07. vii. 2009 wasp eclosed 10. vii. 2009. Paratypes. 11 ♀, (EMUS, MNCR, MZUCR, USNM). COSTA RICA, ACG database codes: 01 - SRNP- 4863: DHJPAR 0024414 (♀); 02 - SRNP- 6690: DHJPAR 0014082 (♀); 04 - SRNP- 24731: DHJPAR 0014028 (♀); 04 - SRNP- 24732: DHJPAR 0014037 (♀); 04 - SRNP- 27154: DHJPAR 0014052 (♀); 09 - SRNP- 44000: DHJPAR 0035169 (♀); 09 - SRNP- 44146: DHJPAR 0035165 (♀); 09 - SRNP- 44274: DHJPAR 0035158 (♀); 09 - SRNP- 44507: DHJPAR 0036003 (♀); 09 - SRNP- 2757: DHJPAR 0036009 (♀); 10 - SRNP- 80898: DHJPAR 0041087 (♀). Barcode. DNA barcode of female holotype DHJPAR 0035199 (629 bp): CAGGTACAATTGGAACTTCAACAAGTATAATTATTCGAATTCAACTTATAAATCCAATAACATTAATTATTAATGA TCAAATATATAATTCTTTAGTAACAATACATGCATTCTTAATAATTTTTTTTTTAGTTATACCTACNATAATTGGA GGATTTGGAAATTGATTAATTCCATTAATATTAGGAACTCCTGATATAGCATTTCCACGTATAAATAATATAAGAT TCTGATTATTACCTCCCTCAATAATTATATTATTAATAAGTAGAATTATTAATCAAGGACCAGGTACTGGATGAAC AGTTTACCCACCATTATCATCAAATATTAGACATGAAGGAATATCAGTCGATTATGCTATTTTCTCCCTTCATATT GCAGGATCTTCTTCTATTATAGGTGCAATTAACTTTATTACAACAATTTTTAATTTAAAAATTAAAAATTTAAAAA TAAGACAATTAACACTTTTCTCATGATCAATTATTATTACATCAATTTTACTTCTACTAGCTGTACCCGTTTTAGC TGGTGCCCTAACAATATTAATTTTTGATCGAAACTTAAATACATCATTCTTTGATCCCTCCGGAGGGGGAGACCCA ATTCTATTCCAACATCTCTTC	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD1FF8A63E20B2DFB844B78.taxon	description	(Figs. 5, 9, 24) Diagnostic description. Female. Fore wing length 9.3 – 9.8 mm. Malar space about 0.6 × basal mandibular width; combined face and clypeus (from clypeal apex to level of antennal sockets) about 1.6 × as high as wide (shortest distance between the eyes); posterior ocellus separated from eye by 0.6 × its own maximum diameter; antenna with 32 flagellomeres. Posterior projections of ventral mesothorax conical and blunt. Coloration. Black mark on occiput small, barely reaching level of inner eye margin; lower 0.3 or 0.4 of pronotum black; ventral mesothorax completely yellow; hind coxa with black mark on internal surface only; propodeum with a longitudinal black mark that is narrower near the middle (chalice- or hourglass-shaped); tergite I with median black line reaching middle of tergite, with posterior portion greatly expanded laterally, or black mark restricted to middle. Male. Similar to female.	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD1FF8A63E20B2DFB844B78.taxon	discussion	Comments. Cubus manuelzumadoi and C. curtsabrowskyi are the only two species having the posterior mesosternal projections stout and cone-like, as opposed to flat and more sharply pointed at the apex. The former can be readily distinguished by having a smaller black mark on the occiput and by lacking a black spot only on the external surface of the hind coxa (Table 1).	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD1FF8A63E20B2DFB844B78.taxon	biology_ecology	Hosts. This species was found in the Pitilla Sector. It has been reared on nine occasions from Omiodes grandis (Crambidae) feeding on an unidentified plant.	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD1FF8A63E20B2DFB844B78.taxon	etymology	Etymology. This species is named in honor of Manuel Zumbado, formerly of INBio, in recognition of his contributions to the ACG tachinid fly inventory.	