identifier	taxonID	type	CVterm	format	language	title	description	additionalInformationURL	UsageTerms	rights	Owner	contributor	creator	bibliographicCitation
03A3B16BFFDBFF8063E20C95FA184B7D.text	03A3B16BFFDBFF8063E20C95FA184B7D.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Cubus	<div><p>Key to Costa Rican species of  Cubus</p><p>(all of the following are new species)</p><p>1. Legs without black marks (Fig. 1); tergite I usually without black, or with very little (Figs. 23, 25); ventral mesothorax with at least some black (Fig. 3)............................................................................... 2</p><p>– Legs with at least some black marks (Fig. 2); tergite I nearly always with black mark (Figs. 16–22, 24, 26); ventral mesothorax completely yellow (Fig. 4)............................................................................. 3</p><p>2. Propodeum with narrow, longitudinal black line in center (Fig. 23).................................  C. johnstiremani</p><p>– Propodeum with chalice-shaped black mark (Fig. 25).............................................  C. montywoodi</p><p>3. Black area on occiput relatively small, barely reaching or not reaching the area behind the eyes, i.e. not extending laterally beyond the level of the inner eye margin on top of the head (Fig. 5).............................................. 4</p><p>– Black area on occiput relatively large, reaching the area behind the eyes, i.e. extending laterally beyond the level of the inner eye margin on top of the head (Figs. 6–8).................................................................. 5</p><p>4. Posterior projections of ventral mesothorax flattened, relatively narrow and sharply pointed (as in Fig. 11); side of pronotum with ventral black area reaching beyond half the pronotal height (Fig. 10)...........................  C. jeffcummingi</p><p>– Posterior projections of ventral mesothorax more robust, wider (as in Fig. 12); side of pronotum predominantly yellow, ventral black area not extending dorsally beyond mid height (Fig. 9)..................................  C. manuelzumbadoi</p><p>5. Posterior projections of ventral mesothorax robustly conical and relatively wide (Fig. 12); black area on propodeum chalice-shaped or triangular, widest anteriorly (Fig. 18); side of pronotum with ventral black area extending dorsally along posterior margin, sometimes with a small black lobe extending anteriorly..................................  C. curtsabrowskyi</p><p>– Posterior projections of ventral mesothorax flattened, narrower and more sharply pointed (Fig. 11); black area on propodeum either a simple line or chalice-shaped; side of pronotum with ventral black area not extending dorsally along posterior margin ................................................................................................... 6</p><p>6. Side of pronotum predominantly yellow, ventral black area not extending dorsally beyond mid height (as in Fig. 9); hind coxa without internal black mark, or with very little black (Fig. 13)........................................  C. jimoharai</p><p>– Side of pronotum with ventral black area reaching beyond half the pronotal height (as in Fig. 10); hind coxa with internal black mark (Figs. 14–15)................................................................................... 7</p><p>7. Hind coxa with black spot on internal surface only (Fig. 14); propodeum with chalice-shaped black mark (Fig. 19).............................................................................................  C. duvalierbricenoi</p><p>– Hind coxa with black spot on both external and internal surface (Fig. 15); propodeum with a black line, at most only slightly chalice-shaped....................................................................................... 8</p><p>8. Occiput with dorsal margin of black mark divergent from eye margin (as in Fig. 6); propodeum with a black line that may be slightly chalice-shaped (Fig. 20)............................................................  C. gracewoodae</p><p>– Occiput with dorsal margin of black mark parallel to eye margin (as in Figs. 7–8); propodeum with a black line (Figs. 16–17, 26)................................................................................................ 9</p><p>9. Propodeum with longitudinal black line narrower than propodeal orifice, although slightly wider at both ends (Fig. 26)...........................................................................................  C. normwoodleyi</p><p>– Propodeum with black line that is about as wide as propodeal orifice (Figs. 16–17)................................ 10</p><p>10. Tergite I with a longitudinal black line extending from anterior margin to middle of the tergite where it becomes wider, often comprising a black band across the tergite (Fig. 17)...........................................  C. christhompsoni</p><p>– Tergite I with a longitudinal black line extending from anterior margin to middle of tergite where it does not become very wide, black line sometimes weak anteriorly (Fig. 16).................................................  C. alanflemingi</p></div>	https://treatment.plazi.org/id/03A3B16BFFDBFF8063E20C95FA184B7D	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		MagnoliaPress via Plazi	Zuñiga, Ronald;Valerio, Alejandro A.;Hanson, Paul;Hallwachs, Winnie;Janzen, Daniel H.	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFDAFF8363E20DF7FE404D40.text	03A3B16BFFDAFF8363E20DF7FE404D40.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Cubus alanflemingi Zuniga, Valerio & Hanson 2025	<div><p>Cubus alanflemingi Zúñiga, Valerio &amp; Hanson,  sp. nov.</p><p>(Fig. 16)</p><p>Diagnostic description. Female. Fore wing length 7.4–8.1 mm. Malar space about 0.6 × basal mandibular width; combined face and clypeus (from clypeal apex to level of antennal sockets) about 1.6 × as high as wide (shortest distance between the eyes); posterior ocellus separated from eye by 0.6 × its own maximum diameter; antenna with 29–30 flagellomeres. Posterior projections of ventral mesothorax flattened and sharply pointed. Coloration. Black mark on occiput reaching laterally well beyond inner eye margin, with dorsal margin of black mark more or less parallel to eye margin; lower 0.6 of pronotum black; ventral mesothorax completely yellow; hind coxa with black mark on both internal and external surfaces; propodeum with longitudinal black line that is about as wide as propodeal orifice; tergite I with median black line reaching middle of tergite, sometimes vestigial anteriorly.</p><p>Male. Similar to female.</p><p>Comments. Both  C. alanflemingi and  C. christhompsoni have a relatively broad longitudinal black line in the center of the propodeum, but the former can be distinguished by tergite I having a simple black line that is usually not expanded laterally.