Scapholeberis duranguensis, Quiroz-Vázquez, Patricia & Elías-Gutiérrez, Manuel, 2009
|
publication ID |
https://doi.org/ 10.5281/zenodo.190439 |
|
DOI |
https://doi.org/10.5281/zenodo.5625599 |
|
persistent identifier |
https://treatment.plazi.org/id/03A487C6-FFC2-A656-FF65-FC75028BEDAD |
|
treatment provided by |
Plazi |
|
scientific name |
Scapholeberis duranguensis |
| status |
sp. nov. |
Scapholeberis duranguensis View in CoL n. sp.
Type Locality: El Chupadero is a small and shallow temporal pond located at 24º 08’ 09.1’’ N and 104º 42’ 43.2’’ W in the south semi-desert region of Durango State, Mexico. At the time of sampling the pond had a total depth of 0.5m, temperature of 17.8ºC, pH of 7.8, conductivity of 0.264mS/Cm and a Secchi depth of 0.4m.
Etymology: This species is named after its terra typica, Durango State, Mexico.
Holotype: Adult ephippial female in 96% ethanol with addition of a drop of glycerol. Total length 0.64mm, height 0.44mm. Access number, ECO-CH-Z 0 3831.
Paratypes: Two ephippial females (one dissected) mounted in Hoyer´s solution, sealed with Enthellan mounting medium ( ECO-CH-Z 0 3835, 03839). One ephippial female preserved in 96% ethanol and glycerol ( ECO-CH-Z 03841), one parthenogenetic female in 96% ethanol and glycerol ( ECO-CH-Z 03832). Five parthenogenetic females, (one dissected) mounted as above ( ECO-CH-Z 0 3833, 0 3834, 03836-03838). In addition, two parthenogenetic females preserved in 96% ethanol and glycerol, and one ephippial female preserved as above ( CNCR 25880) deposited at Instituto de Biología (Universidad Nacional Autónoma de México, UNAM).
Diagnosis. Medium-sized daphniids. Parthenogenetic females around 0.6 (0.59 ± 0.09) mm, body ovoid (height /length = 0.55-0-69, n=20). Large and bilaterally ridged head with a pore-like structure at the top ( Figure 1 View FIGURE 1 A and B). Well-developed and rounded rostrum ( Figure 3 View FIGURE 3. S D) with the so-called rostral pore. Ventral rim of valves infolded, supplied with cilia that ramify to form an adhesive sucker-plate ( Figure 3 View FIGURE 3. S A). Ventroposterior corner of valves angular, forming a well-defined mucro of medium length ( Figures 1 View FIGURE 1 D and 3A). Posterior rim of valves with a thick double membrane. Upper membrane denticulate ( Figure 1 View FIGURE 1 G, H). Both, the head and the valves with fine reticulation ( Figure 1 View FIGURE 1 A, D). Postabdomen robust, rectangular and with ventral margin slightly curved ( Figure 3 View FIGURE 3. S G). Postabdomen claw with three successive bilateral pectens of different size. Antennule short, with eight terminal esthetascs and a lateral sensory seta. Antenna short, with a foursegmented exopod and a three-segmented endopod. Five trunk limbs of general daphnid shape. Endopodite of trunk limb I with a brush-like seta. Ephippium with a single egg.
Description. Head large, (slightly less than a third of the total length), bilaterally ridged, reticulated and with a pore-like structure at the top ( Figure 1 View FIGURE 1 A), not visible in all studied specimens. Well-developed and rounded rostrum with a pore that opens near its tip ( Figure 3 View FIGURE 3. S D). This pore is present in majority of anomopods ( Kotov 1996) and is called rostral or frontal pore. Globular eye and elongated ocellus.
Antennule short and rectangular with eight terminal aesthetascs cylindrical and similar in length ( Figure 3 View FIGURE 3. S C). There is a thinner lateral sensory seta similar in size to the aesthetascs.
Antenna with four-segmented exopod and three-segmented endopod ( Figure 3 View FIGURE 3. S F). First exopod segment relatively short (approx. one third of the second segment). Second segment slightly shorter than the next and with a spine at distal margin. Last two segments of similar size. First endopod segment slightly longer than the other two. First and second endopod segments with a long internal-lateral seta. Three long setae at each apical segment of the endopod and exopod.
Postabdomen robust, rectangular and with ventral margin slightly curved ( Figure 2 View FIGURE 2 G, 3G). The total length is approximately three times the height. Preanal portion approximately one third of the total length. Ventral face with two lateral rows of five spines, similar in size. Following the last spine there are two bunches of mid length cilia.
Postabdominal claw slightly shorter than the preanal portion ( Figure 2 View FIGURE 2 G, H and 3G). With three pectens (rows of spinules) at each side. The external pecten has only four spines gradually increasing in size. The medium pecten starts at the base of the claw and extends to a bit less than half of it. The internal one starts at the last third of the mid pecten and extends to the tip of the claw.
