Radiatus panamensis Grishin, 2023

Zhang, Jing, Cong, Qian & Grishin, Nick V., 2023, Supplementary Materials and Appendix, Insecta Mundi 2023 (26), pp. 1-115 : 73

Radiatus panamensis Grishin , new species

https://zoobank.org/ FF987ADB-7F20-4972-9BFE-C5B24701E914

( Fig. 7 part, 177–178, 410–412)

Definition and diagnosis. Phylogenetic trees reveal that specimens from Panama that someone associated with Artines Godman, 1901 (type species Hesperia aquilina Plötz, 1882 ) are sister to South American Radiatus bradus O. Mielke, 1968 (type locality in Brazil: Distrito Federal) while being genetically differentiated from it ( Fig. 7): e.g., their COI barcodes differ by 4.6% (30 bp), and therefore represent a new species of Radiatus O. Mielke, 1968 (type species R. bradus ). This new species differs from its only close relative R. bradus by the presence of forewing discal and sometimes subapical spots, longer, dash-like postdiscal spots between veins on ventral hindwing, less prominent pale area by dorsal forewing inner margin ( Fig. 177–178), more extended harpe, longer process of ampulla, longer saccus, narrower undivided uncus, wider separated gnathos arms, and stronger bent aedeagus ( Fig. 410–412). This species is not cryptic. In DNA, a combination of the following base pairs is diagnostic in the nuclear genome: aly318.14.8:A156T, aly361.13.3:G40C, aly 2379.4.3:T30C, aly 2011.1.3:C117T, aly 2011.1.3:C192G, and COI barcode: A70G, A130T, T212C, T337C, T799A.

Barcode sequence of the holotype. Sample NVG-20053H06, GenBank OR837703, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACTTCATTAAGTTTATTAATTCGAACGGAATTAGGTAACCCAGGCTCTTTAATT GGAGATGATCAAATTTATAATACTATTGTAACTGCTCACGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATT GATTAGTTCCTTTAATACTAGGAGCTCCTGATATAGCTTTCCCACGAATAAATAACATAAGATTTTGAATATTACCACCTTCTTTAATATTATTAAT TTCAAGAAGAATTGTTGAAAATGGTGCAGGTACTGGATGAACTGTCTATCCCCCCCTTTCTTCTAATATTGCTCACCAAGGATCTTCAGTTGACTTA GCAATTTTTTCATTACATTTAGCAGGTATTTCTTCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAGAAATTTATCAT TTGATCAAATACCATTATTTGTTTGATCTGTAGGAATTACAGCATTATTACTTCTTTTATCTTTACCTGTTTTAGCTGGAGCTATTACAATACTTCT TACAGACCGAAATTTAAATACTTCATTTTTTGATCCTGCTGGAGGAGGGGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the Mississippi Entomological Museum , Starkville, MS, USA ( MEM), illustrated in Fig. 177–178, bears the following three rectangular labels, two white: [ Panama: Panama | Cerro Jefe | “elfin forest” | ca. 950 m. | N 09° 13′ 27.1″ | W 079° 22′ 32.9″ | July 31, 2010 | J. R. MacDonald], [DNA sample ID: | NVG-20053H06 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Radiatus panamensis | Grishin] . Paratypes: 2♂♂ and 1♀ from Panama, John R. MacDonald leg. in MEM: 1♂ NVG-2067 Panama: Cocle, El Valle , 800-850 m, 7-Jan-1986, John R. MacDonald leg., genitalia vial no. RAA 0212 ; 1♂ NVG-1781 Cocle, El Valle , 800-850 m, 7-Jan-1986, John R. MacDonald leg. ; 1♀ NVG-1780 Panama, Cerro Jefe , ca. 950 m, GPS 9.22419, −79.37581, 31-Jul-2010, John R. MacDonald leg.

Type locality. Panama: Panama Province, Cerro Jefe, elevation ca. 950 m, GPS 9.22419, −79.37581

Etymology. The name is given for the type locality and is an adjective.

Distribution. Known only from Panama but may be present in western Colombia.

Comment. A significant extension of the range of this formerly monotypic genus known only from South America.