Bunops cf. serricaudata (Daday, 1884)
|
publication ID |
https://doi.org/ 10.11646/zootaxa.4300.4.7 |
|
publication LSID |
lsid:zoobank.org:pub:0ED749DE-AC2F-466E-87BD-445DA22842AC |
|
DOI |
https://doi.org/10.5281/zenodo.6008981 |
|
persistent identifier |
https://treatment.plazi.org/id/03FB87BD-D87C-FFC6-1AAE-8AE2AF2AE7BF |
|
treatment provided by |
Plazi |
|
scientific name |
Bunops cf. serricaudata (Daday, 1884) |
| status |
|
Bunops cf. serricaudata (Daday, 1884) View in CoL
( Figs. 1–5 View FIGURE 1 View FIGURE 2 View FIGURE 4 View FIGURE 5 )
Description. Parthenogenetic female. Shape and valves ( Figs. 1 View FIGURE 1 A, 3B–E). Semi-circular in lateral view (length: 0.69± 0.1 mm; height: 0.53± 0.08 mm; N=11), strongly flattened laterally in anterior view. The dorsal margins of the valves are coalesced forming a curved, arched, well-developed keel extending from the head to the posterior dorsal corner, forming a small, rounded projection. Ventral margin armed with 18–21 spines (N=11). From the middle of the ventral side of the valves, the spines are submarginal and increase in length proximally. Between the long spines, there is a row of small spinulae inserted sub-marginally ( Fig. 2 View FIGURE 2 E). Internal ventral part of the valves with a row of long setae that goes inside, forming a broad curve that becomes more marginal towards the posterior side (Fig. 3C–D). Hook setae curved towards the dorsal side, followed by a row of small spinulae. The valve ornamentation consists of small spinulae arranged in polygons (Fig. 3E).
Head ( Figs. 1 View FIGURE 1 A, 3B). Small in proportion to the size of the animal, triangular, in lateral view with a depression in the rostral region. Compound eye projecting in the dorsal margin. Ocellus smaller than compound eye, near to the tip of rostrum. Head-pore projected and round. Ventral margin of head smooth. Labrum with a widened proximal side, triangular in shape, with a rounded tip (Fig. 3F).
First antenna ( Figs. 1 View FIGURE 1 C–D) long, cylindrical, slightly tapering at the distal end ( Fig.1 View FIGURE 1 C), with two setules on the last third and two more at a half distance from these to the tip. Nine terminal aesthetascs of different length ( Fig. 1 View FIGURE 1 D).
Second antenna ( Figs. 2 View FIGURE 2 A–B). Basipod internal with two sensory setae on the proximal part and one on the distal, all of them bi-segmented (Fig 3B). A small spine on the distal external side ( Fig 2 View FIGURE 2 B; 3A–B). Swimming seta: 0-0-0-3/1-1-3; spines: 0-1-0-2/0-0-1, very thin and fine. Each segment of both branches with a row of fine spinulae on the distal end. Largest seta thin, bi-segmented, unilaterally setulated with fine spines on both segments.
Postabdomen ( Figs. 2 View FIGURE 2 C–D; 3G–H) oval-acute in lateral view, bilobed. Preanal portion with numerous rows of spines similar in length. Anus surrounded by rows of spinulae. Postabdominal claw curved, with lateral teeth (Fig. 3H). Two postabdominal setae long, slim, biarticulated, with a long distal segment, more than one-third of the total length, covered by thin setulae ( Fig. 2 View FIGURE 2 D). Before the postabdominal setae, there is a rounded abdominal process with short and stiff hairs ( Fig. 2 View FIGURE 2 C).
Trunk limb I ( Figs. 4 View FIGURE 4 A–C). EX (ODL), bearing a long apical seta, bi-segmented; unilaterally setulated at its distal part and a short lateral seta ( Fig. 4 View FIGURE 4 C). EN 4 (IDL) with three setae of different size, the longest bi-segmented and unilaterally setulated at its distal segment; the middle seta is robust hook-shaped, not segmented and unilaterally setulated at its distal segment ( Fig. 4 View FIGURE 4 C); the smaller, strong, not segmented, unilaterally setulated at its middle portion ( Fig. 4 View FIGURE 4 C). Endite 3 (E3) with four setae; seta 1 long, not segmented, unilaterally setulated, with setulae decreasing in size distally ( Fig. 4 View FIGURE 4 A); seta 2 shorter and thinner than seta 1, segmented and bi-setulated ( Fig. 4 View FIGURE 4 A); seta 3, shorter than seta 2, bi-segmented, wider in the first third with long setulae on both sides of it, next twothirds narrower and bilaterally setulated with setulae decreasing in size distally; seta 4 slightly longer and wider than seta 3, bi-segmented, with the same kind of ornamentation. Between E3 and E2 there is a long, thin seta (S in Fig 4 View FIGURE 4 A). Endite 2 (E2) with three bi-segmented setae, unilaterally setulated at their distal segment and long, thin setulae in the proximal segment (5-7). Endite 1 (E1) with three setae; seta 8 and 9 long, segmented, bilaterally setulated along the last two-thirds; seta 10 long and thin, bi-segmented, bilaterally setulated at distal segment. Next to it, a short seta, with a hairless base and long setulae on both sides of the distal, thinner portion (arrow in Fig. 4 View FIGURE 4 A); E1 has a trident-shaped seta with three teeth, the middle one is wider and with small teeth on both sides ( Fig. 4 View FIGURE 4 B). Two ejector hooks, each with small denticles on both sides.
