Homaledra knudsoni Hayden, 2021

Hayden, James E., 2021, Two new species of palm-leaf skeletonizers (Lepidoptera: Pterolonchidae: Homaledra Busck), Insecta Mundi 2021 (859), pp. 1-24 : 15-18

publication ID

https://doi.org/10.5281/zenodo.5041755

publication LSID

lsid:zoobank.org:pub:B6DA8972-8EAE-465F-B4E2-D38B299267B7

persistent identifier

https://treatment.plazi.org/id/03FE87CD-FFBB-FFD6-FF0F-FCF1FB3383F6

treatment provided by

Carolina

scientific name

Homaledra knudsoni Hayden
status

new species

Homaledra knudsoni Hayden , new species

( Fig. 5–7, 10 View Figures 1–10 , 13, 19, 24 View Figures 11–26 , 32, 33 View Figures 27–33 , 36 View Figures 34–37 , 40, 43, 47 View Figures 38–47 , 56–59 View Figures 48–58 View Figure 59 )

Type material. Holotype: ♂: [white label] “ Cameron Co. Tex. Brownsville leg. E.C. Knudson 27-X-86” ( MGCL).

Paratypes: MEXICO: 1♂: Quintana Roo, Allen Point Ascension Bay , 17-IV-1960, J.F.G. Clarke, [green label] Genitalia Slide By RWH, male, USNM 15 View Materials , 045 View Materials , R.W. H. #788, 20-IX-1960, Homaledra sabalella (Chamb.) (USNM) . USA: Florida: Alachua Co. : 1♂: Gainesville, UF Campus, FLMNH Butterfly Rainforest , UV trap, XI-2011, Hansen and Fessenden ; 1♀: same data, MGCL slide 4439 ; 1♂: same data, MGCL slide 4440 ; 2♂: Gainesville, 3215 Hull Rd. , UF Butterfly Rainforest, larva on Washingtonia robusta , 19-XI-2017, J. Hayden, K. Curry, E17-4800 ; 1♂: Gainesville , Split Rock C.A., 29.63658, −82.40965, Pupa on cabbage palm, 12-IX-2017, J. Hayden, eclosed 25-IX-2017, E2017-3805 GoogleMaps ; 1♀: same data, MGCL slide 4437 GoogleMaps ; 1♂: same data, MGCL slide 4438 GoogleMaps ; 2♀: Gainesville, UF NATL, SW 34 St. & 24 Ave. , 29.63038, −82.37226, on Sabal palmetto leaf, 28-XI-2017, J. Hayden GoogleMaps ; 5♂, 2♀: same data except 29.6307, −82.3718, 9-VI-2018 GoogleMaps ; 3♂, 4♀: same data except 29.6345, −82.3704, 16-VIII-2018 GoogleMaps ; 5♂, 2♀: same data except 29.3663, −82.3706, 13-VIII-2018, J. Hayden, H.A. Rohrer GoogleMaps ; 1♀: same data except 29.3663, −82.3706, 13-VIII-2018, J. Hayden, H.A. Rohrer, MGCL slide 5007 (wings) GoogleMaps ; 1♂, 3♀: Gainesville, 3722 SW 19 St. , 29.617956, −82.348579, on Sabal palmetto , 24-I-2018, P. Skelley, J. Hayden, E18-236 (1♂: USNM, rest FSCA) GoogleMaps ; 1♂: same data, slide MGCL 4580 ( FSCA) GoogleMaps ; 2♂, 2♀: Gainesville, SW 41 Pl. south of UF TREEO, ex Sabal palmetto leaf, NW side of road, 22-X-2017, J. Hayden ; 2♂, 3♀: Micanopy, County Rd 346, bridge at River Styx , 29.517163, −82.222084, ex S. palmetto leaf, 22-X-2017, J.S. Bremer, E17-4018 (1♂, 1♀: USNM, rest FSCA) GoogleMaps ; 1♀: Micanopy, 13207 SW Williston Rd., on S. palmetto , 5-III-2018, J. Hayden, J.Y. Miller, E18- 845, MGCL slide 4673 ; 1♂, 1♀: Gainesville, Museum