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD1FF8A63E20B2DFB844B78.taxon	materials_examined	Material. Holotype. ♀. Deposited at EMUS. Specimen labels: 1. DHJPAR 0017032. 2. Caterpillar Voucher: D. H. Janzen & W. Hallwachs, DB: http: // Janzen. sas. upenn. edu, Area de Conservation Guanacaste, Costa Rica, 07 - SRNP- 30683. Database information: Costa Rica, ACG, Guanacaste Prov., Sector Pittilla, Sendero Mismo, 11.01087 - 85.48817, 680 m (Calixto Moraga) caterpillar feeding unknown coll. 09. i. 2007 wasp eclosed 23. i. 2009. Paratypes. 8 ♀, (EMUS, MNCR, MZUCR, USNM). COSTA RICA, ACG database codes: 07 - SRNP- 30681: DHJPAR 0017030 (♀); 07 - SRNP- 30682: DHJPAR 0017026 (♀); 07 - SRNP- 30685: DHJPAR 0017029 (♀); 07 - SRNP- 30686: DHJPAR 0017023 (♀); 07 - SRNP- 30687: DHJPAR 0017031 (♀); 07 - SRNP- 30684: DHJPAR 0017024 (♀); 07 - SRNP- 30688: DHJPAR 0017022 (♀); 07 - SRNP- 30689: DHJPAR 0017021 (♀). Barcode. DNA barcode of female holotype DHJPAR 0017032 (660 bp): ATATTATACTTTATTCTAGGAATTTGATCAGGAACAATTGGAACTTCTACAAGTATAATTATTCGAATTCAACTTA TAAATCCAATAAAACCATTAATTATTAATGATCAAATATATAATTCTTTAGTAACAATACATGCATTTTTAATAAT TTTTTTTTTAGTTATACCTACAATAATTGGGGGATTTGGAAATTGATTAGTACCATTAATATTAGGAACACCTGAT ATAGCATTCCCTCGAATAAATAACATAAGATTTTGACTTTTACCTCCTTCAATAATTCTATTATTAATAAGTAGAA TTATCAATCAAGGTCCAGGTACTGGATGAACAATATACCCACCATTATCATCTAATATTAGTCATGAAGGAATATC AATTGATTACACTATCTTCTCTCTTCATATTGCAGGATCTTCTTCAATTATAGGAGCAATTAATTTTATTACAACA ATTTTTAATTTAAAAATTAAAAATTTAAAGATAAGACAATTAACTCTTTTTTCATGATCAATTATCATTACATCAA TTTTACTTTTATTAGCTGTTCCTGTATTAGCAGGCGCTTTAACAATATTAATTTTTGATCGAAATTTAAATACATC ATTTTTCGATCCTTCAGGTGGAGGTGACCCAATTCTTTTTCAACATTTATTT	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFCFFF9763E2096BFB844D64.taxon	description	(Figs. 3, 8, 25) Diagnostic description. Female. Fore wing length 5.1 – 7.5 mm. Malar space about 0.6 × basal mandibular width; combined face and clypeus (from clypeal apex to level of antennal sockets) about 1.6 × as high as wide (shortest distance between the eyes); posterior ocellus separated from eye by 0.6 × its own maximum diameter; antenna with 26 – 30 flagellomeres. Posterior projections of ventral mesothorax flattened and sharply pointed. Coloration. Black mark on occiput reaching laterally well beyond inner eye margin, with dorsal margin of black mark more or less parallel to eye margin; lower 0.5 or 0.6 of pronotum black; ventral mesothorax with at least some black; hind coxa completely yellow, without black marks; propodeum with black mark somewhat variable, either an elongate triangular black mark that narrows posteriorly, or chalice-shaped; tergite I completely yellow, without obvious black mark. Male. Similar to female.	