</p><p>Hosts. This species was found in the Pocosol, Santa Rosa, Rincon Rain Forest, Del Oro, Pitilla, and Mundo Nuevo Sectors. It has been reared on 76 occasions from  Ategumia lotanalis,  Patania Solis 01, and  Patania Solis 04 ( Crambidae) feeding on  Cecropia obtusifolia,  C. peltata,  Pourouma bicolor ( Urticaceae),  Conostegia xalapensis,  Graffenrieda galeottii, and  Miconia argentea ( Melastomataceae).</p><p>Etymology. This species is named in honor of Al Fleming of the Canadian National Collection of Insects, in recognition of his contributions to the ACG tachinid fly inventory</p><p>Material.   Holotype. ♀. Deposited at EMUS. Specimen labels: 1. DHJPAR0014080. 2. Caterpillar Voucher: D. H. Janzen &amp; W. Hallwachs, DB: http://Janzen.sas.upenn.edu, Area de Conservation Guanacaste, Costa Rica, 00- SRNP-18639. Database information: Costa Rica, ACG, Guanacaste Prov., Sector Santa Rosa, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=-85.61871&amp;materialsCitation.latitude=10.83764" title="Search Plazi for locations around (long -85.61871/lat 10.83764)">Aréa Administrativa</a>, 10.83764, -85.61871, 295m (Ruth Franco) caterpillar feeding on  Cecropia peltata ( Urticaceae) coll. 01.x.2000 wasp eclosed 27.x.2000  .  Paratypes. 70 ♀, 5 ♂, (EMUS, MNCR, MZUCR, USNM). COSTA RICA, ACG database codes: 94-SRNP-6318.1: DHJPAR0024416 (♀);  94-SRNP-6318.5: DHJPAR0024415 (♀);  94-SRNP-6318.6: DHJPAR0024417 (♀);  00-SRNP-18629: DHJPAR0014088 (♀);  00-SRNP-18632: DHJPAR0014077 (♀);  00-SRNP-18640 DHJPAR0014078 (♂);  00-SRNP-18646: DHJPAR0014073 (♀);  00-SRNP-18651: DHJPAR0014090 (♀);  00- SRNP-18762: DHJPAR0014084 (♀);  00-SRNP-18763; DHJPAR0014074 (♀);  00-SRNP-14017: DHJPAR0024412 (♀);  00-SRNP-14133; DHJPAR0014086 (♂);  00-SRNP-14261: DHJPAR0024411 (♀);  00-SRNP-14909: DHJPAR0014079 (♀);  00-SRNP-14912: DHJPAR0024410 (♀);  01-SRNP-5548: DHJPAR0014091 (♀);  01-SRNP-23296: DHJPAR0014071 (♀);  02-SRNP-6116: DHJPAR0024408 (♀);  02-SRNP-6386: DHJPAR0014066 (♀);  02- SRNP-6387: DHJPAR0014081 (♀);  02-SRNP-6411: DHJPAR0014067 (♀);  02-SRNP-6418: DHJPAR0014065 (♀);  02-SRNP-6702.06: DHJPAR0014063 (♀);  02-SRNP-6116: DHJPAR0014064 (♀);  03-SRNP-10611, 03-SRNP-11302: DHJPAR0024409 (♀);  03-SRNP-11303: DHJPAR0014087 (♀);  03-SRNP-11322: DHJPAR0014070 (♀);  04- SRNP-23953: DHJPAR0014057 (♀);  04-SRNP-23959: DHJPAR0014058 (♀);  04-SRNP-24690: DHJPAR0014032 (♀);  04-SRNP-24695: DHJPAR0014062 (♀);  04-SRNP-24874: DHJPAR0014035 (♀);  04-SRNP-24879: DHJPAR0014029 (♀);  04-SRNP-34602: DHJPAR0014043 (♀);  04-SRNP-34606: DHJPAR0014056 (♀);  04- SRNP-34611: DHJPAR0014044 (♀);  04-SRNP-34612: DHJPAR0014045 (♀);  04-SRNP-41949: DHJPAR0014039 (♀);  04-SRNP-42119: DHJPAR0014039 (♂);  04-SRNP-42323: DHJPAR0014040 (♀);  04-SRNP-42326: DHJPAR0014061 (♀);  05-SRNP-1474: DHJPAR0036921 (♀);  05-SRNP-7700: DHJPAR0009781 (♀);  05-SRNP-33873: DHJPAR0009714 (♀);  05-SRNP-33875: DHJPAR0009719 (♀);  05-SRNP-33877: DHJPAR0009716 (♀);  05- SRNP-33888: DHJPAR0009712 (♀);  05-SRNP-33901: DHJPAR0036919 (♀);  05-SRNP-33906: DHJPAR0009715 (♀);  05-SRNP-34006: DHJPAR0009718 (♀);  05-SRNP-34022: DHJPAR0009717 (♀);  05-SRNP-34025: DHJPAR0009711 (♀);  05-SRNP-34033: DHJPAR0009710 (♀);  05-SRNP-34040: DHJPAR0009829 (♀);  06- SRNP-1232: DHJPAR0009625 (♀);  06-SRNP-40288: DHJPAR0009635 (♀);  06-SRNP-40290: DHJPAR0009634 (♂);  06-SRNP-40295: DHJPAR00009637 (♀);  06-SRNP-41421: DHJPAR0010095 (♀);  06-SRNP-41424: DHJPAR0010100 (♀);  09-SRNP-69255: DHJPAR00035993 (♀);  11-SRNP-81743: DHJPAR0046771 (♀):  12- SRNP-68608: DHJPAR0050883 (♀);  12-SRNP-68600: DHJPAR0050885 (♀);  12-SRNP-68622: DHJPAR0050884 (♀);  12-SRNP-68593: DHJPAR0050906 (♀);  13-SRNP-69943: DHJPAR0052803 (♀);  12-SRNP-68618: DHJPAR0050907 (♂);  13-SRNP-43233: DHJPAR0053531 (♀);  13-SRNP-77699: DHJPAR0053543 (♀);  13- SRNP-69942: DHJPAR0052756 (♀);  13-SRNP-69937: DHJPAR0052800 (♀);  13-SRNP-69938: DHJPAR0052802 (♀);  13-SRNP-69949: DHJPAR0052733 (♀);  13-SRNP-69943: DHJPAR0052803 (♀) .</p><p>Barcode. Holotype DHJPAR0014080 (626 bp): CAATTGGAACTTCTACAAGTATAATTATTCGAATTCAACTTATAAATCCAATAAAACCATTAATTATTAATGATCA AATATATAATTCTTTAGTAACAATACATGCATTCTTAATAATTTTTTTTTTAGTTATACCTACAATAATTGGAGGA TTTGGAAATTGATTAATTCCATTAATATTAGGAACTCCTGATATAGCATTTCCACGTATAAATAATATAAGATTCT GACTGCTACCCCCCTCAATAATTATATTATTAATAAGTAGAATTATTAATCAAGGACCAGGTACTGGATGAACAAT TTACCCGCCATTATCATCAAATATTAGACATGAAGGAATATCAGTCGATTACGCTATTTTCTCCCTTCATATTGCA GGATCTTCTTCTATTATAGGTGCAATTAACTTTATTACAACTATTTTTAATTTAAAAATTAAAAATTTAAAAATAA GACAATTAACACTTTTCTCATGATCAATTATTATTACATCAATTTTACTCCTATTAGCTGTACCTGTTTTAGCAGG AGCTCTAACAATATTAATTTTTGATCGAAACTTAAATACATCATTCTTTGATCCTTCCGGAGGAGGAGATCCAATT CTCTTCCAACATCTCTTC</p></div>	https://treatment.plazi.org/id/03A3B16BFFDAFF8363E20DF7FE404D40	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		MagnoliaPress via Plazi	Zuñiga, Ronald;Valerio, Alejandro A.;Hanson, Paul;Hallwachs, Winnie;Janzen, Daniel H.	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD9FF8263E20BE4FDE84BD4.text	03A3B16BFFD9FF8263E20BE4FDE84BD4.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Cubus christhompsoni Zuniga, Valerio & Hanson 2025	<div><p>Cubus christhompsoni Zúñiga, Valerio &amp; Hanson,  sp. nov.</p><p>(Fig. 17)</p><p>Diagnostic description. Female. Fore wing length 6.9–8.3 mm. Malar space about 0.6 × basal mandibular width; combined face and clypeus (from clypeal apex to level of antennal sockets) about 1.6 × as high as wide (shortest distance between the eyes); posterior ocellus separated from eye by 0.6 × its own maximum diameter; antenna with 28–30 flagellomeres. Posterior projections of ventral mesothorax flattened and sharply pointed. Coloration. Black mark on occiput reaching laterally well beyond inner eye margin, with dorsal margin of black mark more or less parallel to eye margin; lower 0.6 of pronotum black; ventral mesothorax completely yellow; hind coxa with black mark on both internal and external surfaces; propodeum with a longitudinal black line that is about as wide as propodeal orifice; tergite I with median black line reaching middle of tergite, with posterior portion greatly expanded laterally.</p><p>Male. Similar to female.</p><p>Comments.  Cubus christhompsoni is quite similar to  Cubus alanflemingi but the black line on tergite I becomes very wide in the middle of the tergite. It is also similar to  C. gracewoodae, from which it can be distinguished by genitalic characters and by the form of the black mark on the occiput.</p><p>Hosts. This species was found in the San Cristobal, Cacao, Rincon Rain Forest, and Brasilia Sectors. It has been reared on nine occasions from  Pantographa suffusalis,  Pantographa Solis 116, spiloBioLep01 BioLep243 ( Crambidae) feeding on  Hampea appendiculata,  Triumfetta bogotensis,  Wissadula excelsior ( Malvaceae), and  Lycianthes synanthera ( Solanaceae)</p><p>Etymology. This species is named in honor of the late Chris Thompson, formerly of the U.S. National Museum of Natural History, in recognition of his contributions to the ACG tachinid fly inventory.