Macrobiotus paulinae, Stec, Daniel, Smolak, Radoslav, Kaczmarek, Łukasz & Michalczyk, Łukasz, 2015

Stec, Daniel, Smolak, Radoslav, Kaczmarek, Łukasz & Michalczyk, Łukasz, 2015, An integrative description of Macrobiotus paulinae sp. nov. (Tardigrada: Eutardigrada: Macrobiotidae: hufelandi group) from Kenya, Zootaxa 4052 (2), pp. 501-526 : 506-517

Macrobiotus paulinae sp. nov.

( Tables 4–5 , Figs 1–45 )

Material examined. 173 animals and 2 eggs isolated directly from the moss sample and 14 animals and 12 eggs obtained from the in vitro culture. Specimens mounted on microscope slides in Hoyer’s medium, fixed on SEM stubs and processed for DNA sequencing.

Description of the new species.

Animals (measurements and statistics in Table 4 ): Body from white in juveniles to light yellow in adults, transparent after fixation in Hoyer’s medium ( Fig. 1 ). In older, live animals the portion of the body posterior to legs III is swollen ( Fig. 2 ). Eyes present (also in mounted specimens). Cuticle covered with pores and faint granulation ( Figs 3–12 ). Small oval and round pores, 0.3–0.5 Μm in diameter ( Figs 4–6 ), are scattered randomly on the entire cuticle, although they are larger on dorso-lateral parts of the body, including the outer surface of legs ( Fig. 9 ). A ring of pores is present around the mouth opening, below the peribuccal sensory lobes ( Fig. 12 , empty arrow). Due to the small size of pores, they are difficult to observe under light microscopy (LM) (see Fig. 6 , asterisks). Granulation is arranged in patches on the dorso-lateral and caudo-dorsal cuticle (body granulation) as well as on the outer surface of all legs (leg granulation) ( Figs 3 , 6–11 ). There are seven dorso-lateral patches of sparse granulation arranged symmetrically on both sides of the body. The patches are spaced regularly, with patches I, III and V being placed slightly anteriorly to legs I, II and III, respectively and with patches II, IV and VI being placed slightly posteriorly to legs I, II and III, respectively. Patch VII is placed between legs III and IV, at the level of the cloaca ( Fig. 3 ). All body patches are arranged around cribriform areas (circled in Fig. 7 ). Rarely, and only in some of larger animals, the dorso-lateral patches may extend to the dorsum and join to form seven transverse stripes of granulation, narrow dorsally and wide laterally. The granulation on all legs is arranged into two distinct patches: a small area of fine and dense granulation just above claws (distal patch) and a larger area of more robust and sparse granulation located in the middle of each leg (proximal patch) ( Figs 8–11 , in all figures the distal patch is outlined with a dashed curve whereas the proximal patch is outlined with a solid curve). Compared to granulation on legs I– III ( Figs 8–9 ), the granulation on legs IV is more distinct and forms larger patches, with the proximal patches merged into a single transverse band of granulation ( Figs 10–11 ). Both pores and granulation are poorly visible, with the dorso-lateral patches being the least visible, thus the cuticle has to be observed under a good quality contrast microscope and at the highest magnification in order to ensure correct interpretation.