Rd west of Lake Alice , larva on Sabal palmetto leaf, 26-XI-2017, J. Hayden (♀: USNM, ♂: FSCA) ; 1♂, 1♀: Gainesville, 2004 SE 41st Ave. , 29.6164, −82.2987 Sabal palmetto , 21-VII-2018, J. Hayden, E. Robertson, J. Mays, J. Awad, E18-4053 GoogleMaps ; 1♂: 6400 SW 20 th Ave. , 29.64142, −81.41091, UV light, 23–24- II-2019, J. Hayden GoogleMaps ; 4♂: Gainesville, across from 6400 SW 20th Ave. , 29.6394, −82.4100, Sabal palmetto , 3-VI-2018, J. Hayden GoogleMaps ; 1♂: same data, MGCL slide 5004 (wings) GoogleMaps ; 2♂, 10♀: Gainesville, 10014 SW 87 Terrace, Reared from leaf of Sabal palmetto , leaf coll. 7-XI-2018, Lyle J. Buss ; 1♂: same data, MGCL slide 5015 (1♂, 1♀: USNM, rest FSCA) ; 1♂: Gainesville, 2832 NW 41 st Place , 29.6922, −82.3650, UV light trap, 24–25-IX-2019, J. Hayden GoogleMaps ; 1♂: same data except 25-III-2020, UV light GoogleMaps ; Brevard Co.: 1♂: Cocoa, 1545 Alligator Lane , 28.3838, −80.7980, on S. palmetto (?), 17-IV-2018, D. Cermak, E18-1920 GoogleMaps ; 1♂: Melbourne , Weston Park, UV, 8-XII-2017, M.F. Blaine ; 1♂: same data, 9-I-2018 ; Citrus Co.: 2♀: Floral City, 9065 E. Bushnell Rd. on Sabal palmetto , 15-V-2018, J. Hayden, E18-3023 ; 1♂: same data, MGCL slide 5005 (wings) ; Collier Co.: 2♀: Naples, Delnor-Wiggins Pass State Park , malaise trap, 24-IV–27-V-2020, D. Serrano ; Duval Co.: 2♂: St. Johns Bluff, Timucua National Park , Fort Caroline , 30°23′09″N 81°29′49″W, malaise trap, 24-VIII– 7-IX-2018, E. Talamas, D. Taradona GoogleMaps ; 1♂: same data except Ribault Column , 30°23′16.4″N 81°29′21.5″W, malaise trap, 2–23-XI-2018, MGCL slide 5185 GoogleMaps ; Gilchrist Co.: 3♂: Trenton, Rte 26 x SW 15 Ct , 29.6137, −82.8330, ex S. palmetto leaf, 18-X-2017, M. Standridge, J. Bremer, E17-4013 GoogleMaps ; Hernando Co.: 1♀: Brooksville, E. side La Pine Rd. 28.5196, −82.2615, on Sabal palmetto , 28-IV-2018, N. Marquez, E18-1403, MGCL slide 5006 (wings) GoogleMaps ; Indian River Co.: 1♂: Vero Beach , FL A1A, 27.6348, −80.3577, on Serenoa repens , 1-XI-2018, A. Tasi, E18-6027 GoogleMaps ; 1♀: Vero Beach, Cap. Forster Hammock Prsv. , 27.5710, −80.4004, reared on S. palmetto leaf, 17-X-2018, A. Tasi, E18-5795 GoogleMaps ; 4♀: Vero Beach, 6618- 7072 9 St. SW-Oslo Rd. , 27.587°N, 80.464°W, 4-XI-2018, T. Greenwald, M.E. Flowers, E18-5798 GoogleMaps ; 1♂: 11738-11360 CR 512, St. Sebastian Prsv. , 27.768°N, 80.564°W, 4-XI-2018, T. Greenwald, M.E. Flowers, E18-5856 GoogleMaps ; 2♂, 2♀: Vero Beach, 4593-4599 Blue Cypress Rd. , 27.726°N, 80.776°W, 4-XI-2018, T. Greenwald, M.E. Flowers GoogleMaps ; 1♂: Vero Beach , 4016-4050 CR 512, 27.645°N, 80.643°W, 4-XI-2018, T. Greenwald, M.E. Flowers GoogleMaps ; Lake Co.: 2♂, 2♀: Howey in the Hills , Highway 19, 28.699279, −81.780483 on S. palmetto (?), 