Watsonidia fulgida

Grados, Juan, 2019, A new species of the genus Watsonidia Toulgoët, 1981 (Lepidoptera, Erebidae, Arctiini): example of polymorphism in the Amazon of Peru, Zootaxa 4691 (1), pp. 33-46: 35-39

publication ID

https://doi.org/10.11646/zootaxa.4691.1.2

publication LSID

lsid:zoobank.org:pub:EF88CFA5-2029-476D-B2F5-474F5E8507BA

persistent identifier

http://treatment.plazi.org/id/120487CB-FFF4-FFFE-C4C3-95BFFDC8F78D

treatment provided by

Plazi

scientific name

Watsonidia fulgida
status

sp. nov.

Watsonidia fulgida  sp. nov.

( Figs. 1–8View FIGURES 1–2View FIGURES 3–6View FIGURES 7–10)

Diagnosis: It is a similar species to W. reimona  , according to the wing color pattern. It can be differentiated from it by the following: on the forewings, the short black line originated at the lower distal part of the second black round line which involves the discal cell is not present, the black line of the apex is continuous whereas, in W. reimona  it is interrupted; termen is black in all its extension whereas, in W. reimona  the anterior half is black. In ventral view of the genital capsule, the distal parts of the valvae are somewhat square in W. fulgida  , whereas in W. reimona  , they are oval. In W. reimona  , the lateral prolongation of the tegumen is glabrous, wide at its base, decreasing in thickness towards the distal part and bears a sharp end; in W. fulgida  the prolongation is thin and elongated in almost all its extension, bearing spicules in the distal third.

Description of morphotype 1: Male ( Figs.1–2View FIGURES 1–2). Forewing span: 14–15 mm (n = 18). Head: Proboscis light brown. Frontoclypeus white. Vertex and postgena mustard. Palpi mustard, curved towards the head and reaching the medial part of the frontoclypeus. First palpomere with piliform scales towards its base; second palpomere similar in length to the first, wider towards the distal part; third palpomere small. Ocellus black and antennal alveolus whitish mustard. Bipectinated antennae. Scape, pedicel and axis of the flagellum, white. First three proximal rami small. Middle rami similar in size to the axis. Fifth distal part of the flagellum does not present rami. Cervical scales mustard. Thorax: Patagia white with mustard scales on the anterior surface. Tegula white, with a black spot posterolateral to surface of the patagia, arising from the central part of the anterior surface, reaching the medial part, and becoming somewhat wider. Posterior part of the patagia mustard. Mesoscutum and mesoscutellum white.A mustard spot at the central anterior part of the mesoscutum and a black spot at the central posterior part. A black spot in the central part of the mesoscutellum. Metascutellum and thoracic pleura white. First pair of legs white with black spots and sparse white scales on the internal side of the femur, tibia and tarsi. Epiphysis brown. Second pair of legs white, with a thin black line along the external surface of the tibia and the tarsi. Tibial spurs white. Third pair of legs white. Tymbal organ covered by white scales on the katepisternum. Forewing (dorsal): White with costal margin black at the first proximal third. Black line at the base of the wing. A first semicircular black line involving the discal cell; from the first proximal third of the wing, and extending to the distal part, ending where R 2+3+4+5 arises. Mustard line near the base of the wing, ventral to the black costal margin, reaching the black semicircular line. Second semicircular black line at the apex, including the distal quarter of the costal directing ventrally from the beginning of R 4 -R 5, passing through the proximal part of R 5 -M 1, the medial portion of the M 1 -M 2, and extending throughout the distal half of M 2 -M 3. Black termen reaching the tornus and projecting itself in an oblique line crossing the distal part of the anal cell, the subdistal parts of the 1A-2A and the Cu 2 -1A extending to the subdistal part of the first semicircular line. Mustard spot between the second and third semicircular lines, extending from the ventral part of the costal margin up to the M 2 -M 3. A third semicircular black line begins at the proximal part of the 1A-2A, runs through the Cu 2 -1A to the medial part, directs ventrally and extends from the 1A-2A, involves the anal cell and its posterior margin, towards the proximal side of it. A mustard spot between the first and third black semicircular lines; extending from the distal part and limited by a black oblique line arising from the tornus, to the posterior margin, limited by 2A. A mustard spot in the anal cell between the base of the wing and the third semicircular line. Forewing (ventral): White with a faint mustard line at the costal margin.A second black line present on the dorsal side, towards the apex, faintly visible. A small mustard spot in the proximal part of the R 5 -M 1. Hindwing (dorsal surface): White with mustard scales extending from cell M 1 -M 3 to anal cell, more prominent in the latter. Hindwing (ventral surface): White with mustard scales in the anal cell. Abdomen: Mustard on the dorsal side, with white piliform scales on the lateral and posterior sides of the last sternite. White on the ventral surface. Male genitalia ( Figs. 3–6View FIGURES 3–6) (Genitalia # JGA 849): Tegumen somewhat sclerotized and its anterior margin shaped like an inverted “V”; presenting elongated, thin and sclerotized extensions that go beyond the tip of valvae towards the postero-lateral parts and bear spicules at the distal third; posterior margin straight. Union of the tegumen and uncus membranous. Uncus narrow at the base; setae present at the lateral parts of the proximal two thirds; sharp and sclerotized at the distal end; in lateral view, the central part twice the width at base. Valvae in lateral view, rectangular, wide and sclerotized, with a slight invagination in the medial part of the dorsal side; a large invagination at the distal end, forming a spoon shaped cavity; setae present along the ventral margin. Juxta triangular and weakly sclerotized. Transtilla with small sclerotized areas on each side. Aedeagus elongated and somewhat sclerotized. Caecum penis somewhat developed. Vesica membranous extending towards the dorsal part and presenting a sclerotized area towards the base of the dorsal part; minute spicules present on the dorsal area; cornuti at the distal central part, with tiny spicules on the area below the cornuti.