Mouth antero-ventral ( Fig. 12 ). Bucco-pharyngeal apparatus of the Macrobiotus type, with the ventral lamina and ten small peribuccal lamellae. The lamellae are only clearly visible under SEM ( Figs 13–14 ) and very difficult to identify under LM ( Fig. 15 ). The oral cavity armature composed of three bands of teeth, but under LM only the third band is visible ( Fig. 15 ) and SEM is required to reveal the first and the second bands of teeth (see Figs 13–14 ). The first band of teeth comprises extremely small cones arranged in a single row situated at the anterior portion of the oral cavity, on the bases of peribuccal lamellae ( Fig. 13 , indented arrowhead). The second band of teeth is composed of ca. five rows of slightly larger cones, positioned at the rear of the oral cavity, between the ring fold and the third band of teeth ( Figs 13–14 , flat arrowheads). The teeth of the third band are positioned at the rear of the oral cavity, between the second band of teeth and the buccal tube opening ( Figs 13–15 ). Under LM, the teeth of the third band appear as a single ventral and a single dorsal thin transversal ridge ( Fig. 15 and the lower insert). However, SEM reveals that both ventral and dorsal teeth indeed form continuous ridges, but with evident median and lateral peaks corresponding to median and lateral teeth in species with stronger oral cavity armatures ( Fig. 14 ). Median teeth are smaller than the lateral teeth, which appears under LM as a thinning in the central portion of the ridges ( Fig. 15 and the lower insert). In addition, there are a number of smaller accessory teeth placed laterally to the lateral teeth. These accessory teeth are more likely to develop on the ventral side than on the dorsal. Buccal tube walls are slightly thickened posterior to the stylet support insertion point ( Fig. 15 , empty indented arrowhead). Pharyngeal bulb spherical, with triangular apophyses, two rod-shaped macroplacoids and a triangular microplacoid ( Fig. 15 and the upper insert). Macroplacoid length sequence 2<1. First macroplacoid with a central constriction ( Fig. 15 , upper insert).

Claws small and slender, of the hufelandi type ( Figs 16–19 ). Primary branches with distinct accessory points. Lunules on legs I–III smooth ( Figs 16–17 ), but those on legs IV from crenulate in young animal to dentate in larger specimens ( Figs 18–19 ). Bars under claws absent, but extremely faint (barely visible under LM, only clearly visible in SEM) paired muscle attachments below claws I–III present.

Eggs (measurements and statistics in Table 5 ): Laid freely, light yellow, spherical and with a hufelandi type chorion ornamentation ( Figs 20–45 ). The surface between processes is covered with a very dense regular reticulum (mesh diameter 0.05–0.20 Μm, reticulum thickness 0.05–0.30 Μm) ( Figs 32–34 , 38, 40–42 ). As these diameters are on the margin or below the resolution of LM, the mesh is only clearly visible with SEM. Under LM the mesh outline can merely be detected only on some eggs (usually only around the processes, where meshes are slightly larger), but on the majority of eggs the surface appears to be covered with faint dots when observed with PCM ( Figs 24 and 26 ). Thus, eggs have to be observed under a good quality contrast microscope and at the highest magnification in order to ensure correct identification. Importantly, however, SEM also does not guarantee the correct identification regarding the chorion sculpture. In some of the eggs we observed with SEM, the reticulum was partially covered by a layer of an unknown substance that fills the mesh and makes the egg surface appear smooth ( Figs 31, 33 , 35 , 39, 41 and 43 ). Figures 33 and 41 show a transition from a clearly visible reticulum to an obscured smooth surface. As eggs with an obscured reticulum appear smooth, they could be erroneously classified as the persimilis type (i.e. with a smooth chorion). Thus, the examination of a larger number of eggs and at magnifications>30,000× is necessary in order to avoid false interpretations.

Processes are in the shape of inverted goblets with slightly concave conical trunks and well-defined terminal discs ( Figs 20–45 ). When observed under SEM, all trunks have 5–7 distinct ring undulations ( Figs 36–41 ), whereas in LM the undulations are lightly outlined only in some processes ( Fig. 28 , indented arrowheads), with the majority of processes appearing to have smooth trunks. Processes exhibit a considerable variation in height and, therefore, also in the base/height ratio (e.g. see Figs 22–23 ). Terminal discs are cog-shaped, with a concave central area and with 8–10 small irregular teeth ( Figs 28–29 , 34–45 ). In SEM, small granules 0.05–0.08 Μm in diameter, are visible on the teeth ( Figs 42–45 ). Approximately half the processes have one to a few teeth on the disc that are elongated into thin flexible filaments, less than 0.5 Μm in diameter and up to 20 Μm in length ( Figs 34–41 ). The filaments are hair-like under LM, but under SEM they are covered with the same type of granulation as the disc teeth ( Fig. 41 ), so they probably enhance the adhesive function of egg processes. Eggs found in the sample were devoid of filaments and we were able to observe them only on eggs obtained from cultured animals. The most probable explanation for this is that the filaments are very fragile and easily broken, thus are not present on some eggs. Also, the filaments are very thin so could be overlooked and/or misinterpreted as dirt attached to eggs. Therefore, extreme care must be taken when examining the eggs in order to avoid incorrect conclusions.