21-II-2018, N. Marquez, A. Bartlett, E18-688 GoogleMaps ; 1♂: same data except E18-689, MGCL slide 4608 GoogleMaps ; 1♀: Tavares, Lake Idamere Park , 28.76455, −81.74842 ex frass on S. palmetto , 16-V-2018, J. Hayden, E18-2826 GoogleMaps ; 3♂: same data except 3-X-2018, J. Hayden, E18-5348 GoogleMaps ; Levy Co.: 3♂, 6♀: US 41 N. of Williston , 29.41196, −81.45341, Sabal palmetto , 22-IV-2018, J. Hayden, E18-2064 GoogleMaps ; Marion Co.: 1♂: Ocala, IFAS Extension , 2232 NE Jacksonville Rd. 29.21114, −82.13074, on Sabal palmetto , 29-I-2018, J. Hayden, B. Danner, E18-846, MGCL slide 4615 GoogleMaps ; 2♂, 2♀: Ocala, 9036 W. Anthony Rd. , 29.28211, −82.13057, Sabal palmetto , 4-III-2018, J. Hayden, T. Dickel, E18-946 GoogleMaps ; 1♀: same data, MGCL slide 5003 (wings) GoogleMaps ; 1♂, 3♀: same data except 29.28231, −82.12926, E18-1012 (1♀: USNM, rest FSCA) GoogleMaps ; 1♀: same data except 29.28332, −82.13414 GoogleMaps ; Osceola Co.: 1♂, 1♀: St. Cloud, 4464 La Salle Ave. S., Larvae on Washingtonia robusta , 17-VIII-2018, R. Areingdale, E2018-4414 ; 1♂: same data except E2018-4464 ; 7♂, 3♀: Kissimmee, Joe Overstreet Rd. S. of Canoe Creek Rd. , 15-XII-2017, on Serenoa repens, T. Greenwald, M.E. Flowers, E 18-155 ; 1♂: same data, MGCL slide 4564 ; 1♂: same data, MGCL slide 5008 (wings) ; Palm Beach Co.: 3♂: Royal Palm Beach, 150 Crestwood Blvd N. on S. palmetto , 6-XII-2018, J. Hernandez, E18-6306 ; 1♂: same data, MGCL slide 4990 ; Polk Co.: 2♂: Lake Alfred, CREC Experiment Sta. Rd. , 28.10184, −81.71229, reared on S. palmetto leaf, 10 Jan. 2019, J. Hayden, E19-165 GoogleMaps ; 1 larva, molecular analysis: Bartow , 1432 CR 555 S., 4-I-2018, Livistona chinensis, J. Bryan, R. Areingdale, E 18-54 ; Putnam Co.: 1♂, 1♀: 3.2 mi. SE of Hawthorne, vic. Little Orange Lake , 29.568291, −82.041721, on Sabal palmetto leaf, 8-X-2017, T.A. Lott, D. Matthews, E2017-3858 GoogleMaps ; 1♀: same data, MGCL slide 4449 GoogleMaps ; Sumter Co.: 1♀: Sumterville , E. side CR 529A, 28.7459, −82.0862, on S. palmetto , 9-III-2018, N. Marquez, E18-1003 GoogleMaps ; Volusia Co.: 1 larva, molecular analysis: De Land , 29.09227, −81.33740, 29-I-2018, Sabal palmetto, K. Loadholtz, E 18-323 GoogleMaps ; 1♂: Osteen, 492 Pell Rd. , 28.852463, −81.068803, on S. palmetto , 12-II-2018, K. Coffey, E18-659 GoogleMaps ; 1♂: Pierson, 1725 Stone Rd. , 29.1854, −81.4826, on Jax. trap, 10-XII-2018, P. Sullivan, E18-6407 GoogleMaps ; TEXAS: Cameron Co.: 1♂: same data as holotype ( MGCL) ; 1♂: Southmost, 27-X-1986, E.C. Knudson, Barcode of Life DNA voucher specimen, SampleID CCBD-28560-D04, BOLD Proc. ID: LNAUU040-15, USNMENT 01048494 ( USNM) ; 1♂: same data except “Southmost”, MGCL slide 4442 ; 1♀: Sabal Palm Sanct. , 4,5- XII-1994, E. Knudson; 1♀: same data except 29-IV-1995, MGCL slide 4441 .