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFCFFF9763E2096BFB844D64.taxon	discussion	Comments: Cubus montywoodi and C johnstiremani. are the only species having the legs completely yellow, without any dark marks, not even on the hind coxa. Both species are also unique in having at least some black on the ventral mesothorax. However, they are easily distinguished by the form of the black mark on the propodeum (Fig. 25 vs Fig. 23). In one specimen (DHJPAR 0046772, reared from Herpetogramma Janzen 07) the black mark on the occiput is small, not reaching laterally beyond inner eye margin, and the black mark on the propodeum is a narrow triangle not reaching the posterior margin. Because there are only three specimens of C. montywoodi it is difficult to judge whether this deviant specimen is a distinct species or represents extreme intraspecific variation.	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFCFFF9763E2096BFB844D64.taxon	biology_ecology	Hosts. This species was found in the Rincon Rain Forest Sector. It has been reared on 3 occasions from Desmia ploralis DHJ 01, Herpetogramma Janzen 07, and spiloBioLep 01 BioLep 375 (Crambidae) feeding on Psychotria panamensis, Sabicea panamensis (Rubiaceae), and Casearia arborea (Salicaceae).	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFCFFF9763E2096BFB844D64.taxon	etymology	Etymology. This species is named in honor of the late Monty Wood, formerly of the Canadian National Collection of Insects, in recognition of his contributions to the ACG tachinid fly inventory.	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFCFFF9763E2096BFB844D64.taxon	materials_examined	Material. Holotype. ♀. Deposited at EMUS. Specimen labels: 1. DHJPAR 0017255. 2. Caterpillar Voucher: D. H. Janzen & W. Hallwachs, DB: http: // Janzen. sas. upenn. edu, Area de Conservation Guanacaste, Costa Rica, 07 - SRNP- 40486. Database information: Costa Rica, ACG, Guanacaste Prov., Sector Rincon Rain Forest, Puente Rio Negro, 10.90376, - 85.30274, 340 m (Minor Carmona) caterpillar feeding on Casearia arborea (Salicaceae) coll. 16. ii. 2007 wasp eclosed 18. iii. 2007. Paratypes. 2 ♀, (MNCR). COSTA RICA, ACG database codes: (♀); 12 - SRNP- 67073: DHJPAR 0046772 (♀), 09 - SRNP- 44112: DHJPAR 0035164 (♀). Barcode. DNA barcode of female holotype DHJPAR 0017255 (660 bp): ATATTATATTTTATTTTAGGAATTTGATCAGGTACAATTGGAACTTCTACAAGTATAATTATTCGAATTCAACTAA TAAATCCAATAAAACCATTAATTACTAATGATCAAATATATAATTCTTTAGTAACAATACACGCATTTTTAATAAT TTTTTTTTTAGTAATACCTACAATAATTGGAGGATTCGGAAATTGATTAATTCCTTTAATATTAGGAACACCTGAT ATAGCATTCCCACGAATAAATAATATAAGATTTTGACTTCTACCTCCTTCAATAATTTTACTATTATTAAGTAGAA TTATAAATCAAGGTCCAGGTACTGGATGAACAGTATATCCACCATTATCATCTAATATTAGTCATGAAGGAATATC AGTTGATTATGCTATTTTTTCTCTTCATATTGCAGGATCCTCTTCAATTATAGGAGCAATTAATTTTATTACAACA ATTTTTAATTTAAAAATTAAAAATTTAAAAATAAGACAATTAACCCTTTTCTCATGATCAATTATTATTACATCAA TTTTACTTCTTCTAGCTGTACCTATTCTTGCAGGAGCATTAACAATATTAATTTTTGATCGAAATTTAAATACATC ATTTTTTGACCCCTCAGGTGGAGGAGATCCAATTCTTTTCCAACATTTATTT	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFCDFF9663E20B85FB944B9C.taxon	description	(Fig. 26) Diagnostic description. Female. Fore wing length 6.8 – 7.3 mm. Malar space about 0.5 × basal mandibular width; combined face and clypeus (from clypeal apex to level of antennal sockets) about 1.4 × as high as wide (shortest distance between the eyes); posterior ocellus separated from eye by 0.5 × its own maximum diameter; antenna with 32 – 34 