DNA sequences. First, we sequenced all four DNA fragments for four individuals. As we found no polymorphism in any of the sequences, for the remaining ten individuals we have amplified and sequenced only ITS-2, potentially the most variable fragment. Again, there were no differences between all fourteen sequences. Since the type population exhibited only one haplotype, only a single sequence for each of the four DNA fragments was uploaded to the GenBank. The typical DNA sequences for Ma. paulinae sp. nov. are as follows:

The 18S rRNA sequence (GenBank: KT935502 ), 1731 bp long:

AGATTAGCCATGCATGTCTCAGTACTTGCTTTTACAAGGCGAAACCGCGAATGGCTCATTAAATCAGTTATGGTTCACTA GATCGTAAATTTTACACGGATAACTGTGGTAATTCTAGAGCTAATACGTGCAAGCAGCTCGTTTCCTTGTGGAGCGAGCG CAGTTATTAGAACAAGACCAATCCGGCCTTCGGGTCGGTACAATTGGTGACTCTGAATAACCGAAGCGGAGCGCATGGTC TCGTACCGGCGCCAGATCTTTCAAGTGTCTGACTTATCAGCTTGTTGTTAGGTTACGTTCCTAACAAGGCTTCGACGGGT AACGGGGTATTAGGGTCCGATACCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAA TTACCCACTCCTAGCACAGGGAGGTAGTGACGAAAAATAACGATGCGAGGGCTAATAGCTTCTCGTAATCGGAATGGGTA CACTTTAAATCCTTTAACGAGGATCTATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGT ATATTAAAGTTGCTGCGGTTAAAAAGCTCGTAGTTGGATCTGGGCTTCTGAATGGACGGTTCACTTTACGGTGTAACTGC TCGTTTGGTGCCACAAGCCGGCCATGTCTTGCATGCCCTTTGCTGGGTGTGCTTGGCGACCGGAACGTTTACTTTGAAAA AATTAGAGTGCTCAAAGCAGGCGTATGGCCTTGCATAATGGTGCATGGAATAATGGAATAGGACCTCGGTTCTATTTTGT TGGTTTTCGGAACTCGAGGTAATGATTAAGAGGAACAGACGGGGGCATTCGTATTGCGGCGTTAGAGGTGAAATTCTTGG ATCGTCGCAAGACGAACTACTGCGAAAGCATTTGCCAAGAATGTTTTCATTAATCAAGAACGAAAGTTAGAGGTTCGAAG GCGATCAGATACCGCCCTAGTTCTAACCATAAACGATGCCAACCAGCGATCCGTCGGTGTTTTTTTTATGACTCGACGGG CAGCTTTCCGGGAAACCAAAGTGCTTAGGTTCCGGGGGAAGTATGGTTGCAAAGCTGAAACTTAAAGGAATTGACGGAAG GGCACCACCAGGCGTGGAGCCTGCGGCTTAATTTGACTCAACACGGGAAAACTTACCCGGCCCGGACACTGTAAGGATTG ACAGATTGAGAGCTCTTTCTTGATTCGGTGGGTGGTGGTGCATGGCCGTTCTTAGTTGGTGGAGCGATTTGTCTGGTTAA TTCCGATAACGAACGAGACTCTAGCCTGCTAAATAGCCGACCGATCCGCAGCGTCGGTTGCTACAAAAGCTTCTTAGAGG GACAGGCGGCGTTTAGTCGCACGAGATTGAGCAATAACAGGTCTGTGATGCCCTTAGATGTCCGGGGCCGCACGCGCGCT ACACTGAAGGGACCAGAGTGCTTAACTACCTTGGCCGGAAGGCCTGGGGAATCCGGTTAAACCCCTTCGTGATTGGGATT GAGCTTTGTAATTATCGCTCATGAACGAGGAATGCCCAGTACTCGCGAGTCATAAGCTCGCGATGATTACGTCCCTGCCC TTTGTACACACCGCCCGTCGCTACTACCGATTGAATGATTTAGTGAGGTCTTCGGACTGGCCGTCGATGCTGACTCTGTT GGCGTCGGTTGGATCGGAAAGACGACCAAACTGGCTCATTAGAGGAAGTAA