Mandible with rectangular distal end ( Figure 3 View FIGURE 3. S B) and the basal third of body incurved. Masticatory surface with a row of about seven thick and short teeth.
Trunk limb I (P1). Exopod with two not-segmented, apical setae, the first one half as long as the second one ( Figure 4 View FIGURE 4. S A). Distal two thirds of both setae with two rows of long and thick cilia in the ventral face. Transversal row of cilia in the middle of both setae. Endopod with three apical setae. The longest seta with very short cilia bilaterally arranged in more than half of its total length. The second seta two thirds as long as the first one and with an apical tuft of long and thick cilia. The third seta is brush-shaped and slightly shorter than the previous one. Endite 1 with four setae, endites 2 and 3 with two setae each. All setae on endites are similar in length, shape and cilia arrangement. The base of such setae, which represents approximately a third of the total length, is wider than the apical part and has a bilateral arrangement of long and fine cilia. The apical part has two rows of medium-sized thick cilia in the ventral face. All endites with an accessory seta similar in structure to the ejector hooks but slightly shorter. Long ejector hooks with apical arrangement of cilia are just below the base of endite 1. Accessory seta at the external face of base of limb body.
Trunk limb II (P2). Exopod with two apical feather-like setae, the first one is twice as long as the second one ( Figure 4 View FIGURE 4. S B). Endopod with five apical setae similar in size. Setae 2-5 serrated from base to tip and the first one (1) is feather-like with a bilateral arrangement of long and thin cilia from base to tip. Additionally there is a thin and feathered seta that arises from the base of the fifth seta. Near this setae there is also a pair of appendages that arise from the base of the exopod, one of them apical and with ventral short cilia in the distal two thirds, the second one is a naked structure, half as long as the previous one and with a rounded tip. Gnathobase with eight setae ( Fig 4 View FIGURE 4. S C). The longest one has two ventral rows of long cilia that extend from base to tip. The second seta is finger-like and it is approximately two thirds as long as the first one. It is a naked seta but it has two ventral rows of thick spine-like structures in the upper half. The third seta is apical, slightly shorter than the previous one and with a transversal row of thick and long cilia in the middle and with two ventral rows of short and thick cilia from the mid part to the tip. The remaining five setae are similar in shape and cilia arrangement to the previous one and with a gradual increase in length.
Trunk limb III (P3). Exopod with four apical and two lateral feathered setae ( Figure 4 View FIGURE 4. S E). The two lateral setae are of mid length and bilaterally covered with thin and long cilia from base to tip, the second of such pair of setae is about half as long as the first one. The first two apical setae (1 and 2) are similar in shape and cilia arrangement to the lateral ones but thinner and longer. The second seta slightly shorter than the first one. Setae 3 and 4 with the lower third covered with long and thin cilia and the upper two thirds with very short and fine cilia. Gnathobase with numerous (about 24) long, bisegmented and thin setae similar in shape and size. All setae with a bilateral arrangement of very short and thin cilia from base to tip. Last distal setae are more internally placed than the others. There are four endites, each with at least 2 ciliated setae, between the exopodite and the gnathobase.
Trunk limb IV (P4). Exopod with four apical and two lateral setae. The two lateral setae are of mid length and bilaterally covered with thin and long cilia from base to tip, the second of such pair of setae is longer than the first one ( Figure 4 View FIGURE 4. S F). The first three apical setae (1 to 3) are similar in shape and cilia arrangement to the lateral ones but thinner and longer and show a decrease in length. Seta 4 different in shape from the others. It has a wider and well defined base which is slightly less than half of the total length. Such a base is laterally covered with long cilia and with shorter cilia in the upper ring. The upper portion of the seta is narrower and without cilia. Gnathobase with two rows of setae (one external and one internal), similar in shape to those of P3’s gnathobase. The external set has ten setae while the internal one has five. There is an endite between the gnathobase and the exopod.
Trunk limb V (P5). Endopod with a long, bisegmented and densely ciliated seta ( Figure 4 View FIGURE 4. S G). A finger-like structure at the base of this seta is approximately half as long as the base portion of such a seta. Exopod with two shorter ciliated setae. The first one bisegmented and a third longer than the second one. There is a long feather-like proximal setae at the base of the exopod.
Differential diagnosis: The main morphological characters that differentiate S. duranguensis n. sp. from S. armata freyi are: (1) a double and thicker membrane at the posterior rim of valves, (2) lower number (8 compared to 9) of setae in the gnathobase of trunk limb II (see Figures 4 View FIGURE 4. S C and D), (3) longer and more rectilinear ejector hooks on trunk limb I, and (4) the presence of a pore-like structure at the top of the head (not a definitive character). The average length of the mucro in proportion to the length of the valves in S. duranguensis (1/5) is significantly higher (p<0.001, n=8) than in S. armata freyi (1/7). The size of the adult specimens (females) is also significantly different (p<0.01, n= 20) between the two species. The average length for 20 individuals of S. armata freyi is 0.45 mm ± 0.05mm whereas in S. duranguensis it is 0.6 mm ± 0.09 mm.