flagellomeres. Posterior projections of ventral mesothorax flattened and sharply pointed. Coloration. Black mark on occiput reaching laterally well beyond inner eye margin, with dorsal margin of black mark more or less parallel to eye margin; lower 0.6 of pronotum black; ventral mesothorax completely yellow; hind coxa with black mark on both internal and external surfaces; propodeum with a longitudinal black line that is narrower than propodeal orifice; tergite I with median black line reaching middle of tergite, with posterior portion greatly expanded laterally, or black mark restricted to middle. Male. Unknown.	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFCDFF9663E20B85FB944B9C.taxon	discussion	Comments. Cubus normwoodleyi and C. johnstiremani are the only species having a very narrow longitudinal black line on the propodeum. The former differs by having a black mark on both surfaces of the hind coxa whereas the latter completely lacks black marks on the hind coxa.	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFCDFF9663E20B85FB944B9C.taxon	biology_ecology	Hosts. This species was found in the Mundo Nuevo Sector. It has been reared on five occasions from Herpetogramma Janzen 03 (Crambidae) feeding on Iresine calea (Amaranthaceae).	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFCDFF9663E20B85FB944B9C.taxon	etymology	Etymology. This species is named in honor of Norm Woodley of the U. S. National Museum of Natural History in recognition of his contributions to the ACG tachinid fly inventory.	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFCDFF9663E20B85FB944B9C.taxon	materials_examined	Material. Holotype. ♀. Deposited at EMUS. Specimen labels: 1. DHJPAR 0045034. 2. Caterpillar Voucher: D. H. Janzen & W. Hallwachs, DB: http: // Janzen. sas. upenn. edu, Area de Conservation Guanacaste, Costa Rica, 11 - SRNP- 55610. Database information: Costa Rica, ACG, Guanacaste Prov., Sector Mundo Nuevo, Estación la Perla, 10.76737, - 85.43313, 325 m (Mariano Pereira) caterpillar feeding on Iresine calea (Amaranthaceae) coll. 31. v. 2011 wasp eclosed 27. vi. 2011. Paratypes. 4 ♀, (MNCR, USNM). COSTA RICA, ACG database codes: (Rearing ref. #: 11 - SRNP- 57143: DHJPAR 0046766 (♀); 11 - SRNP- 57137: DHJPAR 0046767 (♀); 11 - SRNP- 55980: DHJPAR 0045033 (♀); 11 - SRNP- 55979: DHJPAR 0045032 (♀). Barcode. DNA barcode of female holotype DHJPAR 0045034 (661 bp): AATACTATATTTTATTTTAGGGATCTGATCAGGTACAATTGGAACTTCTACAAGTATAATTATTCGAATTCAACTT ATAAACCCAATAAAACCATTAATTATTAATGATCAAATATATAATTCTTTAGTAACAATACATGCATTCTTAATAA TTTTTTTTTTAGTTATACCTACAATAATTGGAGGATTTGGAAATTGATTAGTTCCACTAATATTAGGAACCCCTGA TATAGCATTCCCACGTATAAATAATATAAGATTCTGATTATTACCCCCCTCAATAATTATATTATTAATAAGTAGA ATTATTAATCAAGGACCAGGTACTGGATGAACAATTTATCCTCCATTATCATCAAATATTAGACATGAAGGAATAT CAGTTGATTATGCTATTTTCTCCCTTCATATTGCAGGATCTTCTTCTATTATAGGAGCAATTAATTTTATTACAAC AATTTTTAATTTAAAAATTAAAAATTTAAAAATAAGACAATTAACACTTTTCTCATGATCAATTATTATTACATCA ATTTTACTTCTATTAGCCGTACCCGTTTTAGCTGGTGCTTTAACAATATTAATTTTTGATCGAAACTTAAACACAT CATTCTTTGACCCTTCAGGAGGAGGAGACCCAATTCTCTTTCAACATCTCTTC	en	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