The 28S rRNA sequence (GenBank: KT935501 ), 788 bp long:

TACTAAGCGGAGGAAAAGAAACCAACGGGGATGCCGATAGTACTGCGAGTGAAATCGGCCAAGCCCAGCGCCGAATCCTG TTGCTGGCGACGGTGACAGGAACTGTGGCGTGAAGAACGTCCTTACCGGTACGGTTTGCGTGCGTAAGTTCTCCTGAGTG AGGCTCCATTCCAAGGAGGGTGCAAGACCCGTATCGCGTGCAACCGGTGTCGGTGTAAGATGTTCGGAGAGTCGCCTTGT TTGTGAGTACAAGGTGAAGTCGGTGGTAAACTCCATCGAAGGCTAAATATGACCACGAGTCCGATAGCGAACAAGTACCG TGAGGGAAAATTGAAAAGCACTTTGAAGAGAGAGCGAAACAGTGCGTGAAACCGCTCAGAGGCAAGCAAATGGGGCCTCG AAGGCAAGGCAGCGAATTCAGCTGGTGGTCTGCGCGGCTGGTTGGTTTGGAGATCTTACGACTCTGGCCGGCTGGGCTCT GAGCGTAGGTGCCAGTGCACTTTTGTTGCTTGTACGCCACCGCCGTTGAGTGGGCATCCGTCGAGTTGGCAATGCGAAGC CTTGAGCCTTTACGGGCCTAGGTGCTTGCAGCCGGCTTTTGTACGCGTTTGCACTTCAACCGGTCATGTTTGCATGTGCC AGCAATTTGGCGTTGGATCGGCTTGCTCTGCCGTTTGTCGTGAGATGACGAGCTTGCTCGGCTCTTCGGCATCTATGGTA GAATCGGGTCGGTTTCAACGTGGGCACATTGTAATTCGGTGGCGAGTAGATGGCTGCCCATTTAACCC

The COI sequence (GenBank: KT951668 ), 707 bp long:

TTGACAGCTTGTGTAGGAACATCACTAAGCTTTTTAATCCGAACAGAACTCAGCCWACCAGGACTTCTTTTAGCTGATGA ACAAATATATAATGTCATTGTCACAAGCCACGCCTTTATTATAATTTTTTTTTTTGTAATGCCAATTCTTATTGGAGGAT TTGGTAATTGATTAATCCCTTTAATAATCAGAGCCCCCGACATAGCTTTCCCTCGTATAAATAATTTAAGATTTTGAATA CTACCTCCCTCATTTCTTCTAATTACATTAAGAACTATGGCTGAACAGGGAGCCGGTACGGGATGAACTGTGTACCCCCC TCTCTCGCATTTTTTTGCTCATAGGGGGCCTAGGGTAGACTTGACTATTTTTTCTCTTCATGTAGCCGGTATCTCCTCCA TTTTAGGGGCTATTAATTTTATTTCTACAATTATTAATATGCGAGCCCCGTTTATAAGGTTAGAAAAAATACCTCTTTTT GTTTGGTCAGTACTCCTAACTGCCATTTTACTTTTATTAGCTCTGCCTGTGCTTGCAGGGGGCATCACTATATTATTACT AGACCGAAATTTTAACACTTCTTTTTTTGACCCTGCGGGCGGGGGAGACCCTATTTTATACCAACATTTATTTTGATTTT TTGGGCATCCCGAAGTGTATATTTTAATTTTGCCTGGTTTTGGGATTATCTCTCAAATTGTAATTCA