Trunk limb II ( Figs. 4 View FIGURE 4 D). EX oval, covered with small and numerous fine hairs with a long, thin bi-segmented seta, inserted towards one side, armed with thin setulae on both sides inserted sub-distally ( Fig. 4 View FIGURE 4 D). EN with eight stout and bi-segmented scrapers; scraper 1 and scraper 2 of the same size, longer and slender than the others, unilaterally setulated at their distal segment; the other six, decreasing in size proximally, with strong teeth on their distal segment; behind scraper 8, a sensillum strongly setulated at its distal portion (arrow in Fig. 4 View FIGURE 4 D). GT with four setae; seta GT1 the shortest, ending pointed; seta GT2, longer, with long setulae on the distal part; seta GT3 with hook-shaped tip; and seta GT4 slightly longer than GT3 and GT1, with two pointed ends. Filter comb with five long setae, not segmented, bilaterally setulated. Besides scraper 2 and 3 there are three hyaline elements, the first one broad, triangular and hairy, the second is very wide, with a bifurcated end, and the third one rounded without setae. Behind scraper 4, one modified seta, possibly sensorial, short, broad, with long setulae on both sides.
Trunk limb III ( Figs. 4 View FIGURE 4 E). EX with five hyaline setae, well developed; two more vestigial setae, between seta 2 and 3 (arrows in Fig. 4 View FIGURE 4 E); seta 1, long, bilaterally setulated from basis to tip; seta 2, short, bilaterally setulated from basis to tip, after this, the first and second vestigial seta (V1 and V2), setulated; second vestigial seta (V2) blunt, very short, fully setulated; seta 3 long and robust, fully setulated on both sides; seta 4 longer than 3, both bilaterally setulated from basis to tip; seta 5 shorter than setae 3 and 4, bisegmented, bilaterally setulated from basis to tip. EN with two lobes. First lobe or EE with two rows of setae; anterior row with three setae; seta 1 hook like with small teeth along its distal portion; seta 2 and seta 3, both with long setulae; posterior row with four setae; seta I1 and seta I2 longer, different in length, with broad basis, fully setulated at their distal portion, brush-like appearance; seta I3 and I4 thin, with wide basis, bilaterally setulated. Second lobe or IE also with two rows of setae; anterior row with four setae, bottle-shaped, setulated distal part, seta 4, the longest; posterior row with four setae, long and slim, bilaterally setulated. GT blunt, with rows of thick setulae, near its basis there is a pore and a mamillated receptor similar in shape to a bottle; one angled seta, with setae at their tip, near a hyaline papilla is also found (arrow in Fig. 4 View FIGURE 4 E); FC composed of six setae, bilaterally setulated from the basis to the tip.
Trunk limb IV ( Fig. 4 View FIGURE 4 F). EX with four hyaline setae; seta 1 and 4, the shortest, bilaterally setulated from basis to tip; seta 3, the second in length, fully setulated from basis to tip; seta 2, the longest, bilaterally setulated along distal side, basis fully setulated on one side. EN with two rows of setae; anterior row with five thin setae with a wide base; in posterior row, seta 1 with a series of small thickened teeth on the distal end, seta 2–4 bi-segmented, with a line of strong and thick setae at its distal portion, seta 5, short, oval with a slender tip, setulated. GT with one long, angled, fully setulated seta at its distal portion (arrow in Fig. 4 View FIGURE 4 F), near a short, blunt and naked sensilla; a long, naked seta, between the angled seta and the filter comb (arrow in Fig. 4 View FIGURE 4 F); the latter composed of five long setae, broad at their basis and bilaterally setulated at the distal portion.
Trunk limb V ( Figs. 4 View FIGURE 4 G–H). EP oval. EX with two long setae; seta 1 the longest, not segmented, bilaterally setulated from the basis to the tip; seta 2 much shorter, not segmented, long and thin in the second half, covered with thin setulae. EN, a lobe with a fully setulated tip ( Fig. 4 View FIGURE 4 G). GT with three setae, 1 longer, seta 3 the shortest, bi-segmented ( Fig. 4 View FIGURE 4 G). PEP with three blunt sensillae fully covered by thin setae, two of them bigger, with a blunt end ( Fig. 4 View FIGURE 4 H).