Other material examined. USA: Florida: Alachua Co. : 1♂: Gainesville, UF NATL, SW 34 St. & 24 Ave., 29.63038, −82.37226, Pupa on Sabal palmetto leaf, 9-X-2017, J. Hayden, MGCL slide 4448; 1 larva: same data except 29.6304, −82.3717; 1♀: same data except 29.63446, −82.37056, 5-X-2017; 1 larva: Gainesville, UF NATL, SW 34 th St., 29.6336, −82.3706, on Sabal palmetto , 13-VIII-2018, J. Hayden, H.A. Rohrer, MGCL slide 4854 (larval cuticle); 1 larva (molecular sequencing): same data except: sample JEH20180813E; 1 larva: Gainesville, NATL, 29.6345, −82.3704, 16-VIII-2018, Sabal palmetto, J.E. Hayden ; 1 larva (molecular sequencing): Gainesville, SW 41 Pl. S. of UF TREEO, ex Sabal palmetto leaf on NW side of road, 22-X-2017, J. Hayden, sample JEH20171121A; 3 larvae: Gainesville, NATL, 15-XII-2018, Sabal palmetto, J.E. Hayden, K. Ellis ; 1 larva: Gainesville, FLMNH Butterfly Rainforest, 19-XI-2017, Washingtonia robusta, K. Curry, J.E. Hayden ; 2 larvae: Gainesville, 3722 SW 19 St., 29.6180, −82.3486, 24-I-2018, Sabal palmetto, J.E. Hayden, P. Skelley ; 1 larva: Micanopy, 29.5172, −82.2221, 22-X-2017, Sabal palmetto, J. Bremer ; 1 larva: Micanopy, 13207 SW Williston Rd., 5-III-2018, Sabal palmetto, J.E. Hayden, J.Y. Miller ; Brevard Co.: 2 larvae: Cocoa, 28.3838, −80.7980, 17-IV-2018, Sabal palmetto, D. Cermak ; Columbia Co.: 2 larvae (1 preserved, 1 molecular sequencing): Lake City, 30.1753, −82.6325, 19-I-2019, Sabal palmetto, M.E. Flowers, T. Greenwald, E2019 -212; Hernando Co.: 2 larvae: Brooksville, La Pine Rd., 24.5196, −82.2615, 28-III-2018, Sabal palmetto, N. Marquez ; Hillsborough Co.: 1♂: Seffner, 8682 Williams Rd., on Butia capitata , 15-II-2018, T. Streeter, MGCL slide 4601; 1 larva: same data, not slide-mounted; Indian River Co: 2 larvae: Vero Beach, 27.5870, −80.4640, 4-XI-2018, Sabal palmetto, T. Greenwald, M.E. Flowers ; Lake Co.: 1 larva, 2 pupae: Clermont, 28.554211, −81.747638, on Sabal palmetto , 16-I-2018, A. Bartlett, N. Marquez, E2018-175; 1 pupa: Howey in the Hills, on S. palmetto , 2-II-2018, N. Marquez, A. Bartlett; 1 pupa: Howey in the Hills, 28.6993, −81.7805, 21-III-2018, Sabal palmetto, N. Marquez, A. Bartlett ; 1 larva: Tavares, 28.7646, −81.7484, 16-V-2018, Sabal palmetto, J.E. Hayden ; 4 larvae: same data except 3-X-2018; Marion Co.: 1 larva: Ocala, 29.2821, −82.1306, 4-III-2018, Sabal palmetto, J.E. Hayden, T.S. Dickel ; Osceola Co.: 1 larva: Kenansville, Three Lakes WMR, 27.942, −81.152, 2-XI-2018, Serenoa repens, M. Flowers, T. Greenwald ; 2 larvae (molecular samples): St. Cloud, 4464 La Salle Ave. S., 17-VIII-2018, Washingtonia robusta, R. Areingdale , samples E2018-4413, E2018-4414; Palm Beach Co.: 5 larvae, 1 pupa: Royal Palm Beach, on S. palmetto , 6-XII-2018, J. Hernandez; Polk Co.: 2 larvae: Bartow, 1432 CR 555 S., on Livistona chinensis , 4-I-2018, J. Bryan and R. Areingdale, E2018-54; Sumter Co.: 2 larvae: Sumterville, 28.7459, −82.0862, 9-III-2018, Sabal palmetto, N. Marquez ; Volusia Co.: 1 larva: De Land, 29.09227, −81.33740, on Sabal palmetto , 29-I-2018, K. Loadholtz, E2018-323.