The ITS-2 sequence (GenBank: KT935500 ), 440 bp long:

AAAATGCGAGACGTAACGTGAATTGCAGGACTTTGTGAACGTTAATTCTTCGAACGCACATTGCGGCTTCGGGTTAACTG AAGCCATGCCTGGTTGAGGGTCAGTTGAAATAAAAAATCGTAATCGYGCATTGATTACGGATTGTCTGGTTTTAACGGCC TTGTGTGCCGTTTCCGGATAAAGTTGAGACCAGATGTGTGCGCTCATTTGACCGGTGCAAGCAACGCTTTGCCGAGTTGG AGCATCCGACTTGTTTAGTCGTGCGCCGCAGCTGCACAATGGCTAAGCATGGTCAACCAACGGCGTTTGATGGCAAAGAA AGACTGGTACAAAAGTGCGCAAGCGCATAGACACGTCTGTGGCCGAAAAAGAACGCACCCAAGTGTGTTTTTGCTCATTC TTTTGACCTCAGCTCAGACAAGATTACCCGCTGAACTTAA

Type locality. 02°39'15.75''N, 36°56'9.99''E; 1824 m asl: Kenya, Eastern Province, Marsabit County, Mount Kulal Biosphere Reserve, Kulal Mt., near Gatab. Habitat: compact high, dense and shady forest (with approximately 30 min of sunshine a day reaching the forest floor). Sample: moss from a dead fallen tree ( Chionanthus sp.). Coll. Radoslav Smolak.

Etymology. The species is named after a former member of the Michalczyk lab and the first author’s friend, Miss Paulina Kosztyła , who wears braids that resemble fine filaments on the egg processes of the new species.

Type depositories. Holotype: slide KE.001.01 (with 17 paratypes), 108 paratypes (slides: KE.001/*, where the asterisk can be substituted by any of the following numbers: 1, 2, 3, 4, 5, 6, 8, 9, 11, 13, 14, 16, 17, 18, 19, 22, 26, 27, 28) and 7 eggs (slides: KE.001/*: 21, 23, 24) are deposited at the Department of Entomology, Institute of Zoology, Jagiellonian University, Gronostajowa 9, 30-387, Kraków, Poland; 25 paratypes (slides: KE.001/*: 10, 12, 15, 20) and 4 eggs (slide KE.001/25) are deposited at the Department of Animal Taxonomy and Ecology, Institute of Environmental Biology, Adam Mickiewicz University in Poznań, Umultowska 89, 61-614 Poznań, Poland.

Figures

FIGURES 1 – 3. Macrobiotus paulinae sp. nov. — habitus: 1 — dorso-ventral projection (holotype, PCM); 2 — dorsal view, please note the enlarged posterior portion of the body (paratype, SEM); 3 — a semi-schematic drawing of a laterally positioned animal showing all patches of cuticular granulation: Roman numerals indicate seven dorso-lateral patches of body granulation whereas arrow indicates the proximal patch and arrowhead the distal patch of leg (III) granulation (please note that the granule sizes are not to scale, they have been enlarged in order to make them identifiable on the drawing). Scale bars in Μm.

FIGURES 4 – 7. Macrobiotus paulinae sp. nov. — cuticular pores and body granulation: 4 – 5 — cuticular pores seen in SEM (paratype); 6 – 7 — body granulation seen in PCM (6) and in SEM (7) (paratypes). Please note a faint cuticular pore immediately left to each of six asterisks on Fig. 6 and the three encircled cribriform areas on Fig. 7. Scale bars in Μm. Fig. 6 assembled from two photos.

FIGURES 8 – 11. Macrobiotus paulinae sp. nov. — leg granulation: 8 — the proximal and the distal patch of granulation on leg III seen in PCM (paratype); 9 — the distal patch of granulation on leg III as seen in SEM (paratype); 10 — the proximal and the distal patch of granulation on leg IV seen in PCM (paratype); 11 — the proximal patch and the distal patches of granulation on legs IV seen in SEM (paratype). In all figures the proximal patches of larger granulation are outlined with solid curves whereas the distal patches of smaller granulation are outlined with dashed curves. Scale bars in Μm. Figs 8 and 10 assembled from several photos.