</p><p>Material.   Holotype. ♀. Deposited at EMUS. Specimen labels: 1. DHJPAR0009782. 2. Caterpillar Voucher: D. H. Janzen &amp; W. Hallwachs, DB: http://Janzen.sas.upenn.edu, Area de Conservation Guanacaste, Costa Rica, 05-SRNP-7719. Database information: Costa Rica, ACG, Guanacaste Prov., Sector San Cristobal, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=-85.39333&amp;materialsCitation.latitude=10.87161" title="Search Plazi for locations around (long -85.39333/lat 10.87161)">Sendero Pinyal</a>, 10.87161 -85.39333, 2630m (Anabelle Cordoba) caterpillar feeding on  Hampea appendiculata ( Malvaceae) coll. 07.xii.2005 wasp eclosed 05.i.2006  .  Paratypes. 5 ♀, 1 ♂, (MNCR, MZUCR, USNM). COSTA RICA, ACG database codes: 05-SRPN-7717: DHJPAR00099752 (♀);  05-SRPN-7720: DHJPAR0009746 (♀);  07-SRPN-65970: DHJPAR0023356 (♀);  05-SRPN-65967: DHJPAR0023304 (♀);  04-SRPN-48231: DHJPAR0014060 (♀);  09- SRPN-3153: DHJPAR0036008 (♀);  04-SRPN-48228: DHJPAR0014059 (♀);  07-SRPN-65963: DHJPAR0023355 (♂) .</p><p>Barcode. DNA barcode of female holotype DHJPAR0009782 (560 bp): TTAATGATCAAATATATAATTCTTTAGTTACAATACATGCATTCTTGATAATTTTTTTTTTAGTTATACCTACAAT AATTGGAGGTTTCGGAAATTGATTAATTCCATTAATATTAGGAACTCCTGATATAGCATTCCCTCGAATAAATAAT ATAAGATTCTGACTTTTACCTCCCTCAATAATTATATTATTAATAAGAAGAATTATTAATCAAGGACCAGGCACTG GGTGAACTGTTTACCCCCCATTATCATCAAATATTAGACATGAAGGTATATCAGTTGATTACGCTATTTTCTCCTT ACATATTGCGGGATCCTCATCTATTATAGGAGCAATTAATTTTATCACAACAATTTTTAATTTAAAAATTAAAAAT TTAAAAATAAGGCAATTAACTCTTTTCTCATGATCAATTATTATTACATCAATTTTACTTCTTTTAGCCGTACCTG TTTTAGCTGGCGCTCTAACAATATTAATTTTTGATCGAAATTTAAATACATCATTCTTTGATCCTTCAGGGGGAGG AGACCCAATTCTTTTCCAACATCTATTC</p></div>	https://treatment.plazi.org/id/03A3B16BFFD9FF8263E20BE4FDE84BD4	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		MagnoliaPress via Plazi	Zuñiga, Ronald;Valerio, Alejandro A.;Hanson, Paul;Hallwachs, Winnie;Janzen, Daniel H.	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD7FF8C63E20FD1FA114CD8.text	03A3B16BFFD7FF8C63E20FD1FA114CD8.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Cubus curtsabrowskyi Zuniga, Valerio & Hanson 2025	<div><p>Cubus curtsabrowskyi Zúñiga, Valerio &amp; Hanson,  sp. nov.</p><p>(Figs. 6, 12, 18)</p><p>Diagnostic description. Female. Fore wing length 8.5–9.4mm. Malar space about 0.6 × basal mandibular width; combined face and clypeus (from clypeal apex to level of antennal sockets) about 1.6 × as high as wide (shortest distance between the eyes); posterior ocellus separated from eye by 0.6 × its own maximum diameter; antenna with 28–29 flagellomeres. Posterior projections of ventral mesothorax conical and blunt. Coloration. Black mark on occiput reaching laterally well beyond inner eye margin, with dorsal margin of black mark diverging from eye margin; lateral pronotum, in addition to black mark on lower 0.6, with a black lobe extending anteriorly from middle of posterior margin; ventral mesothorax completely yellow; hind coxa with black mark on both internal and external surfaces; propodeum with a chalice-shaped or triangular black mark that is widest anteriorly, narrowing posteriorly, then widening slightly at posterior margin; tergite I with median black line reaching middle of tergite, with posterior portion greatly expanded laterally.</p><p>Male. Similar to female.</p><p>Comments.  Cubus curtsabrowskyi and  C. manuelzumadoi are the only two species having the posterior mesosternal projections stout and cone-like, as opposed to flat and more sharply pointed at the apex. The former can be readily distinguished by having a larger black mark on the occiput and by having a black mark on both surfaces of the hind coxa, as opposed to just the internal surface in  C. manuelzumadoi .</p><p>Hosts. This species was found in Rincon Rain Forest, Mundo Nuevo, and Santa Rosa Sectors. It has been reared on 69 occasions from  Omiodes cuniculalis ( Crambidae) feeding on  Gliricidia sepium and  Platymiscium parviflorum ( Fabaceae).</p><p>Etymology. This species is named in honor of Curt Sabrowsky of the U.S. National Museum of Natural History, in recognition of his contributions to the ACG tachinid fly inventory.</p><p>Material.   Holotype. ♀. Deposited at EMUS. Specimen labels: 1. DHJPAR0009953. 2. Caterpillar Voucher: D. H. Janzen &amp; W. Hallwachs, DB: http://Janzen.sas.upenn.edu, Area de Conservation Guanacaste, Costa Rica, 05-SRNP-66072. Database information: Costa Rica, ACG, Guanacaste Prov., Sector Mundo Nuevo, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=-85.42734&amp;materialsCitation.latitude=10.7416" title="Search Plazi for locations around (long -85.42734/lat 10.7416)">Punta Plancha</a>, 10.74160, -85.42734, 420m (Mariano Pereira) caterpillar feeding on  Gliricidia sepium ( Fabaceae) coll. 25.xi.2005 wasp eclosed 28.xii.2005  .  Paratypes. 67 ♀, 1 ♂, (EMUS, MNCR, MZUCR, USNM). COSTA RICA, ACG database codes: 00-SRNP-14512: DHJPAR0014075 (♀);  00-SRNP-14513: DHJPAR0014083 (♀);  00-SRNP-14527: DHJPAR0014085 (♀);  00-SRNP-14534: DHJPAR0014076 (♀);  00-SRNP-14547: DHJPAR0014072 (♀);  05-SRNP-66036: DHJPAR0009947 (♀);  05-SRNP-66037: DHJPAR0009735 (♀);  05-SRNP-66038: DHJPAR0009950 (♀);  05-SRNP-66039: DHJPAR0009949 (♀);  05-SRNP-66040: DHJPAR0009739 (♀);  05- SRNP-66042: DHJPAR0009946 (♀);  05-SRNP-66043: DHJPAR0024421 (♀);  05-SRNP-66045: DHJPAR0009734 (♀);  05-SRNP-66047: DHJPAR0024423 (♀);  05-SRNP-66048: DHJPAR0024419 (♀);  05-SRNP-66050: DHJPAR0024420 (♀);  05-SRNP-66051: DHJPAR0009954 (♀);  05-SRNP-66052: DHJPAR0009733 (♀);  05- SRNP-66055: DHJPAR0009948 (♀);  05-SRNP-66056: DHJPAR0009738 (♀);  05-SRNP-66058: DHJPAR0009740 (♀);  05-SRNP-66059: DHJPAR0009737 (♀);  05-SRNP-66060: DHJPAR0009952 (♀);  05-SRNP-66061: DHJPAR0009732 (♀);  05-SRNP-66063: DHJPAR0024422 (♀);  05-SRNP-66070: DHJPAR0009736 (♀);  05- SRNP-66071: DHJPAR0009951 (♀);  05-SRNP-66072: DHJPAR0009953 (♀);  05-SRNP-66074: DHJPAR0009731 (♀);  05-SRNP-66141: DHJPAR0009730 (♀);  08-SRNP-15743: DHJPAR0028345 (♂);  08-SRNP-15744: DHJPAR0028363 (♀);  08-SRNP-15745: DHJPAR0028342 (♀);  08-SRNP-15755: DHJPAR0028350 (♀);  08- SRNP-15756: DHJPAR0028357 (♀);  08-SRNP-15760: DHJPAR0028368 (♀);  08-SRNP-15761: DHJPAR0028370 (♀);  08-SRNP-15762: DHJPAR0028361 (♀);  08-SRNP-15764: DHJPAR0028371 (♀);  08-SRNP-15767: DHJPAR0028348 (♀);  08-SRNP-15773: DHJPAR0028372 (♀);  08-SRNP-15779: DHJPAR0028362 (♀);  08- SRNP-15782: DHJPAR0028358 (♀);  08-SRNP-15786: DHJPAR0028365 (♀);  08-SRNP-15788: DHJPAR0028347 (♀);  08-SRNP-15791: DHJPAR0028353 (♀);  08-SRNP-15794: DHJPAR0028346 (♀);  08-SRNP-15803: DHJPAR0028344 (♀);  08-SRNP-15805: DHJPAR0028369 (♀);  08-SRNP-15807: DHJPAR0028349 (♀);  08- SRNP-15809: DHJPAR0028366 (♀);  08-SRNP-15810: DHJPAR0028351 (♀);  08-SRNP-15812: DHJPAR0028367 (♀);  08-SRNP-15813: DHJPAR0028356 (♀);  08-SRNP-15820: DHJPAR0028354 (♀);  08-SRNP-15826: DHJPAR0028364 (♀);  08-SRNP-15786: DHJPAR0028360 (♀) 09-SRNP-14797: DHJPAR0035995 (♀);  09- SRNP-14801: DHJPAR0036243 (♀);  09-SRNP-14802: DHJPAR0035994 (♀);  09-SRNP-14818: DHJPAR0036043 (♀);  09-SRNP-14824: DHJPAR0036247 (♀);  09-SRNP-14844: DHJPAR0036292 (♀);  09-SRNP-14851: DHJPAR0036288 (♀);  09-SRNP-14912: DHJPAR0039123 (♀);  09-SRNP-14904: DHJPAR0039124 (♀);  09- SRNP-14903: DHJPAR0039128 (♀);  12-SRNP-12607: DHJPAR0050847 (♀);  12-SRNP-12594: DHJPAR0050808 (♀);  12-SRNP-12607: DHJPAR0050847 (♀) .