Lancephallus purpurus Grishin, 2023
publication ID |
https://doi.org/ 10.5281/zenodo.10396362 |
persistent identifier |
https://treatment.plazi.org/id/03810139-FFE6-BB6A-C0CA-FC41E075B11F |
treatment provided by |
Felipe |
scientific name |
Lancephallus purpurus Grishin |
status |
new genus and new species |
Lancephallus purpurus Grishin , new genus and new species
https://zoobank.org/ 3AD6C438-4774-4FE6-9020-54F6A4A6D92E https://zoobank.org/ 7BACF558-7208-4EFE-AF4C-923515E25AE5
( Fig. 5 part, 131–134, 364–365)
Definition of the new genus. Phylogenetic analysis places specimens that agree with Evans’ unpublished (curation in BMNH only) concept of males of Phlebodes confixa (A. Butler, 1877) (type locality in Brazil: Amazonas) as a unique lineage sister to Vettius Godman, 1901 (type species Papilio phyllus Cramer, 1777 ) ( Fig. 5). This lineage is prominently separated in trees from Vettius , stronger than Vettius species within the genus, and therefore represents a new genus. This new genus is diagnosed by unique male genitalia, in particular, by the shape of the aedeagus with extended caudal end, slightly curved and terminating in a sharp point and valva with a spike-like projection from the ampulla and rounded harpe, uncus arms strongly divergent, gnathos arms convergent. Males have a bi-partite brand with a longer section along cubitus between the origins of veins CuA 1 and CuA 2 and a dash below it, below vein CuA 2. In DNA, a combination of the following base pairs is diagnostic in the nuclear genome: aly 2178.10.1:G66A, aly 2178.10.1:T109C, aly1260.24.1:G228A, aly 1019.12.6:C66T, aly 1019.12.6:G78A.
Type species. Lancephallus purpurus Grishin , new species.
Species included in the genus. Only the type species.
Parent taxon for the genus. Subtribe Moncina A. Warren, 2008
Definition of the new species. While we have not sequenced true P. confixa View in CoL , females of Lancephallus that were associated with males by DNA sequencing (and specimens in copula in BMNH) do not resemble the only known P. confixa View in CoL syntype, a female, in having sharply defined pale spots on the ventral hindwing, which has a strong purple sheen and slightly paler veins. Therefore, this species of Lancephallus is new. In wing patterns, it is uniquely different from all of its closest relatives in Vettius View in CoL , its sister genus. The only similarly patterned species formerly associated with Vettius View in CoL was Phlebodes fuldai (E. Bell, 1930) (type locality in Colombia), now transferred to its rightful genus Phlebodes Hübner, [1819] View in CoL (type species Papilio pertinax Stoll, [1781] ) ( Zhang et al. 2022b), which Lancephallus resembles. However, Lancephallus and Phlebodes View in CoL are not closely related to each other ( Fig. 5, 6). This new species is identified by chestnut-brown wings with small and narrow (in males) yellowish forewing spots in cells CuA 1 -CuA 2 and M 3 -CuA 1, and in some specimens, one to three subapical dots, spots are larger and paler in females who may have a spot in upper discal cell beneath; ventrally with strong purple sheen, especially on hindwing that has variously developed postdiscal pale dots and a dot in the center, veins are paler. In DNA, a combination of the following base pairs is diagnostic in the COI barcode: T38C, A184T, A208T, A334C, A532C.
Barcode sequence of the holotype. Sample NVG-19021F03, GenBank OR837684, 658 base pairs: AACTTTATATTTTATTTTTGGAATCTGAGCAGGAATACTAGGAACTTCTTTAAGTTTATTAATTCGTTCAGAATTAGGAAATCCAGGTTCATTAATT GGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGTTTTGGAAATT
GATTAGTACCTCTTATATTAGGAGCCCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTCTGAATACTTCCCCCCTCATTAATATTATTAAT TTCAAGAAGAATTGTAGAAAATGGTGCAGGAACTGGATGAACCGTTTACCCCCCTCTTTCTTCTAATATTGCTCATCAAGGATCTTCAGTAGATTTA GCTATCTTTTCCCTTCATTTAGCAGGAATTTCATCTATTCTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAAAAATTTATCTT TTGATCAAATACCTTTATTTGTATGATCAGTAGGAATTACTGCACTCTTATTACTTTTATCTTTACCTGTATTAGCAGGAGCTATTACTATACTTTT AACAGATCGAAATTTAAATACTTCATTTTTTGATCCAGCAGGAGGAGGAGATCCTATTCTATATCAACATTTATTT
Type material. Holotype: ♂ deposited in the National Museum of Natural History , Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 131–132, bears the following five rectangular labels, four white: [ GUYANA: Cuyuni R, | Kamaria Falls 100′ | 30.XI.–5.XII.2000 | 6° 24′N 58° 54.6′W | Leg. S. Fratello et al] ( GPS given as “546′W”), [DNA sample ID: | NVG-19021F03 | c/o Nick V. Grishin], [{QR Code} | USNM ENT 00275117 View Materials ], and one red [HOLOTYPE ♂ | Lancephallus | purpurus Grishin ] GoogleMaps . Paratypes: 5♂♂ and 2♀♀: 1♂ Colombia / Venezuela border, Orinoco River , Maipures, Dec-1898, Cherrie leg. [ BMNH] ; 1♂ Venezuela, Suapure , 2-Mat-1899, Klages leg. [ BMNH] ; 2♂♂ NVG-18098F02, H15049 and (not sequenced) H15046 French Guiana , Bagne des Annamites, GPS 4.8333, −52.5167, H. Crampette leg., 12-Jul-1998 [BHermier], 1♂ and 1♀ in copula, Guyana 1962–3 [ BMNH] GoogleMaps ; 1♀ NVG-19024B11, USNM ENT 00275122 View Materials Guyana: Acarai Mts. , Sipu River, elevation 900 ft, GPS 1.4183, −58.9533, 24-Oct-12-Nov-2000, S. Fratello et al. leg. [ USNM] ( Fig. 133–134) GoogleMaps .
Type locality. Guyana: Cuyuni-Mazaruni Region, Cuyuni River, Kamaria Falls, approx. GPS 6.40, −58.91.
Etymology. In Latin, lancea means spear, lance, or pike. The name is given for the spear-shaped aedeagus (phallus), and the species epithet is for the extensive purple sheen on the ventral side of the wings. The name of the genus is a masculine noun in the nominative singular, and the species name is a masculine adjective.
Distribution. Venezuela, Guyana, and French Guiana.
USNM |
Smithsonian Institution, National Museum of Natural History |
R |
Departamento de Geologia, Universidad de Chile |
V |
Royal British Columbia Museum - Herbarium |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Kingdom |
|
Phylum |
|
Class |
|
Order |
|
Family |
|
Genus |