Female ( Figs. 7–8View FIGURES 7–10): Forewing span: 15–17 mm (n=14). Patterns of wing and body color similar to the male, differing on the following characters: antennae with minute rami; hindwings elongated and somewhat triangular; frenulum composed of three bristles. Female genitalia ( Figs. 11–12View FIGURES 11–14) (Genitalia # JGA 851): Pheromone glands present. Eighth tergite uniformly sclerotized. Anal papillae well developed bearing setae throughout the area, denser on the proximal and dorsal surfaces; in lateral view, height 1.5 times its width. Posterior apophyses four times larger than the anterior ones. Ostium and antrum in central position, the latter sclerotized. Antevaginal lamella somewhat sclerotized. Postvaginal lamella membranous. Ductus bursae membranous, wide and flattened; distal third somewhat sclerotized. Cervix bursae somewhat sclerotized, wider than long. Corpus bursae membranous, somewhat globose; in dorsal view, oval, somewhat narrower to the left side. A small signum at the dorsal side and another at the posterior of the right side. Ductus seminalis arising from the left side of the cervix bursae.

Type material: HOLOTYPE male ( Figs. 1–2View FIGURES 1–2): PERU, CUSCO: Cashiriari, 11°52’S, 72°39’W, 690 m, 04– 05.xii.1997, J. Grados (11:00 pm–12:00)GoogleMaps  . 30 Paratypes (16 males and 14 females): PERU, UCAYALI, 1 male, Masisea, C.C.N.N., Betel, 08°25’29.94’’S, 74°15’42.81’’W, 138 m, 08.viii.2009, C. CarranzaGoogleMaps  ; 1 female, Puerto Putin , 08°44’59.2’’S, 74°08’19.52’’W, 122 m, 17.vii.2008, M. AlvaradoGoogleMaps  ; 1 female, Río Tamaya , 08°51’41.9’’S, 74°04’20.6’’W, 150 m, 07–08.vii.2008, M. Alvarado.GoogleMaps  JUNIN: 2 females, Mazamari , 11°20’33’’S, 74°33’04’’W, 1100 m, 28–29.v.2011, P. Hocking legGoogleMaps  . CUSCO: 1male, 12 km O de Sonampiato, 11°39’52.07’’S, 73°14’35.01’’W, 887 m, 29.v.2011, C. EspinozaGoogleMaps  ; 1 male, San Martín C, 11°47’S, 72°41’W, 480 m, 06.iv.1997, J. GradosGoogleMaps  ; 1 male, Pagoreni , 11°42’S, 72°54’W, 470 m, 02.x.1998, G. ValenciaGoogleMaps  ; 1 male, 7.5 km SO de Puerto Huallana ( Río Picha ), 11°49’21’’S, 72°11’24’’W, 441 m, 05–07.ix.2017, J. GonzálesGoogleMaps  ; 2 males, Cashiriari , 11°52’S, 72°39’W, 690 m, 04–05.xii.1997, J. Grados (2:00–3:00 am)(Light trap MV / UV)GoogleMaps  ; 1 male, idem except, 06.xii.1997GoogleMaps  ; 1 male, idem except (GENITALIA # 850– JGA)GoogleMaps  ; 1 female, Las Malvinas, 11°52’S, 72°56’W, 360 m, 20.ix.1997, J. Grados (Light trap MV / UV)GoogleMaps  . MADRE DE DIOS: 1 male, CICRA, Río Los Amigos , 12°33’S, 70°06’W, 280 m, 06.xi.2006, A. AsenjoGoogleMaps  ; 2 males, idem except, 17.xi.2006GoogleMaps  ; 1 female, idem except, 27.xi.2006 (GENITALIA # 851– JGA)(Genitalia # 968– JGA)GoogleMaps  ; 1 male, idem except, 16.i.2007 (GENITALIA # 849– JGA)GoogleMaps  ; 1 male, idem except, 12°34’7.35’’S, 70°05’56.8’’W, 380 m, 08.xii.2005, J. Grados leg. (Genitalia # 972– JGA)GoogleMaps  ; 1 female, Albergue Posada Amazonas, 12°47’S, 69°14’W, 300 m, 05.xii.2003, A. LescanoGoogleMaps  ; 1 male, idem except, 13.xii.2003GoogleMaps  ; 1 female, idem ex- cept, 12°48’17’’S, 69°17’35’’W, 280 m, 03.x.2004, T. McCabeGoogleMaps  ; 1 female, Tambopata Research Center, 13°08’S, 69°36’W, 300 m, 13.v.2001, J. Grados (Light trap MV)GoogleMaps  ; 1 female, Albergue Refugio Amazonas, Río Tambopata , 12°52’30’’S, 69°24’35’’W, 231 m, 09.x.2016, D. CouceiroGoogleMaps  ; 2 females, idem except, 22.x.2016GoogleMaps  ; 1 female, idem except 24.vi.2017GoogleMaps  ; 1 female, idem except, 16.vii.2017, Wendy and Joshua VillanuevaGoogleMaps  ; 1 female, idem except, 20.x.2017, D. CouceiroGoogleMaps  ; 1male, idem except, 05.viii.2018. PUNO: 1 male, P.N. Bahuaja-Sonene, 13°11’42’’S, 70°07’56’’W, 330 m, 03.vi.2013, J. Grados, E. Razuri & J. Barrientos (Genitalia # 1000– JGA)GoogleMaps  ; 1 male, idem except, 13°11’35’’S, 70°07’56’’W, 05.vi.2013GoogleMaps  . Additional material examined. PERU, MADRE DE DIOS: 1 female, Rio Tambopata Res : 30 air km. SW Pto. Maldonado, 290 m, 11–15.xi.1979, J.B. Heppner (subtropical moist forest) ( USNM)  ; 4 males, idem except, 6–10.xi.1979  .