</p><p>Barcode. DNA barcode of female holotype DHJPAR0009953 (532 bp): TTAATGATCAAACATATAATTCTTTAGTAACAATACATGCATTTTTAATAATTTTTTTTTTAGTTATACCTACAAT AATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAACACCTGATATAGCATTTCCTCGAATAAATAAT ATAAGATTTTGACTTTTACCTCCTTCAATAATTTTACTATTTATAAGTAGAATTATTAATCAAGGTCCAGGTACTG GATGAACAATATATCCACCATTATCATCTAATATTAGTCATGAAGGAATATCAGTTGATTATGCTATTTTCTCTCT TCATATTGCAGGATCTTCTTCAATTATGGGAGCAATTAATTTTATTACAACAATTTTTAATTTAAAAATTAAAAAT TTAAAAATAAGACAATTAACCCTTTTCTCATGATCAATTATAATTACATCAATTTTACTTCTTTTAGCTGTTCCTG TTCTAGCAGGAGCACTAACAATATTAATTTTTGATCGAAATTTAAATACATCATTTTTTGATCCATCAGGTGGAGG</p></div>	https://treatment.plazi.org/id/03A3B16BFFD7FF8C63E20FD1FA114CD8	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		MagnoliaPress via Plazi	Zuñiga, Ronald;Valerio, Alejandro A.;Hanson, Paul;Hallwachs, Winnie;Janzen, Daniel H.	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD6FF8F63E20954FDD84AE6.text	03A3B16BFFD6FF8F63E20954FDD84AE6.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Cubus duvalierbricenoi Zuniga, Valerio & Hanson 2025	<div><p>Cubus duvalierbricenoi Zúñiga, Valerio &amp; Hanson,  sp. nov.</p><p>(Figs. 14, 19)</p><p>Diagnostic description. Female. Fore wing length 6.4 mm. Malar space about 0.4 × basal mandibular width; combined face and clypeus (from clypeal apex to level of antennal sockets) about 1.4 × as high as wide (shortest distance between the eyes); posterior ocellus separated from eye by 0.6 × its own maximum diameter; antenna with 28 flagellomeres. Posterior projections of ventral mesothorax flattened and sharply pointed. Coloration. Black mark on occiput reaching laterally well beyond inner eye margin, with dorsal margin of black mark more or less parallel to eye margin; lower 0.6 of pronotum black; ventral mesothorax completely yellow; hind coxa with black mark on internal surface only; tergite I with median black line reaching middle of tergite, with posterior portion greatly expanded laterally, or with black mark restricted to middle.</p><p>Male. Similar to female.</p><p>Comments.  Cubus duvalierbricenoi and  C. manuelzumadoi are the only species lacking a black spot on the external surface of the hind coxa but having a black spot on the internal surface. However, these two species are readily distinguished by the form of the posterior mesosternal projections and the size of the black spot on the occiput.</p><p>Hosts. This species was found in Mundo Nuevo Sector. It has been reared on three occasions from  Phaedropsis Solis 348 ( Crambidae) feeding on  Triplaris melaenodendron ( Polygonaceae).</p><p>Etymology. This species is named in honor of Duvalier Briceño, an ACG parataxonomist, in recognition of his contributions to the ACG tachinid fly inventory</p><p>Material.   Holotype. ♀. Deposited at EMUS. Specimen labels: 1. DHJPAR0041062. 2. Caterpillar Voucher: D. H. Janzen &amp; W. Hallwachs, DB: http://Janzen.sas.upenn.edu, Area de Conservation Guanacaste, Costa Rica, 10-SRNP-57323. Database information: Costa Rica, ACG, Guanacaste Prov., Sector Nuevo Mundo, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=-85.42567&amp;materialsCitation.latitude=10.76828" title="Search Plazi for locations around (long -85.42567/lat 10.76828)">Sendero Mora</a>, 10.76828, -85.42567, 480 (Jose Cortez) caterpillar feeding on Triplari s  melaenodendron ( Polygonaceae) coll. 12. xi.2010 wasp eclosed 20.xii.2010  .  Paratypes. 2 ♀, (MNCR). COSTA RICA, ACG database codes: 13-SRNP-57596: DHJPAR0054911 (♀);  13-SRNP-57592: DHJPAR0054907 (♀) .</p><p>Barcode. DNA barcode of female holotype DHJPAR0041062 (636 bp): TGATCAGGAACAATTGGAACTTCAACAAGTATAATTATTCGAATTCAACTTATAAATCCAATAAAACCATTAATTA TTAATGATCAAATATACAATTCTTTAGTAACAATACATGCATTTTTAATAATTTTTTTTTTAGTTATACCTACAAT AATTGGAGGATTTGGAAACTGACTAGTACCATTAATATTAGGAACACCCGATATAGCTTTTCCTCGAATAAATAAT ATAAGATTTTGACTTTTACCACCTTCAATAATTCTACTATTAATAAGTAGAATTATTAATCAAGGTCCAGGTACTG GATGAACAGTATATCCACCATTATCATCTAATATTAGTCATGAAGGAATATCAGTTGATTATGCTATTTTCTCCCT TCACATTGCAGGGTCTTCTTCAATTATAGGAGCAATTAATTTTATTACAACAATTTTTAATTTAAAAATTAAAAAT TTAAAAATAAGACAATTAAACCTCTTTTCATGATCAATTATTATTACATCAATTTTACTTCTTTTAGCTGTTCCTG TTCTTGCAGGTGCTTTAACAATACTATTTTTGATCGAAACTTAAATACATCATTCTTTGATCCATCAGGTGGAGGT GATCCAATTCTTTTTCAACATTTATTT</p></div>	https://treatment.plazi.org/id/03A3B16BFFD6FF8F63E20954FDD84AE6	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		MagnoliaPress via Plazi	Zuñiga, Ronald;Valerio, Alejandro A.;Hanson, Paul;Hallwachs, Winnie;Janzen, Daniel H.	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD5FF8E63E20B14FB844A73.text	03A3B16BFFD5FF8E63E20B14FB844A73.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Cubus gracewoodae Zuniga, Valerio & Hanson 2025	<div><p>Cubus gracewoodae Zúñiga, Valerio &amp; Hanson,  sp. nov.</p><p>(Figs. 4, 15, 20)</p><p>Diagnostic description. Female. Fore wing length 6.8–7.6 mm. Malar space about 0.6 × basal mandibular width; combined face and clypeus (from clypeal apex to level of antennal sockets) about 1.6 × as high as wide (shortest distance between the eyes); posterior ocellus separated from eye by 0.6 × its own maximum diameter; antenna with 29–30 flagellomeres. Posterior projections of ventral mesothorax flattened and sharply pointed. Coloration. Black mark on occiput reaching laterally well beyond inner eye margin, with dorsal margin of black mark diverging from eye margin; lower 0.6 of pronotum black; ventral mesothorax completely yellow; hind coxa with black mark on both internal and external surfaces; propodeum with a longitudinal black mark that is chalice-shaped (narrower near the middle); tergite I with median black line reaching middle of tergite, with posterior portion greatly expanded laterally.</p><p>Male. Similar to female.</p><p>Comments.  Cubus gracewoodae is one of three species that has the dorsal margin of black mark on the occiput diverging from eye margin (Table 1). It can be distinguished from these other two species by the size of the black mark on the lateral pronotum and the form of the black mark on the propodeum.</p><p>Hosts. This species was found in the San Cristobal, Oro, and Brasilia Sectors. It has been reared on 23 occasions from  Pantographa suffusalis and  Pantographa Solis 116 ( Crambidae) feeding on  Allosidastrum pyramidatum,  Hampea appendiculata,  Wissadula excelsior ( Malvaceae).