Paranerita maculata sandeepani

Grados, Juan, 2018, Four new species and one new subspecies of Arctiinae (Lepidoptera: Erebidae) from the Tambopata river, Madre de Dios, Peru, Zootaxa 4434 (1), pp. 29-48: 40-42

publication ID

https://doi.org/10.11646/zootaxa.4434.1.2

publication LSID

lsid:zoobank.org:pub:BBD0A5B9-B363-4802-8F2B-78C0209C08D5

persistent identifier

http://treatment.plazi.org/id/03CA3555-8876-D170-51A4-23C4FE68F873

treatment provided by

Plazi

scientific name

Paranerita maculata sandeepani
status

ssp. nov .

Paranerita maculata sandeepani  ssp. nov  .

( Figs. 31–38View FIGURES 31–34View FIGURES 35–38)

Holotype male ( Figs. 31–32View FIGURES 31–34): PERU, Madre de Dios, Albergue Refugio Amazonas, 12°52'30''S, 69°24'35''W, 231m, 22.x.2016 (J. Grados & D. Couceiro)GoogleMaps  . 3 paratypes (2 males and 1 female): PERU, Madre de Dios  , 1 female, Albergue Refugio Amazonas, 12°52'30''S, 69°24'35''W, 231m, 15.iii.2016 (D. Couceiro)GoogleMaps  ; 1 male, idem except, 20.v.2016; 1male, idem except 02.x.2016.

Diagnosis (male): Small species (11 mm), with yellowish red head. Thorax brown with yellow and red spots. Forewings brown with red edged yellow spots. Hindwings red with brown external margin which does not reach the anal angle. An expansion of the tornus heads towards the back and presents a fold in the inner margin. The internal margin also bears an elongated patch of brown scales on its ventral side.

Description male ( Figs. 31–32View FIGURES 31–34) and female ( Figs. 33–34View FIGURES 31–34). Forewing span: 11 mm in males (n=3), 12 mm in female (n=1. Head: Frontoclypeus yellow, with a brown cross line. At the base of the antennae, with scattered red scales. Vertex yellow, with posterolateral parts with red spots, which project forward until reaching the base of the antennae. Palpi yellow, with red scales on the external side of the first segment and on the dorsolateral side of the three proximal quarters of the length of the second segment. Antennae with rami reduced with scape and pedicel both yellow. Red scales in the proximal fifth and, in the distal third with white scales. Thorax: Brown. Patagia with red scales on the anterior part, from the middle of the area and towards the mesal margin. Tegula with red scales towards the posterior part. Two yellow spots edged in red, located in the central and mesal part of the mesoscutum. Presence of yellow and red hairs between the metascutum and metascutellum. First pair of legs yellow, with the proximal half of the dorsal side of the femur with a red line and the distal end with a red dot. Dorsal side and mesal middle margin red. Tibia dorsal side red; and on the ectal margin, almost from the middle to the distal end brown. Second and third pair of legs, yellow. Forewing: Dorsal surface brown with cream spots and red contours: an oblong spot near the base of the wing and below the basal part of the Cu, projecting obliquely, being narrower, towards the outside of the wing, reaching the basal part of the discal cell, crosses the R obliquely towards the base of the wing, reaching the costal margin; a larger spot below the intersection of Cu and Cu1 extends toward the base of cell M3-Cu1, from where it divides, extending the first branch toward the termen and covering the proximal two – thirds of cell M2-M3 and which connects with a small spot that is at the distal end of the cell M3-Cu1 and reaches the termen; the other branch ascends with the discal cells internal limit, reaches the intersection of R and M1, where it becomes narrower, and then reaches the costal margin, from where a thin red line arises and goes along the margin and towards the apex without reaching it; a rounded spot in the center of the anal cell which reaches the posterior margin; a small spot on the distal end of Cu1-Cu2; a tiny spot at the distal end of cell M1-M2, reaching the termen; a somewhat elongated red spot on the distal end of cell R4-R5 and another near the base of cell R5-M1. An elongated red spot at the base of anal cell. The apex presents yellow and reddish scales. Ventral surface with the same pattern as the dorsal side with the brown background and the spots of red contours, only these are yellow instead of creamy; mesal area and posterior margin yellow. Unlike the dorsal side, the following is not observed: the rounded spot in the center of anal cell, which reaches the posterior margin; the elongated red spot at the base of anal cell; the elongated red spot on the distal end of cell R4-R5 and the another near the base of cell R5-M1. Hindwing: Dorsal surface red, with costal margin yellow and brown termen In females, the brown band in the termen is wider. Tornus expanded posteriorly with a lobulated shape, and a fold in the inner margin. In females, does not show the expansion. Ventral surface yellow, with an elongated oval patch of brown scales in the fold of the inner margin. In females, does not have the elongated oval patch. Abdomen: Red, with yellow scales. In the distal part of the last sternite with yellow scales. Creamy yellow ventral side. Male genitalia ( Figs. 35–38View FIGURES 35–38) (Genitalia # JGA 762): Saccus wide and slightly curved towards the right side in dorsal view. Tegumen wide towards posterior end, with each side of triangular shape. On the external posterior side, it forms an angle of almost ninety degrees with the distal margin, which is wide and where the uncus emerges. On the lateral sides of this distal margin, it presents two small sclerosed pointed projections. Uncus slender, curved towards the ventral side. The end has a small curvature. Long valvae with the edges of the sacculus and the costa parallel, thinning towards the distal end. Juxta wide in the anterior part and thinning towards the end. Aedeagus elongated and curved upward dorsally. Caecum penis small. Vesical short with small spicules.