Diagnosis. Adult. The antennae are distinctly longer than the forewings and gray at the apex, whereas they are shorter than the wings and unicolorous in H. sabalella . Most specimens have a pecten on the scape, which H. sabalella lacks. The forewings are beige with white scales on the veins, especially along the radial veins ( Fig. 5, 6, 7 View Figures 1–10 ). The terminal black spots are more prominent and extend farther basad, including a spot at the end of R1 (anterior of the discal spot) and in some specimens basad of R1. Forewing vein M 1 is close or anastomoses with Rs 3+4, the forewing CuA veins are usually separate or less often fused, and the hind wing CuA veins are separate ( Fig. 36 View Figures 34–37 ). The hind wings are darker gray than those of H. sabalella . The male tergum has slightly enlarged pleural scales but is otherwise unmodified ( Fig. 13 View Figures 11–26 ). Male genitalia: The cornuti are large, numerous, and melanized ( Fig. 24 View Figures 11–26 ). Female genitalia: The corpus bursae is pyriform in shape, widest at the anterior end ( Fig. 32 View Figures 27–33 ). The signum is a diffuse, elongate zone of granules on anterior end of the corpus bursae ( Fig. 33 View Figures 27–33 ). Larva ( Fig. 40 View Figures 38–47 ). The subventral group on A3–A6 has four setae of similar size: one anterior of the proleg and three anterolateral of it ( Fig. 43 View Figures 38–47 ). Pupa ( Fig. 47 View Figures 38–47 ). The antennae and metathoracic legs are longer than wings and are extended to the end of the 6 th abdominal segment; the antennae are tangent, concealing the legs at the 3 rd abdominal segment.