Etimology: fulgida  is a feminine adjective in singular nominative meaning bright. The name was chosen by Wendy and Joshua Villanueva, participants of the Citizen Science project.

Distribution: Known in Peru from the departments of Ucayali, Junín, Cusco and Madre de Dios (Peruvian Amazon).

Barcoding: The mitochondrial DNA sequence (COI) of one of the paratypes (Voucher MUSM-Arctiinae VBC # 359) is as follows:

AACTTTATATTTTATCTTTGGTzATCTGAGCTGGAATAGTAGGAACTTCTCTAAGTTTATTAATTC- GTGCTGAATTAGGAAATCCTGGATCTTTAATTGGAGACGATCAAATTTATAATACAATTGTAACT- GCCCATGCTTTTATTATAATTTTCTTTATAGTAATACCAATTATAATTGGAGGATTTGGTAATTGATTA GTACCTTTAATACTAGGAGCCCCAGATATAGCATTCCCTCGAATAAATAATATAAGTTTTTGACTCTTACCCCCAT- C AT TA A C AT TAT TA AT T T C A A G A A G A AT C G TA G A A A AT G G A G C A G G A A C A G G AT G A A C A G - TATACCCCCCACTTTCATCTAATATTGCTCATGGAGGAAGTTCCGTAGATTTAGCTATTTTTTC ATTACACTTAGCTGGAATTTCATCAATTTTAGGAGCCATCAATTTTATTACAACAATTATTAATATAC- GATTAAATAATTTATCATTTGATCAAATACCTTTATTTATTTGAGCTGTAGGTATTACAGCTTTTT- TATTATTATTATCATTACCTGTTTTAGCTGGAGCTATTACAATATTATTAACAGATCGTAATCTTA- ATACTTCATTTTTTGATCCTGCTGGAGGAGGAGACCCAATTCTCTACCAACATTTATTC

Remarks: Watsonidia reimona  was described by Schaus (1933) from two male and one female specimens from Buena Vista ( Colombia), a male was designated as Holotype. The information provided by Watson (1971) is as follows: holotype male; “Collection Wm. Schaus; S.C. Patchett Coll; Buena Vista, Colombia; Type No. 34388 U.S. N.M.; Glaucostola reims Schaus.  Type; Arctiidae  genitalia slide no. AW253; Holotype male Glaucostola reigns Schaus A.W. 1967  .”

Watsonidia  was proposed by Toulgoët (1981), composed of four species: W. reimona  ( Glaucostola  ), W. pardea  ( Glaucostola  ), W. porioni  and W. navatteae  . He designated Watsonidia reimona  as the type species of the genus ( Schaus 1933) (= Glaucostola reimona Schaus, 1933  ). When describing the species W. porioni, Toulgoët (1981)  compared the genital capsule of the new species with a male specimen from Apuya, Napo River ( Ecuador), which he identified as W. reimona  (nec W. reimona  ).