</p><p>Etymology. This species is named in honor of Grace Wood of the Canadian National Collection of Insects, in recognition of her contributions to the ACG tachinid fly inventory.</p><p>Material.   Holotype. ♀. Deposited at EMUS. Specimen labels: 1. DHJPAR0014030. 2. Caterpillar Voucher: D. H. Janzen &amp; W. Hallwachs, DB: http://Janzen.sas.upenn.edu, Area de Conservation Guanacaste, Costa Rica, 04-SRNP-24207. Database information: Costa Rica, ACG, Guanacaste Prov., Sector Del Oro, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=-85.48669&amp;materialsCitation.latitude=11.02865" title="Search Plazi for locations around (long -85.48669/lat 11.02865)">Quebrada Raiz</a>, 11.02865, -85.48669, 280m. (Lucia Rios) caterpillar feeding on  Allosidastrum pyramidatum ( Malvaceae) coll.21.xiii.2004 wasp eclosed 16.xi.2004  .  Paratypes. 20 ♀, 2 ♂, (EMUS, MNCR, MZUCR, USNM). COSTA RICA, ACG database codes: 04-SRNP-24259: DHJPAR0014026 (♀);  04-SRNP-24261: DHJPAR0014027 (♂);  04-SRNP-24792: DHJPAR0014034 (♀);  04-SRNP-26119: DHJPAR0014053 (♀);  04-SRNP-26120: DHJPAR0014031 (♀);  04-SRNP-26125: DHJPAR0014033 (♀);  04-SRNP-26132: DHJPAR0014049 (♀);  04-SRNP-26135: DHJPAR0014042 (♀);  04-SRNP-26387: DHJPAR0014046 (♀);  04-SRNP-26394: DHJPAR0014047 (♀);  04- SRNP-26471: DHJPAR0014038 (♀);  04-SRNP-26540: DHJPAR0014051 (♀);  04-SRNP-26541: DHJPAR0014041 (♀);  04-SRNP-26547: DHJPAR0014054 (♀);  04-SRNP-26549: DHJPAR0014050 (♀);  04-SRNP-26550: DHJPAR0014048 (♀);  04-SRNP-26552: DHJPAR0014055 (♀);  05-SRNP-7853: DHJPAR0009753 (♀);  09-SRNP-23374: DHJPAR0038419 (♂);  05-SRNP-33461: DHJPAR0028562 (♀);  07-SRNP-65964: DHJPAR0023305 (♀);  13-SRNP-540: DHJPAR0051744 (♀) .</p><p>Barcode. DNA barcode of female holotype DHJPAR0014030 (660 bp): ATATTATATTTTATTTTAGGAATCTGATCAGGTACAATTGGAACTTCTACAAGTATAATTATTCGAATTCAACTTA TAAATCCAATAAAACCATTAATTATTAATGATCAAATATATAATTCTTTAGTAACAATACATGCATTCTTAATAAT TTTTTTTTTAGTTATACCTACAATAATTGGAGGTTTCGGAAATTGATTAATTCCATTAATACTAGGAACTCCTGAT ATAGCATTCCCTCGAATAAATAATATAAGATTCTGACTTTTACCCCCCTCAATAATCATATTATTAATAAGAAGAA TTATTAATCAAGGACCAGGTACTGGGTGAACTATTTACCCCCCATTATCATCAAATATTAGACATGAAGGAATATC AGTTGATTATGCTATTTTCTCCCTACATATTGCGGGATCCTCATCTATTATAGGAGCAATTAATTTTATCACAACA ATTTTTAATTTAAAAATTAAAAATTTAAAAATAAGACAATTAACTCTTTTCTCATGATCAATTATTATTACATCAA TTTTACTTCTTTTAGCTGTTCCTGTTTTAGCTGGTGCTCTAACAATATTAATTTTTGATCGAAATTTAAATACATC ATTCTTTGACCCCTCAGGAGGGGGAGACCCAATTCTTTTCCAACATCTATTC</p></div>	https://treatment.plazi.org/id/03A3B16BFFD5FF8E63E20B14FB844A73	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		MagnoliaPress via Plazi	Zuñiga, Ronald;Valerio, Alejandro A.;Hanson, Paul;Hallwachs, Winnie;Janzen, Daniel H.	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD4FF8963E20CF9FE404B78.text	03A3B16BFFD4FF8963E20CF9FE404B78.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Cubus jeffcummingi Zuniga, Valerio & Hanson 2025	<div><p>Cubus jeffcummingi Zúñiga, Valerio &amp; Hanson,  sp. nov.</p><p>(Figs. 2, 10, 21)</p><p>Diagnostic description. Female. Fore wing length 7.5–9 mm. Malar space about 0.6 × basal mandibular width; combined face and clypeus (from clypeal apex to level of antennal sockets) about 1.6 × as high as wide (shortest distance between the eyes); posterior ocellus separated from eye by 0.6 × its own maximum diameter; antenna with 32–34 flagellomeres. Posterior projections of ventral mesothorax flattened and sharply pointed. Coloration. Black mark on occiput small, barely reaching level of inner eye margin; lower 0.6 of pronotum black; ventral mesothorax completely yellow; hind coxa with black mark on both internal and external surfaces; propodeum with a longitudinal black mark that is narrower near the middle (chalice- or hourglass-shaped); tergite I with median black line reaching middle of tergite, with posterior portion greatly expanded laterally.</p><p>Male. Similar to female.</p><p>Comments.  Cubus jeffcummingi can be recognized by the combination of the small black mark on the occiput and the lateral pronotum with the ventral black area reaching beyond half the pronotal height. In one specimen (DHJPAR0050790, reared from  Desmia Solis 19) the black mark on the occiput is large, nonetheless it groups with  C. jeffcummingi in the NJ tree.</p><p>Hosts. This species was found in the San Cristobal, Orosi, Rincon Rain Forest, and Pitilla Sectors. It has been reared on 12 occasions from  Desmia ploralis DHJ 01,  Desmia Janzen 09,  Desmia Solis 19,  Syllepte Solis 22,  Trichaea pilicornis, and spiloBioLep01 BioLep498 ( Crambidae) feeding on  Faramea multiflora,  Psychotria chagrensis,  P. grandis, and  P. panamensis ( Rubiaceae).</p><p>Etymology. This species is named in honor of Jeff Cumming of the Canadian National Collection of Insects, in recognition of his contributions to the ACG tachinid fly inventory.</p><p>Material.   Holotype. ♀. Deposited at EMUS. Specimen labels: 1. DHJPAR0014089. 2. Caterpillar Voucher: D. H. Janzen &amp; W. Hallwachs, DB: http://Janzen.sas.upenn.edu, Area de Conservation Guanacaste, Costa Rica, 01- SRNP-11830. Database information: Costa Rica, ACG, Guanacaste Prov., Sector Del Oro, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=-85.45364&amp;materialsCitation.latitude=11.02991" title="Search Plazi for locations around (long -85.45364/lat 11.02991)">Mena Central</a>, 11.02991, -85.45364, 345m (Tonny Lara) caterpillar feeding on  Psychotria panamensis ( Rubiaceae) coll. 31.x.2001 wasp eclosed 30.xi.2001  .  Paratypes. 10 ♀, 1 ♂, (EMUS, MNCR, MZUCR, USNM). COSTA RICA, ACG database codes: (05- SRNP-4173: DHJPAR0009713 (♀);  06- SRNP-33766: DHJPAR0016379 (♀);  06- SRNP-33767: DHJPAR0016385 (♂);  07- SRNP-22365: DHJPAR0021637 (♀);  07- SRNP-22366: DHJPAR0021660 (♀);  09-SRNP-3191: DHJPAR0035973 (♀);  09- SRNP-3791: DHJPAR0036775 (♀);  10- SRNP-1948: DHJPAR0039367 (♀);  13- SRNP-4707: DHJPAR0053488 (♀);  13- SRNP-30943: DHJPAR0053527 (♀);  12- SRNP-5502: DHJPAR0050790 (♀) .</p><p>Barcode. DNA barcode of female holotype DHJPAR0014089 (626 bp): C AATTGGAACTTCTACAAGTATAATTATTCGAATTCAACTTATAAATCCAATAAAACCATTAATTACTAATGATCA AATATACAATTCTTTAGTAACAATACATGCATTTTTAATAATTTTTTTTTTAGTTATACCTACAATAATTGGAGGA TTTGGAAATTGATTAGTTCCATTAATATTAGGAACACCTGATATAGCATTTCCTCGAATAAATAATATAAGATTTT GACTTTTACCACCTTCAATAATTCTATTATTAATAAGTAGAATCATTAATCAAGGTCCAGGAACTGGATGAACAAT ATATCCACCATTATCATCTAATATTAGTCATGAAGGAATATCCGTTGATTATGCTATTTTTTCTCTTCATATTGCA GGATCTTCCTCAATTATAGGAGCAATTAATTTTATTACAACAATTTTTAATTTAAAAATTAAAAATTTAAAAATAA GACAATTAAATCTTTTTTCATGATCAATTATTATTACATCAATCTTACTTCTTTTAGCTGTTCCTGTATTAGCAGG TGCTTTAACAATATTAATTTTTGATCGAAATTTAAATACTTCATTCTTTGATCCATCAGGAGGGGGAGATCCTATT CTTTTTCAACATTTATTT</p></div>	https://treatment.plazi.org/id/03A3B16BFFD4FF8963E20CF9FE404B78	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		MagnoliaPress via Plazi	Zuñiga, Ronald;Valerio, Alejandro A.;Hanson, Paul;Hallwachs, Winnie;Janzen, Daniel H.	