The signum of H. sabalella and H. howardi has a discrete edge and bears spines. Homaledra citraula (Meyrick) has cornuti that are similarly large and melanized ( Clarke 1965: pl. 254 fig. 1a). That species is distinguished by wing pattern, which is yellow with orange and gray streaks.

Description. Head ( Fig. 10 View Figures 1–10 ). haustellum dark gray; maxillary palpi gray; labial palpi with proximal segment gray, second segment dark gray except cream in dorsal 2/5 and around distal margin, without dorsal tuft; distal segment brown with few pale gray scales. Frons entirely dark gray below level of antennae, brown dorsally. Ocelli absent. Antennal scape dorsally brown, ventrally cream with row of single gray scales along anterior edge, pecten of 1 to 5 fine gray scales near base, often lost; pedicel and flagellum mostly brown, gray at apex, longer than wing.

Thorax. Prothorax behind head dark gray; rest of thorax brown dorsally, cream ventrally. prothoracic leg coxa gray, femur gray, tibia gray with dark gray and cream scales, bearing erect hairlike scales along whole length of dorsal side; tarsi gray and pale brown. Mesothoracic leg femur gray, tibia gray, tarsus pale brown; one pair of tibial spurs present. Metathoracic leg mostly cream except tibia pale gray along whole dorsal side, with long hairlike scales; two pairs of tibial spurs present. Forewing ( Fig. 5, 6, 7 View Figures 1–10 ) length 6.0–9.0 mm, usually 7.0 mm or longer (n = 20); dorsal side brown, with cream scales along veins, especially in distal half; a black spot at distal end of discal cell, another black spot along anal fold, and veins terminating in black spots on anterior and posterior margins; costal margin cream; ventral side gray; fringe gray. Forewing venation: Rs 4 stalked with Rs 3, M 1 variably parallel to Rs 3 +Rs 4, stalked with them, or anastomosed with Rs 4; CuA 1 and CuA 2 separate in most specimens, stalked in one specimen ( Fig. 36 View Figures 34–37 ). Hind wings with dorsal and ventral sides and fringe uniformly gray. Hind wing venation: M 1 and M 2 shortly stalked; M 3, CuA 1, and CuA 2 present and separate.

Abdomen. Dorsal side brownish gray, ventral side cream; eighth segment gray in female, brown in male.

Male genitalia ( Fig. 19, 24 View Figures 11–26 ). Uncus hooked, slightly enlarged medially; gnathos absent; transtilla a pair of narrow sclerotized straps in membrane, meeting mesally; juxta a broad pentagon, ventral margin straight or slightly concave; valva elongate, without fibula, setose along ventral half, with few setae along dorsal half, the proximal half of costa being rather strongly arched; saccus not pronounced; tegumen with sclerotized medial longitudinal ridge. Phallus with sclerotized strap entire length; large cornuti in one large field on vesica.

Female genitalia ( Fig. 32, 33 View Figures 27–33 ). Ostium bursae without sclerites; colliculum present; ductus seminalis attached to ductus bursae just anteriad of colliculum; anterior end of ductus bursae with granular texture on one side. Corpus bursae slightly shorter than ductus bursae; anterior section 1 mm long, ovate; posterior section 1.5 mm, narrow and straight; one longitudinally elongate, diffuse signum occupying most of anterior section.

Larva ( Fig. 40, 43 View Figures 38–47 ). SV group on A3–A6 with 4 large setae:1 anterior of crochets and 3 anterolateral of crochets. Etymology. The species is named after Dr. Edward C. Knudson, who collected specimens in the Lower Rio Grande Valley as part of his decades-long Texas Lepidoptera Survey. His donation of specimens to the Florida Museum of Natural History allowed timely recognition of this species’ probable origin.

Distribution. Fig. 59 View Figure 59 . Southern Texas, Mexico (Yucatan Peninsula), and peninsular Florida, from Duval County in the north to Palm Beach and Collier Counties in the south.

Hosts plants. This species is most frequently reared on Sabal palmetto and Washingtonia robusta , infrequently on Butia capitata , Livistona chinensis , and Serenoa repens . It is reported on Trachycarpus H. Wendl. in cultivation (R. Fessenden, FLMNH, pers. comm. 2018).

Larval behavior. The larvae coexist in large numbers in frass-covered silken tubes on protected parts of leaves, usually the abaxial side, but also the adaxial side along the rachis when deeply folded. The tunnels are as wide as the larvae, and they wind randomly across the leaf surface in large patches ( Fig. 56, 57 View Figures 48–58 ). During the day, larvae often hide in sections of the tubes near the base of the leaf. If larvae are difficult to find, active damage can be recognized by the leading ends of frass tubes with fresh, greenish frass extending onto undamaged epidermis ( Fig. 58 View Figures 48–58 ). The larvae do not bind leaf sections with thick mats of silk, unlike H. sabalella .