Comparing the color pattern and the genital traits of the specimen used, deposited and photographed by Toulgoët (1981: 65, Figs. 1, 2View FIGURES 1–2 and 5View FIGURES 3–6) with the holotype of W. reimona  ( Watson 1971: 124, plate 20: f; plate 50: c,d), different characters can be seen, indicating they correspond to distinct species. In his publication Toulgoët (1981) considered he was representing W. reimona  but he did not realize it was an unknown species.

Description (stained morphotype): Male ( Figs. 27, 30, 33View FIGURES 27–35). Forewing span: 14–15 mm (n = 5). Except for the black spot on the forewings, the stained morphotype is similar to the male of the white one ( Figs. 27,30, 33View FIGURES 27–35). The male genitalia ( Fig. 28–29, 31–32, 34–35View FIGURES 27–35) is similar to the white morphotype. Valvae and lateral processes of the tegumen are variable, and the range of variability is continuous in both morphotypes.

Female ( Figs. 9–10View FIGURES 7–10): Forewing span: 13–15 mm (n=4). Wing and body color pattern similar to the male, differing in the following characters: antennae with minute rami; hindwings elongated; frenulum composed of three bristles. Except for the black spot on the forewings, it is similar to the female of the white morphotype. Female genitalia ( Figs. 13–14View FIGURES 11–14) (Genitalia # 853–JGA): There are no differences between this and the genitalia of the white morphotype.

Material examined: PERÚ: CUSCO: 1 male, Pagoreni , 11°42’S, 72°54’W, 470 m, 02.x.1998, G. Valencia (GENITALIA # 852— JGA)GoogleMaps  ; 1 male, Segakiato, Río Camisea , 11°48’S, 72°52’W, 330 m, 08.x.1997, J. Grados (Light trap MV)GoogleMaps  ; 1 female, 1.3 km SSO de Las Malvinas , 11°51’30’’S, 72°57’00’ W, C. Espinoza  . MADRE DE DIOS: 1 male, Río Los Amigos , CICRA, 12°33’S, 70°06’W, 280 m, 25.xi.2006, A. Asenjo (Genitalia # 977– JGA)GoogleMaps  ; 1 female, Albergue Refugio Amazonas, Río Tambopata , 12°52’30’’S, 69°24’35’’W, 231 m, 12.xi.2016, D. Couceiro (GENITALIA # 853— JGA)GoogleMaps  ; 1 female, idem except, 20.x.2017GoogleMaps  ; 1 male, ídem except 12.v.2018, J. Shoobridge et alGoogleMaps  .; 1male, ídem except, 05.viii.2018 (Genitalia # 1001– JGA)GoogleMaps  ; 1 male, Rio Tambopata Res : 30 air km. SW Pto. Maldonado, 290 m, 11–15.xi.1979, J.B. Heppner (subtropical moist forest)( USNM)  ; 1 male, idem except 21–25.xi.1979 ( USNM)  .

Barcoding: The mitochondrial DNA sequence ( COI) of one specimen is as follows (Voucher MUSM-Arctiinae VB # 200):

AACTTTATATTTTATCTTTGGTATCTGAGCTGGAATAGTAGGAACTTCTCTAAGTTTATTAATTC- GTGCTGAATTAGGAAATCCTGGATCTTTAATTGGAGACGATCAAATTTATAATACAATTGTAACT- GCCCATGCTTTTATTATAATTTTCTTTATAGTAATACCAATTATAATTGGAGGATTTGGTAATTGATTAG- TACCTTTAATACTAGGAGCCCCAGATATAGCATTCCCTCGAATAAATAATATAAGTTTTTGACTCT- TACCCCCATCATTAACATTATTAATTTCAAGAAGAATCGTAGAAAATGGAGCAGGAACAGGATGAA- CAGTATACCCCCCACTTTCATCTAATATTGCTCATGGAGGAAGTTCCGTAGATTTAGCTATTTTTTCA TTACACTTAGCTGGAATTTCATCAATTTTAGGAGCCATCAATTTTATTACAACAATTATTAATATACGAT- TAAATAATTTATCATTTGATCAAATACCTTTATTTATTTGAGCTGTAGGTATTACAGCTTTTTTATTATTAT- TATCATTACCTGTTTTAGCTGGAGCTATTACAATATTATTAACAGATCGTAATCTTAATACTTCATTTTTT- GATCCTGCTGGAGGAGGAG

MV

University of Montana Museum

UV

Departamento de Biologia de la Universidad del Valle

USNM

Smithsonian Institution, National Museum of Natural History

COI

University of Coimbra Botany Department