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD3FF8863E20DF5FC754825.text	03A3B16BFFD3FF8863E20DF5FC754825.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Cubus jimoharai Zuniga, Valerio & Hanson 2025	<div><p>Cubus jimoharai Zúñiga, Valerio &amp; Hanson,  sp. nov.</p><p>(Figs. 11, 13, 22)</p><p>Diagnostic description. Female. Fore wing length 7.4–8.4 mm. Malar space about 0.6 × basal mandibular width; combined face and clypeus (from clypeal apex to level of antennal sockets) about 1.6 × as high as wide (shortest distance between the eyes); posterior ocellus separated from eye by 0.6 × its own maximum diameter; antenna with 30–33 flagellomeres. Posterior projections of ventral mesothorax flattened and sharply pointed. Coloration. Black mark on occiput reaching laterally well beyond inner eye margin, with dorsal margin of black mark diverging from eye margin; lower 0.3 or 0.4 of pronotum black; ventral mesothorax completely yellow; hind coxa with black mark on external surface only; propodeum with a somewhat diamond-shaped black mark covering more than half the length of the propodeum, separated from much smaller black mark at posterior end; tergite I with black mark restricted to middle, yellow anteriorly.</p><p>Male. Similar to female.</p><p>Comments. No other species has a broken black mark on the propodeum, i.e. consisting of two parts.  Cubus jimoharai, like  C. manuelzumbadoi, has the lateral pronotum predominantly yellow, i.e. the ventral black mark covers less than half the height of the pronotum. However, the hind coxa of the former has a black mark only on the external surface, whereas the latter has a black mark only on the internal surface.</p><p>Hosts. This species was found in the San Cristobal, del Oro, Rincon Rain Forest, Santa Rosa, Pocosol, and Pitilla Sectors. It has been reared on 10 occasions from  Omiodes humeralis,  Phaedropsis Solis 03DHJ01, and  Phaedropsis Solis 348 ( Crambidae) feeding on  Inga oerstediana,  I. sapindoides,  I. vera ( Fabaceae),  Trumfetta lappula ( Malvaceae), and  Triplaris melaenodendron ( Polygonaceae).</p><p>Etymology. This species is named in honor of Jim O'Hara of the Canadian National Collection of Insects, in recognition of his contributions to the ACG tachinid fly inventory.</p><p>Material.   Holotype. ♀. Deposited at EMUS. Specimen labels: 1. DHJPAR0014068. 2. Caterpillar Voucher: D. H. Janzen &amp; W. Hallwachs, DB: http://Janzen.sas.upenn.edu, Area de Conservation Guanacaste, Costa Rica, 03-SRNP-10316. Database information: Costa Rica, ACG, Guanacaste Prov., <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=-85.26968&amp;materialsCitation.latitude=10.88068" title="Search Plazi for locations around (long -85.26968/lat 10.88068)">Sector Rincon Rain Forest, Finca Hugo</a>, 10.88068, -85.26968, 540m (Armando Rios) caterpillar feeding on  Inga sapindoides ( Fabaceae) coll. 10. ii.2003 wasp eclosed 07.v.2003  .  Paratypes. 8 ♀, 1 ♂, (EMUS, MNCR, MZUCR, USNM). COSTA RICA, ACG database codes: 99-SRNP-11316: DHJPAR0024398 (♀);  99-SRNP-11319: DHJPAR0024413 (♀);  04-SRNP-61275: DHJPAR0036920 (♂);  07-SRNP-24369: DHJPAR0027715 (♀);  07-SRNP-31220: DHJPAR0017247 (♀);  07- SRNP-34128: DHJPAR0023325 (♀);  08-SRNP-5380: DHJPAR0030305 (♀);  13-SRNP-5069: DHJPAR0053506 (♀);  99-SRNP-11314: DHJPAR0024404 (♀) .</p><p>Barcode. DNA barcode of female holotype DHJPAR0014068 (660 bp): ATATTATATTTCATTTTAGGAATTTGATCAGGAACAATTGGAACTTCTACAAGTATAATTATTCGAATCCAACTTA TAAATCCAATAAAACCATTAATTACTAATGATCAAATATATAATTCTTTAGTAACAATACATGCATTTTTAATAAT TTTTTTTTTAGTTATACCTACAATAATTGGAGGATTTGGAAATTGATTAATTCCATTAATATTAGGAACACCTGAT ATAGCATTCCCACGAATAAATAATATAAGATTTTGACTTTTACCGCCTTCAATAATTCTATTATTAATAAGTAGAA TTATCAATCAAGGCCCAGGTACTGGATGAACAGTATATCCACCTTTATCATCTAATATTAGTCATGAAGGAATATC AGTTGATTATGCTATTTTCTCACTTCATATTGCAGGATCTTCCTCAATTATAGGAGCAATTAATTTTATTACAACA ATTTTTAATTTAAAAATTAAAAACTTAAAAATAAGCAATTAACCCTTTTTTCATGATCAATTATTATCACATCAAT TTTACTTCTTTTAGCTGTTCCTGTATTAGCAGGTGCTTTAACAATATTAATTTTTGATCGAAATTTAAATACTTCA TTCTTTGATCCTTCAGGAGGAGGAGATCCAATTCTTTTTCAACATTTATTT</p></div>	https://treatment.plazi.org/id/03A3B16BFFD3FF8863E20DF5FC754825	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		MagnoliaPress via Plazi	Zuñiga, Ronald;Valerio, Alejandro A.;Hanson, Paul;Hallwachs, Winnie;Janzen, Daniel H.	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD2FF8863E20ED6FE7D4E75.text	03A3B16BFFD2FF8863E20ED6FE7D4E75.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Cubus johnstiremani Zuniga, Valerio & Hanson 2025	<div><p>Cubus johnstiremani Zúñiga, Valerio &amp; Hanson,  sp. nov.</p><p>(Figs. 1, 7, 23)</p><p>Diagnostic description. Female. Fore wing length 6.8–7.4 mm. Malar space about 0.6 × basal mandibular width; combined face and clypeus (from clypeal apex to level of antennal sockets) about 1.6 × as high as wide (shortest distance between the eyes); posterior ocellus separated from eye by 0.6 × its own maximum diameter; antenna with 28–30 flagellomeres. Posterior projections of ventral mesothorax flattened and sharply pointed. Coloration. Black mark on occiput reaching laterally well beyond inner eye margin, with dorsal margin of black mark more or less parallel to eye margin; lower 0.6 of pronotum black; ventral mesothorax with at least some black; hind coxa completely yellow, without black marks; propodeum with a longitudinal black line that is narrower than propodeal orifice; tergite I with dark mark restricted to middle, yellow anteriorly.</p><p>Male. Unknown.</p><p>Comments.  Cubus johnstiremani and  C. montywoodi are the only species having completely yellow legs, without any dark marks, not even on the hind coxa. Both species are also unique in having at least some black on the ventral mesothorax. However, they are easily distinguished by the form of the black mark on the propodeum (Table 1).  Cubus johnstiremani and  C. normwoodleyi are the only species having a very narrow longitudinal black line on the propodeum. The former differs by the absence of black marks on the hind coxa.</p><p>Hosts. This species was found in the San Cristobal, Oro, and Rincon Rain Forest Sectors. It has been reared on 12 occasions from  Ategumia lotanalis and  Rhectocraspeda periusalis ( Crambidae) feeding on  Conostegia xalapensis ( Melastomataceae),  Piper auritum,  P. peltatum, and  P. umbellatum ( Piperaceae).</p><p>Etymology. This species is named in honor of John Stireman of Wright State University, in recognition of his contributions to the ACG tachinid fly inventory.</p><p>Material.   Holotype. ♀. Deposited at EMUS. Specimen labels: 1. DHJPAR0035199. 2. Caterpillar Voucher: D. H. Janzen &amp; W. Hallwachs, DB: http://Janzen.sas.upenn.edu, Area de Conservation Guanacaste, Costa Rica, 09-SRNP-2196. Database information: Costa Rica, ACG, Guanacaste Prov., Sector Del Oro, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=-85.48817&amp;materialsCitation.latitude=11.01087" title="Search Plazi for locations around (long -85.48817/lat 11.01087)">Sendero Puertas</a>, 11.01087, -85.48817, 400m (Elieth Cantillano) caterpillar feeding on  Tapirira mexicana ( Anacardiaceae) coll. 07. vii.2009 wasp eclosed 10.vii.2009  .  