FIGURES 12 – 15. Macrobiotus paulinae sp. nov. — 12 — head and the mouth opening seen in SEM, empty arrow indicates a pore in the ring of pores surrounding the mouth (paratype); 13 – 14 — oral cavity armature seen in SEM, indented arrowhead indicates teeth of the first band, flat arrowheads indicate teeth of the second band, teeth of the third band are marked with “ M ” (median teeth), “ L ” (lateral teeth) and “ a ” (accessory teeth), rhombi indicate ring folds, asterisks indicate the ventral side (paratypes); 15 — buccal apparatus seen in PCM, dorso-ventral projection with dorsal teeth and dorsal placoids, the lower insert shows ventral teeth (of the same individual) whereas the upper insert shows ventral placoids (of a different individual), empty indented arrowhead indicates the sub-stylet thickening of the buccal tube wall. Peribuccal lamellae are barely identifiable in the lower insert (paratype). Scale bars in Μm. Fig. 15 assembled from several photos.

FIGURES 16 – 19. Macrobiotus paulinae sp. nov. — claws: 16 – 17 — claws III with small smooth lunules (PCM and SEM, respectively, both paratypes); 18 – 19 — claws IV with enlarged and indented lunules (PCM and SEM, respectively, both paratypes). Scale bars in Μm. Figs 16 and 18 assembled from several photos.

FIGURES 20 – 23. Macrobiotus paulinae sp. nov. — eggs seen in PCM: 20 – 21 — surfaces; 22 – 23 — midsections. Arrowheads indicate process filaments. Figures on the left and on the right pane show two different eggs. Scale bars in Μm.

FIGURES 24 – 29. Macrobiotus paulinae sp. nov. — egg details seen in PCM: 24 – 25 — focus on egg surfaces with a hardly detectable reticular design; 26 – 27 — focus on terminal discs of egg processes; 28 – 29 — midsection of egg processes. Flat arrowheads indicate process filaments, indented arrowheads indicate circular undulations on trunks of an egg process. Figures on the left and on the right pane show two different eggs. Scale bars in Μm.

FIGURES 30 – 33. Macrobiotus paulinae sp. nov. — eggs seen in SEM: 30 – 31 — entire eggs, with a clearly visible reticulum (24) and with an obscured reticulum (25); 32 – 33 — zoom on different parts of the same egg surface between processes: with a clearly visible reticulum (26) and with a partially obscured reticulum (27). Arrowheads indicate process filaments. Scale bars in Μm.

FIGURES 34 – 37. Macrobiotus paulinae sp. nov. — egg processes seen in SEM. Arrowhead indicates an undulation on process trunk. Scale bars in Μm.

FIGURES 38 – 41. Macrobiotus paulinae sp. nov. — terminal discs of egg processes with filaments of various lengths seen in SEM. Asterisks indicate places on discs where filaments originate. Scale bars in Μm.

FIGURES 42 – 45. Macrobiotus paulinae sp. nov. — terminal discs of egg processes without filaments seen in SEM: 42 – 43 — disc tops; 44 — the underside of a disc; 45 — zoom on a disc edge covered with granules. Scale bars in Μm.

Tables

TABLE 4. Measurements [in µm] of selected morphological structures of individuals of Macrobiotus paulinae sp. nov. mounted in Hoyer’s medium (N—number of specimens / structures measured, RANGE refers to the smallest and the largest structure among all measured specimens; SD—standard deviation).