The main differences between S. duranguensis n. sp. and S. armata armata were the lack of a hyaline membrane and a thinner membrane at the posterior rim of the valves in the latter, as well as the average size of the organisms. S. armata armata is noticeably larger (0.82 mm, n=7) than S. duranguensis n. sp. The relative length of the mucro in S. armata armata is significantly lower (1/7) than in S. duranguensis n. sp (1/5).
Differences of our new species from other species include the arrangement of the denticulate membrane at the posterior rim of the valves, an important feature for taxonomic discrimination according to Dumont and Pensaert (1983).
Distribution: S. duranguensis n. sp. is known only from its type locality.
Molecular Sequences (CO1): Sequences of the gene CO1 used for barcoding by the BOLD (www.boldsystems.org) informatics data base were obtained from three topotypes of the new species. All of them are published in the project " Cladocera of Mexico " in BOLD. The average divergence between the three sequences was 0.54±0.03%, with a maximum of 0.61%.
Average divergence between the three specimens of S. armata freyi used for comparison was 0.35 ± 0.06%, with a maximum of 0.62%.
Below are the differences in the nucleotide composition of the COI sequence between S. armata freyi (ZPLMX096-06) and S. duranguensis n. sp. (ZPLMX144-06).
* 20 * 40 * 60
ZPLMX096-06: GACATTATATTTTATTTTTGGAGTCTGATCTGGTATAGTAGGAACTGCTTTAAGAATGTT: 60 ZPLMX144-06: .....................G..A...................................: 60 * 80 * 100 * 120
ZPLMX096-06: AATCCGAGCAGAATTAGGTCAAGCTGGAAGTTTAATTGGGGATGATCAGATTTATAATGT: 120 ZPLMX144-06: ...T........G........G.....G..C........A........A........C..: 120 * 140 * 160 * 180
ZPLMX096-06: AGTTGTTACAGCCCACGCGTTTGTCATAATTTTCTTTATAGTTATACCAATCATGATTGG: 180 ZPLMX144-06:.A.C...........T........G.....C..T..........................: 180 * 200 * 220 * 240
ZPLMX096-06: GGGGTTCGGTAATTGATTAGTTCCTCTAATGTTAGGCGCCCCTGACATAGCTTTTCCGCG: 240 ZPLMX144-06: ...C..T.........C....C.........C....T........T...........T..: 240 * 260 * 280 * 300
ZPLMX096-06: ATTAAATAACTTAAGTTTTTGGTTTCTTCCCCCCGCTTTAACTTTACTTTTAGTTGGAGG: 300 ZPLMX144-06: ..........C.......C...........T..T....................A..G..: 300 * 320 * 340 * 360
ZPLMX096-06: GGCGGTAGAAAGTGGGGCTGGAACTGGGTGAACCGTTTACCCGCCCTTGTCAGCAGGAAT: 360 ZPLMX144-06: ...T...........A....................C.....T.....A........G..: 360 * 380 * 400 * 420
ZPLMX096-06: TGCTCACGCCGGAGCATCAGTTGATCTAAGAATTTTCTCTCTTCACTTAGCAGGGATTTC: 420 ZPLMX144-06: ...C..T..T..............C...........T..C........G...........: 420 * 440 * 460 * 480
ZPLMX096-06: TTCTATTTTAGGGGCTGTTAATTTTATTACTACTATCATTAATATACGATCGGAGGGAAT: 480 ZPLMX144-06: ..........................................C........A..A..G..: 480 * 500 * 520 * 540
ZPLMX096-06: GTCTTTAGACCGAATTCCGTTATTTGTATGAGCAGTGGGAATTACAGCTCTTCTTTTACT: 540 ZPLMX144-06: ...C.....T...........G........G.....A..G..C........C........: 540 * 560 * 580 * 600
ZPLMX096-06: TTTAAGTCTTCCCGTGCTAGCTGGTGCAATCACAATGCTTCTTACAGATCGAAATTTAAA: 600 ZPLMX144-06: ...............A.................G.....CT.A.................: 600 * 620 * 640 *
ZPLMX096-06: TACTTCGTTTTTTGACCCTGCTGGGGGAGGAGATCCTATTCTTTACCAGCATCTTTTC: 658 ZPLMX144-06: ............C.................G..C..A...T....T..A.........: 658 Figure 5 View FIGURE 5 shows the ID tree of the several Scapholeberis used for comparison in this study (see Table 2 View TABLE 2 ). Main variation in the sequences of S. duranguensis was in the GC% of the first codon position, in which such a percentage varied from 27.4 to 29.5. In S. armata freyi , the main variation was in the GC% of the third codon position, in which it was from 25.5 to 27. The main total variation in both species was given by the C%.
In S. duranguensis this percentage varied from 18.8 to 20.5 whereas in S. armata freyi it varied from 18.24 to 19.55.
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.