Paratypes. 11 ♀, (EMUS, MNCR, MZUCR, USNM). COSTA RICA, ACG database codes: 01-SRNP-4863: DHJPAR0024414 (♀);  02-SRNP-6690: DHJPAR0014082 (♀);  04-SRNP-24731: DHJPAR0014028 (♀);  04-SRNP-24732: DHJPAR0014037 (♀);  04-SRNP-27154: DHJPAR0014052 (♀);  09-SRNP-44000: DHJPAR0035169 (♀);  09-SRNP-44146: DHJPAR0035165 (♀);  09-SRNP-44274: DHJPAR0035158 (♀);  09- SRNP-44507: DHJPAR0036003 (♀);  09-SRNP-2757: DHJPAR0036009 (♀);  10-SRNP-80898: DHJPAR0041087 (♀) .</p><p>Barcode. DNA barcode of female holotype DHJPAR0035199 (629 bp): CAGGTACAATTGGAACTTCAACAAGTATAATTATTCGAATTCAACTTATAAATCCAATAACATTAATTATTAATGA TCAAATATATAATTCTTTAGTAACAATACATGCATTCTTAATAATTTTTTTTTTAGTTATACCTACNATAATTGGA GGATTTGGAAATTGATTAATTCCATTAATATTAGGAACTCCTGATATAGCATTTCCACGTATAAATAATATAAGAT TCTGATTATTACCTCCCTCAATAATTATATTATTAATAAGTAGAATTATTAATCAAGGACCAGGTACTGGATGAAC AGTTTACCCACCATTATCATCAAATATTAGACATGAAGGAATATCAGTCGATTATGCTATTTTCTCCCTTCATATT GCAGGATCTTCTTCTATTATAGGTGCAATTAACTTTATTACAACAATTTTTAATTTAAAAATTAAAAATTTAAAAA TAAGACAATTAACACTTTTCTCATGATCAATTATTATTACATCAATTTTACTTCTACTAGCTGTACCCGTTTTAGC TGGTGCCCTAACAATATTAATTTTTGATCGAAACTTAAATACATCATTCTTTGATCCCTCCGGAGGGGGAGACCCA ATTCTATTCCAACATCTCTTC</p></div>	https://treatment.plazi.org/id/03A3B16BFFD2FF8863E20ED6FE7D4E75	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		MagnoliaPress via Plazi	Zuñiga, Ronald;Valerio, Alejandro A.;Hanson, Paul;Hallwachs, Winnie;Janzen, Daniel H.	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFD1FF8A63E20B2DFB844B78.text	03A3B16BFFD1FF8A63E20B2DFB844B78.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Cubus manuelzumbadoi Zuniga, Valerio & Hanson 2025	<div><p>Cubus manuelzumbadoi Zúñiga, Valerio &amp; Hanson,  sp. nov.</p><p>(Figs. 5, 9, 24)</p><p>Diagnostic description. Female. Fore wing length 9.3–9.8 mm. Malar space about 0.6 × basal mandibular width; combined face and clypeus (from clypeal apex to level of antennal sockets) about 1.6 × as high as wide (shortest distance between the eyes); posterior ocellus separated from eye by 0.6 × its own maximum diameter; antenna with 32 flagellomeres. Posterior projections of ventral mesothorax conical and blunt. Coloration. Black mark on occiput small, barely reaching level of inner eye margin; lower 0.3 or 0.4 of pronotum black; ventral mesothorax completely yellow; hind coxa with black mark on internal surface only; propodeum with a longitudinal black mark that is narrower near the middle (chalice- or hourglass-shaped); tergite I with median black line reaching middle of tergite, with posterior portion greatly expanded laterally, or black mark restricted to middle.</p><p>Male. Similar to female.</p><p>Comments.  Cubus manuelzumadoi and  C. curtsabrowskyi are the only two species having the posterior mesosternal projections stout and cone-like, as opposed to flat and more sharply pointed at the apex. The former can be readily distinguished by having a smaller black mark on the occiput and by lacking a black spot only on the external surface of the hind coxa (Table 1).</p><p>Hosts. This species was found in the Pitilla Sector. It has been reared on nine occasions from  Omiodes grandis ( Crambidae) feeding on an unidentified plant.</p><p>Etymology. This species is named in honor of Manuel Zumbado, formerly of INBio, in recognition of his contributions to the ACG tachinid fly inventory.</p><p>Material.   Holotype. ♀. Deposited at EMUS. Specimen labels: 1. DHJPAR0017032. 2. Caterpillar Voucher: D. H. Janzen &amp; W. Hallwachs, DB: http://Janzen.sas.upenn.edu, Area de Conservation Guanacaste, Costa Rica, 07-SRNP-30683. Database information: Costa Rica, ACG, Guanacaste Prov., Sector Pittilla, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=-85.48817&amp;materialsCitation.latitude=11.01087" title="Search Plazi for locations around (long -85.48817/lat 11.01087)">Sendero Mismo</a>, 11.01087 -85.48817, 680m (Calixto Moraga) caterpillar feeding unknown coll. 09.i.2007 wasp eclosed 23.i.2009.  Paratypes. 8 ♀, (EMUS, MNCR, MZUCR, USNM). COSTA RICA, ACG database codes: 07-SRNP-30681: DHJPAR0017030 (♀);  07-SRNP-30682: DHJPAR0017026 (♀);  07-SRNP-30685: DHJPAR0017029 (♀);  07- SRNP-30686: DHJPAR0017023 (♀);  07-SRNP-30687: DHJPAR0017031 (♀);  07-SRNP-30684: DHJPAR0017024 (♀);  07-SRNP-30688: DHJPAR0017022 (♀);  07-SRNP-30689: DHJPAR0017021 (♀) .</p><p>Barcode. DNA barcode of female holotype DHJPAR0017032 (660 bp): ATATTATACTTTATTCTAGGAATTTGATCAGGAACAATTGGAACTTCTACAAGTATAATTATTCGAATTCAACTTA TAAATCCAATAAAACCATTAATTATTAATGATCAAATATATAATTCTTTAGTAACAATACATGCATTTTTAATAAT TTTTTTTTTAGTTATACCTACAATAATTGGGGGATTTGGAAATTGATTAGTACCATTAATATTAGGAACACCTGAT ATAGCATTCCCTCGAATAAATAACATAAGATTTTGACTTTTACCTCCTTCAATAATTCTATTATTAATAAGTAGAA TTATCAATCAAGGTCCAGGTACTGGATGAACAATATACCCACCATTATCATCTAATATTAGTCATGAAGGAATATC AATTGATTACACTATCTTCTCTCTTCATATTGCAGGATCTTCTTCAATTATAGGAGCAATTAATTTTATTACAACA ATTTTTAATTTAAAAATTAAAAATTTAAAGATAAGACAATTAACTCTTTTTTCATGATCAATTATCATTACATCAA TTTTACTTTTATTAGCTGTTCCTGTATTAGCAGGCGCTTTAACAATATTAATTTTTGATCGAAATTTAAATACATC ATTTTTCGATCCTTCAGGTGGAGGTGACCCAATTCTTTTTCAACATTTATTT</p></div>	https://treatment.plazi.org/id/03A3B16BFFD1FF8A63E20B2DFB844B78	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		MagnoliaPress via Plazi	Zuñiga, Ronald;Valerio, Alejandro A.;Hanson, Paul;Hallwachs, Winnie;Janzen, Daniel H.	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFCFFF9763E2096BFB844D64.text	03A3B16BFFCFFF9763E2096BFB844D64.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Cubus montywoodi Zuniga, Valerio & Hanson 2025	<div><p>Cubus montywoodi Zúñiga, Valerio &amp; Hanson,  sp. nov.</p><p>(Figs. 3, 8, 25)</p><p>Diagnostic description. Female. Fore wing length 5.1–7.5 mm. Malar space about 0.6 × basal mandibular width; combined face and clypeus (from clypeal apex to level of antennal sockets) about 1.6 × as high as wide (shortest distance between the eyes); posterior ocellus separated from eye by 0.6 × its own maximum diameter; antenna with 26–30 flagellomeres. Posterior projections of ventral mesothorax flattened and sharply pointed. Coloration. Black mark on occiput reaching laterally well beyond inner eye margin, with dorsal margin of black mark more or less parallel to eye margin; lower 0.5 or 0.6 of pronotum black; ventral mesothorax with at least some black; hind coxa completely yellow, without black marks; propodeum with black mark somewhat variable, either an elongate triangular black mark that narrows posteriorly, or chalice-shaped; tergite I completely yellow, without obvious black mark.</p><p>Male. Similar to female.