Etymology: sandeepani  is a singular genitive noun, dedicated to Dileep Sandeepan for having collected the first specimen at the Refugio Amazonas Lodge.

Distribution: Known only from the department of Madre de Dios, southeast of the Peruvian Amazon.

Barcoding: The access number to Genbank is MG837876View Materials. The mitochondrial DNA sequence ( COI) of one of the paratypes is as follows (Voucher MUSM – Arctiinae  VB # 67):

AACTTTATATTTTATTTTTGGTATTTGAGCTGGAATAGTAGGAACTTCATTAAGTTTATTAATTCGAGCTG AATTAGGAAATCCTGGATCCTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCACATGCTTT CATTATAATTTTCTTTATAGTTATACCAATTATAATTGGAGGATTTGGTAATTGATTAGTTCCATTAATATT AGGAGCCCCAGATATAGCCTTCCCTCGAATAAATAATATAAGTTTTTGATTATTACCCCCTTCCTTAACT CTTTTAATTTCAAGAAGAATTGTAGAAAACGGTGCTGGAACTGGATGAACTGTTTACCCCCCTCTTTC TTCTAATATTGCCCATGGAGGAAGATCAGTAGATCTAGCTATTTTTTCCCTTCATTTAGCTGGAATTTCT TCAATTTTAGGAGCAATTAATTTCATTACTACAATTATTAATATACGATTAAATAACTTATCATTTGATCA AATACCTCTATTTGTGTGAGCTGTAGGAATTACAGCATTTTTATTATTACTTTCATTACCTGTTTTAGCTG GAGCTATTACTATGTTATTAACTGATCGAAATTTAAATACTTCTTTTTTCGACCCTGCTGGGGGAGGAG ATCCAATTCTTTATCAACACTTATTT

Remarks: As I pointed out for the previous species, reviewing the genitalia morphology of Paranerita polyxenus Druce  and Trichromia onytes Cramer  , and being these the type species for each respective genera, significant differences can be observed, making it unlikely that they belong to the same genus, hence I do not consider both genera to be synonyms. For these reasons, I maintain the species maculata  within the genus considered by Watson & Goodger (1986).

Regarding Evius maculata maculata ( Rothschild, 1909)  it was described from a female from Fonte Boa, Amazonas ( Brazil) and transferred to Paranerita  by Watson & Goodger (1986). Based on females, we observed that the Paranerita maculata sandeepani  has the large, creamy spot that starts below the intersection of Cu and Cu1 extending towards the base of cell Cu1, where it divides. The first branch extends towards the termen, covering the proximal two thirds of the cell M2 and connects with a small spot situated on distal end of cell M3 and which reaches the term, without interruptions until reaching the termen. In maculata maculata  the large spot appears discontinuously, formed by three spots separated by brown areas. The main spot emerging at the intersection of Cu and Cu1, as it ascends has a constriction at the lower angle of the discal cell and does not extend into cell M3. The pattern of the Paranerita maculata sandeepani  is also true for males, this being the first time that males of this species have been described.

PERU

Universit� di Perugia

DNA

Department of Natural Resources, Environment, The Arts and Sport

COI

University of Coimbra Botany Department

Kingdom

Animalia

Phylum

Arthropoda

Class

Insecta

Order

Lepidoptera

Family

Arctiidae

Genus

Paranerita

Loc

Paranerita maculata sandeepani

Grados, Juan 2018
2018
Loc

Paranerita maculata sandeepani

Grados 2018
2018
Loc

Paranerita maculata sandeepani

Grados 2018
2018
Loc

Evius maculata maculata (

Rothschild 1909
1909
Loc

Paranerita

Hampson 1901
1901