FIGURE 3. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico. SEM photographs. A, ephippial female. A1–A4, close-ups of different regions of the ephippia. B, parthenogenetic female. C, Internal view of the valves, posterior. D, internal view of the valves, middle part. E, ornamentation in the inferior part, parthenogenetic female; lines highlight the part where this detail is found. F, labrum. G, postabdomen. H, postabdominal claw.
Ephippial female ( Figs. 1 View FIGURE 1 B, 3A) slightly bigger than parthenogenetic females (length: 0.75± 0.04 mm; height: 0.59± 0.02 mm; N=6); in general, body similar to that of parthenogenetic female ( Fig. 1 View FIGURE 1 B, 3A), with a welldeveloped keel. Surface of valves covered by an ornamentation formed by a series of rounded projections (Fig. 3A, 3A2–A3), becoming irregular in shape towards the ventral side, on some occasions with spine-like projections. Inferior margin of valves with a polygonal ornamentation, similar to that of parthenogenetic female (Fig. 3A4). Head pore similar to parthenogenetic female (Fig. 3A1)
Male ( Fig. 5 View FIGURE 5 A–J) Shape. Smaller than female (length: 0.58± 0.1 mm; height: 0.44± 0.2 mm; N=10), in general, shape similar to that in female. Semi-oval in lateral view, the posterior region of the dorsal keel more amply curved ( Fig. 5 View FIGURE 5 A). Internally the valves are similar to the ventral part of the female ( Fig. 5 View FIGURE 5 F)
First antenna ( Figs. 5 View FIGURE 5 B–E) longer than in female, curved forming an open “s” shape ( Fig. 5 View FIGURE 5 A). Externally, a long sensory seta on the proximal side ( Fig. 5 View FIGURE 5 B); internally, a basal internal seta short and robust, with lines of strong and short spines ( Fig. 5 View FIGURE 5 E). Last third with two groups of two external sensory setae. Distal internal part with two leaf-shaped aesthetascs ( Fig. 5 View FIGURE 5 D).
Second antenna same as female.
Trunk limb I ( Figs. 5 View FIGURE 5 I–J) similar to that of female, but with a hook attached at the distal part of the exopod (EXO-ODL); tip of this hook with three rows of small denticles ( Figs. 5 View FIGURE 5 I–J).
Trunk limbs II, III, IV and V similar to female.
Postabdomen ( Figs. 5 View FIGURE 5 G–H) oval in lateral view; bilobed, with numerous rows of spines, similar in length; anus bordered with groups of spines. Postabdominal claw curved, with lateral teeth ( Fig. 5 View FIGURE 5 G). Genital pore near the base of the claws on the ventral side ( Fig. 5 View FIGURE 5 H). Postabdominal seta with distal segment shorter than the proximal, without setulae ( Fig 5 View FIGURE 5 A).
Molecular analyses. For the comparison between all macrotricids, we produced a tree where the average intraspecific divergence is 0.91% with a maximum of 2.61%. Between genera, it was 24.57%, with a maximum of 35.55% and a minimum of 18.6%. In particular, Bunops cf. serricaudata has a maximum divergence of 35.55% with Ophryoxus and a minimum of 22.46% with Macrothrix . Most of the compared material is from Mexico and Canada, except Macrothrix atahualpa from Bolivia and Peru, and M. elegans represented by some specimens from Guatemala. In general terms, Bunops conforms a clade that is clearly separate from all others in the tree.
A consensus sequence of the seven obtained, with lenghts from 613 to 658 bp, is given here as an additional character of Bunops cf. serricaudata :
GACACTTTATTTAATTTTTGGGGCATGGTCCGGAATAGTAGGGACAGCTTTAAGTATACTAATTCGAGC AGAGCTCGGTCAATCTGGAAATTTAATTGGGGACGATCAAATCTACAATGTGATTGTCACTGCTCACG CTTTTATTATAATTTTTTTTATGGTTATACCAATTCTCATTGGAGGATTTGGTAATTGACTTGTGCCTCTA ATATTAGGAGCTCCAGACATAGCGTTCCCCCGACTTAACAATTTAAGTTTTTGGCTTCTACCTCCTTCA CTGACGTTGCTTCTTGTAGGGGGGGCTGTAGAAAGAGGAGCTGGGACCGGTTGGACTGTCTACCCCC CTCTTTCTGCGGGAATTGCTCATGCTGGTGCATCAATTGATTTAAGAATTTTTTCTCTTCATTTAGCAGG GATTTCGTCTATTTTAGGGGCAGTAAATTTCATTACGACTATTATTAATATACGATCACAAGGGATAACT CTAGATCGAATCCCACTATTTGCCTGAGCTGTAGGAATCACAGCCTTGCTTCTTCTTCTGAGTTTGCCA GTACTTGCAGGGGCAATTACGATACTCTTAACTGATCGCAATCTTAATACATCATTTTTTGATCCAGCGG GGGGAG
The average GC composition of Bunops sequences is 41.01±0.1, with 53.3% in the first codon position, 45.2% in the second, and 25.7% in the third.
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.