</p><p>Comments:  Cubus montywoodi and  C johnstiremani . are the only species having the legs completely yellow, without any dark marks, not even on the hind coxa. Both species are also unique in having at least some black on the ventral mesothorax. However, they are easily distinguished by the form of the black mark on the propodeum (Fig. 25 vs Fig. 23). In one specimen (DHJPAR0046772, reared from  Herpetogramma Janzen 07) the black mark on the occiput is small, not reaching laterally beyond inner eye margin, and the black mark on the propodeum is a narrow triangle not reaching the posterior margin. Because there are only three specimens of  C. montywoodi it is difficult to judge whether this deviant specimen is a distinct species or represents extreme intraspecific variation.</p><p>Hosts. This species was found in the Rincon Rain Forest Sector. It has been reared on 3 occasions from  Desmia ploralis DHJ 01,  Herpetogramma Janzen 07, and spiloBioLep01 BioLep375 ( Crambidae) feeding on  Psychotria panamensis,  Sabicea panamensis ( Rubiaceae), and  Casearia arborea ( Salicaceae).</p><p>Etymology. This species is named in honor of the late Monty Wood, formerly of the Canadian National Collection of Insects, in recognition of his contributions to the ACG tachinid fly inventory.</p><p>Material.   Holotype. ♀. Deposited at EMUS. Specimen labels: 1. DHJPAR0017255. 2. Caterpillar Voucher: D. H. Janzen &amp; W. Hallwachs, DB: http://Janzen.sas.upenn.edu, Area de Conservation Guanacaste, Costa Rica, 07- SRNP-40486. Database information: Costa Rica, ACG, Guanacaste Prov., Sector Rincon Rain Forest, Puente Rio Negro, 10.90376, -85.30274, 340m (Minor Carmona) caterpillar feeding on  Casearia arborea ( Salicaceae) coll. 16. ii.2007 wasp eclosed 18.iii.2007  .  Paratypes. 2 ♀, (MNCR). COSTA RICA, ACG database codes: (♀); 12-SRNP-67073: DHJPAR0046772 (♀),  09-SRNP-44112: DHJPAR0035164 (♀) .</p><p>Barcode. DNA barcode of female holotype DHJPAR0017255 (660 bp): ATATTATATTTTATTTTAGGAATTTGATCAGGTACAATTGGAACTTCTACAAGTATAATTATTCGAATTCAACTAA TAAATCCAATAAAACCATTAATTACTAATGATCAAATATATAATTCTTTAGTAACAATACACGCATTTTTAATAAT TTTTTTTTTAGTAATACCTACAATAATTGGAGGATTCGGAAATTGATTAATTCCTTTAATATTAGGAACACCTGAT ATAGCATTCCCACGAATAAATAATATAAGATTTTGACTTCTACCTCCTTCAATAATTTTACTATTATTAAGTAGAA TTATAAATCAAGGTCCAGGTACTGGATGAACAGTATATCCACCATTATCATCTAATATTAGTCATGAAGGAATATC AGTTGATTATGCTATTTTTTCTCTTCATATTGCAGGATCCTCTTCAATTATAGGAGCAATTAATTTTATTACAACA ATTTTTAATTTAAAAATTAAAAATTTAAAAATAAGACAATTAACCCTTTTCTCATGATCAATTATTATTACATCAA TTTTACTTCTTCTAGCTGTACCTATTCTTGCAGGAGCATTAACAATATTAATTTTTGATCGAAATTTAAATACATC ATTTTTTGACCCCTCAGGTGGAGGAGATCCAATTCTTTTCCAACATTTATTT</p></div>	https://treatment.plazi.org/id/03A3B16BFFCFFF9763E2096BFB844D64	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		MagnoliaPress via Plazi	Zuñiga, Ronald;Valerio, Alejandro A.;Hanson, Paul;Hallwachs, Winnie;Janzen, Daniel H.	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
03A3B16BFFCDFF9663E20B85FB944B9C.text	03A3B16BFFCDFF9663E20B85FB944B9C.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Cubus normwoodleyi Zuniga, Valerio & Hanson 2025	<div><p>Cubus normwoodleyi Zúñiga, Valerio &amp; Hanson,  sp. nov.</p><p>(Fig. 26)</p><p>Diagnostic description. Female. Fore wing length 6.8–7.3 mm. Malar space about 0.5 × basal mandibular width; combined face and clypeus (from clypeal apex to level of antennal sockets) about 1.4 × as high as wide (shortest distance between the eyes); posterior ocellus separated from eye by 0.5 × its own maximum diameter; antenna with 32–34 flagellomeres. Posterior projections of ventral mesothorax flattened and sharply pointed. Coloration. Black mark on occiput reaching laterally well beyond inner eye margin, with dorsal margin of black mark more or less parallel to eye margin; lower 0.6 of pronotum black; ventral mesothorax completely yellow; hind coxa with black mark on both internal and external surfaces; propodeum with a longitudinal black line that is narrower than propodeal orifice; tergite I with median black line reaching middle of tergite, with posterior portion greatly expanded laterally, or black mark restricted to middle.</p><p>Male. Unknown.</p><p>Comments.  Cubus normwoodleyi and  C. johnstiremani are the only species having a very narrow longitudinal black line on the propodeum. The former differs by having a black mark on both surfaces of the hind coxa whereas the latter completely lacks black marks on the hind coxa.</p><p>Hosts. This species was found in the Mundo Nuevo Sector. It has been reared on five occasions from  Herpetogramma Janzen 03 ( Crambidae) feeding on  Iresine calea ( Amaranthaceae).</p><p>Etymology. This species is named in honor of Norm Woodley of the U.S. National Museum of Natural History in recognition of his contributions to the ACG tachinid fly inventory.</p><p>Material.   Holotype. ♀. Deposited at EMUS. Specimen labels: 1. DHJPAR0045034. 2. Caterpillar Voucher: D. H. Janzen &amp; W. Hallwachs, DB: http://Janzen.sas.upenn.edu, Area de Conservation Guanacaste, Costa Rica, 11- SRNP-55610. Database information: Costa Rica, ACG, Guanacaste Prov., <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=-85.43313&amp;materialsCitation.latitude=10.76737" title="Search Plazi for locations around (long -85.43313/lat 10.76737)">Sector Mundo Nuevo, Estación la Perla</a>, 10.76737, -85.43313, 325m (Mariano Pereira) caterpillar feeding on  Iresine calea ( Amaranthaceae) coll. 31.v.2011 wasp eclosed 27.vi.2011  .  Paratypes. 4 ♀, (MNCR, USNM). COSTA RICA,ACG database codes: (Rearing ref. #: 11- SRNP-57143: DHJPAR0046766 (♀);  11-SRNP-57137: DHJPAR0046767 (♀);  11-SRNP-55980: DHJPAR0045033 (♀);  11-SRNP-55979: DHJPAR0045032 (♀) .</p><p>Barcode. DNA barcode of female holotype DHJPAR0045034 (661bp): AATACTATATTTTATTTTAGGGATCTGATCAGGTACAATTGGAACTTCTACAAGTATAATTATTCGAATTCAACTT ATAAACCCAATAAAACCATTAATTATTAATGATCAAATATATAATTCTTTAGTAACAATACATGCATTCTTAATAA TTTTTTTTTTAGTTATACCTACAATAATTGGAGGATTTGGAAATTGATTAGTTCCACTAATATTAGGAACCCCTGA TATAGCATTCCCACGTATAAATAATATAAGATTCTGATTATTACCCCCCTCAATAATTATATTATTAATAAGTAGA ATTATTAATCAAGGACCAGGTACTGGATGAACAATTTATCCTCCATTATCATCAAATATTAGACATGAAGGAATAT CAGTTGATTATGCTATTTTCTCCCTTCATATTGCAGGATCTTCTTCTATTATAGGAGCAATTAATTTTATTACAAC AATTTTTAATTTAAAAATTAAAAATTTAAAAATAAGACAATTAACACTTTTCTCATGATCAATTATTATTACATCA ATTTTACTTCTATTAGCCGTACCCGTTTTAGCTGGTGCTTTAACAATATTAATTTTTGATCGAAACTTAAACACAT CATTCTTTGACCCTTCAGGAGGAGGAGACCCAATTCTCTTTCAACATCTCTTC</p></div>	https://treatment.plazi.org/id/03A3B16BFFCDFF9663E20B85FB944B9C	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		MagnoliaPress via Plazi	Zuñiga, Ronald;Valerio, Alejandro A.;Hanson, Paul;Hallwachs, Winnie;Janzen, Daniel H.	Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Hallwachs, Winnie, Janzen, Daniel H. (2025): Endoparasitoid wasps of the genus Cubus (Hymenoptera, Ichneumonidae, Metopiinae) reared from caterpillars of Área de Conservación Guanacaste, Costa Rica. Zootaxa 5590 (3): 365-385, DOI: 10.11646/zootaxa.5590.3.4, URL: https://doi.org/10.11646/zootaxa.5590.3.4