Remarks. This species is figured in Knudson and Bordelon (2008), plate 2, fig. 10, misidentified as H. sabalella . It is apparently geographically separated from H. sabalella in eastern Texas (E. Knudson, pers. comm. 2018). This species probably appeared in Florida as early as 2006, evidenced by a photograph of a moth posted on Bugguide. net (Lady Lake, Lake County, FL, 29 Nov. 2006) ( White 2006). Figures 2–4 View Figures 1–10 in Howard and Abreu (2007) show leaf damage that is characteristic of H. knudsoni rather than H. sabalella ; that would be contemporaneous, but the locations and exact dates of their photographs are not given. Specimens of H. knudsoni were not found among Howard’s reared material.

Homaledra knudsoni is represented by BIN BOLD:ACJ4987 (https://doi.org/10.5883/BOLD:ACJ4987), which is based on two specimens: USNMENT 01048494 and GenBank accession JF818757.1. The latter sample (voucher no. MM11439) was misidentified as H. sabalella and included in the gelechioid phylogeny of Kaila et al. (2011). The larvae were collected in Gainesville in 2010 (L. Buss, pers. comm. 2019). Five other genes were sequenced, so the amended identification should not affect the higher-level phylogenetic conclusion that Homaledra is associated with Pterolonchidae .

The COI barcode sequences have the same haplotype; for example, the sequence of E2018-4413 is:

TTTGAGCAGGAATAGTAGGAACTTCTCTTAGTCTTCTAATTCGAGCTGAATTAGGAAATCCAGGTTCTTTAATTGGAGA TGATCAAATTTATAATACAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGTGG ATTTGGAAATTGATTAGTCCCTTTAATATTAGGAGCCCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGAC TTCTTCCCCCTTCTTTAACTCTTCTTATTTCAAGAAGAATTGTTGAAAGAGGAGCAGGAACTGGATGAACAGTATATCC CCCACTTTCATCCAATATTGCCCATGGAGGTAGATCTGTAGATCTAGCAATCTTTTCTTTACATTTAGCAGGAATTTCAT CAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAATAATATATCATTTGATCAAATACCTTTATT TGTATGAGCAGTAGGAATTACTGCTTTACTACTTTTACTCTCTTTACCCGTTTTAGCTGGTGCAATTACCATATTATTAA CTGATCGTAATTTAAATACATCATTTTTTGACCCTGCAGGAGGAGGAGA

Other sequences available on GenBank with the following accession numbers (full data in Material Examined): sample JEH20180813E: MW549056 View Materials ; E2017-3858: MW549057 View Materials ; JEH20171121A: MW549058 View Materials ; E2018-4413: MW549059 View Materials ; E2019-212: MW549060 View Materials .

Other species. The species raised by Abreu in Puerto Rico ( Howard and Abreu 2007) is not conspecific with H. howardi . It resembles H. howardi in that the beige wings have scattered black scales not concentrated in spots, and the males also have a distinct tuft of scales on the dorsal abdomen. Unlike H. howardi , the scales are short, fine, erect and black in color, forming a circular cushion-like patch. Tergum II narrows as a triangle instead of a Y, and there is a pocket of scales on the membrane between terga II-III that is revealed after brushing off the black scales. The phallus lacks cornuti except a few small spinules. The valvae are narrower than any other species. In the female, the corpus bursae is carrot-shaped, broadest posteriad where it meets the ductus bursae, and a signum is absent.

Homaledra heptathalama Busck distinctly differs in its orange wing pattern with a central exclamation point “!” ( Fig. 48 View Figures 48–58 ). Males lack a dorsal abdominal scale tuft ( Fig. 14 View Figures 11–26 ), the apex of the valva is more strongly attenuate than that in the other species ( Fig. 20 View Figures 11–26 ), and cornuti are absent ( Fig. 25 View Figures 11–26 ). Females were not examined: all of the numerous pinned specimens of H. heptathalama in the FSCA are males, so females may not be attracted to light, the usual collection method. Rearing females from late-instar larvae should be attempted.

USNM

Smithsonian Institution, National Museum of Natural History

FSCA

Florida State Collection of Arthropods, The Museum of Entomology

Kingdom

Animalia

Phylum

Arthropoda

Class

Insecta

Order

Lepidoptera

Family

Coleophoridae

Genus

Homaledra