CHARACTER	N	RANGE	MEAN	SD	Holotype
		µm pt	µm pt	µm pt	µm pt
Body length	15	237–400 837–1165	310 1000	46 98	262 923
Buccal tube
Length	15	28.3–35.6 –	30.9 –	2.2 –	28.4 –
Stylet support insertion point	15	19.9–26.7 69.7–75.0	22.3 71.9	1.9 1.7	20.7 72.9
External width	15	2.5–4.5 8.8–12.6	3.2 10.4	0.5 1.1	2.8 9.9
Internal width	15	1.0–2.9 3.5–8.1	1.7 5.6	0.5 1.3	1.6 5.6
Ventral lamina length	15	15.0–19.6 51.1–58.3	17.0 54.9	1.4 2.0	15.2 53.5
Placoid lengths
Macroplacoid 1	15	4.6–8.6 16.1–24.2	6.6 21.2	1.0 2.0	6.0 21.1
Macroplacoid 2	15	3.4–5.8 11.6–16.3	4.1 13.1	0.6 1.2	3.7 13.0
Microplacoid	15	1.3–2.4 4.5–7.7	1.9 6.3	0.3 0.9	2.0 7.0
Macroplacoid row	15	9.2–14.4 32.5–40.4	11.4 36.9	1.4 2.5	10.1 35.6
Placoid row	15	10.8–17.4 37.8–48.9	13.7 44.0	1.8 3.2	12.1 42.6
Claw 1 heights
External primary branch	15	8.4–12.4 28.9–38.6	9.9 31.8	1.2 2.4	9.5 33.5
External secondary branch	15	6.9–10.1 23.0–31.5	8.2 26.4	1.0 2.3	8.2 28.9
Internal primary branch	15	8.2–10.9 25.9–32.4	9.1 29.4	0.8 1.7	8.9 31.3
Internal secondary branch	14	6.1–8.6 21.6–26.5	7.5 24.2	0.7 1.5	7.3 25.7
Claw 2 heights
External primary branch	14	8.6–12.4 30.1–38.6	10.2 33.1	1.2 2.7	9.6 33.8
External secondary branch	14	7.0–9.3 24.5–29.2	8.3 27.1	0.6 1.3	8.2 28.9
Internal primary branch	15	8.0–11.4 27.4–32.9	9.4 30.4	0.9 1.6	9.2 32.4
Internal secondary branch	15	6.9–8.6 21.8–27.9	7.7 24.9	0.6 1.7	7.9 27.8
Claw 3 heights
External primary branch	12	8.8–13.5 31.0–42.1	10.9 34.8	1.6 3.2	8.8 31.0
External secondary branch	12	7.1–11.5 24.5–35.8	8.6 27.5	1.2 3.1	7.7 27.1
Internal primary branch	11	8.3–11.3 28.3–35.2	9.4 30.7	0.9 1.8	8.6 30.3
Internal secondary branch	10	6.7–8.6 21.8–26.8	7.7 25.1	0.7 1.6	6.9 24.3
Claw 4 heights
Anterior primary branch	14	8.8–14.7 31.1–45.8	11.1 35.7	1.8 3.9	10.2 35.9
Anterior secondary branch	14	7.4–12.5 24.3–35.8	8.8 28.4	1.6 3.7	9.2 32.4
Posterior primary branch	14	10.0–16.8 35.0–47.2	12.2 39.3	1.9 3.7	11.8 41.5
Posterior secondary branch	13	7.9–12.8 27.6–39.9	9.9 31.7	1.4 3.3	9.7 34.2

TABLE 5. Measurements [in µm] of selected morphological structures of eggs of Macrobiotus paulinae sp. nov. mounted in Hoyer’s medium (N—number of eggs / structures measured, RANGE refers to the smallest and the largest structure among all measured specimens; SD—standard deviation).

CHARACTER	N	RANGE	MEAN	SD
Diameter of egg without processes	11	57.0–70.5	62.7	4.9
Diameter of egg with processes	11	66.3–85.6	74.1	6.2
Process height	33	3.8–8.1	5.6	1.0
Process base width	33	3.6–7.7	5.0	1.0
Process base/height ratio	33	58%–134%	92%	18%
Terminal disc width	33	2.3–4.2	3.4	0.5
Distance between processes	33	1.4–5.0	2.8	0.8
Number of processes on the egg circumference	11	24–32	27.6	2.4