Ornilius rotundus, Zhang & Cong & Shen & Grishin, 2022

Zhang, Jing, Cong, Qian, Shen, Jinhui & Grishin, Nick V., 2022, Taxonomic changes suggested by the genomic analysis of Hesperiidae (Lepidoptera), Insecta Mundi 2022 (921), pp. 1-135 : 12-13

Ornilius rotundus Grishin, new genus and new species

http://zoobank.org/ 6CAFDF62-38BE-465D-934A-D844A589F12A http://zoobank.org/ 926EC06C-982B-4811-9152-0270F924C028

Definition of the new species. This is the species Evans misidentified as Papilio cebrenus Cramer, 1777 (type locality Suriname) and called “ Salatis cebrenus ”. Thus, the diagnostic characters for it are given in Evans (1952), where the species keys out to D.2.3. Specifically, both sexes have wings rounder than most relatives, fringes not checkered. Males with yellowish hyaline spots on forewing, cheeks broadly white. Forewing of female with hyaline discal band of three spots well-aligned with each other, small roundish spot in cell M 3 -CuA 1 offset from the discal band and three well-developed (not one as in Salatis species) hyaline subapical spots. The COI barcode sequence of the holotype is:

AACTTTATACTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCACTAAGATTATTAATTCGAACTGAATTAG GAACTCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTT TATAGTAATACCTAT TATAAT TGGAGGAT T TGGAAAT TGAT TAAT TCCTCTCATACTCGGAGCCCCAGATATAG CATTTCCACGAATAAATAATATAAGATTTTGATTATTACCCCCATCTTTAACTTTACTAATTTCAAGAAGAATTG TAGAAAATGGTGCTGGAACTGGATGAACAGTATATCCTCCTTTATCGTCTAATATTGCTCACCAAGGATCTTCTG TAGACTTAGCAATTTTTTCTTTACATTTAGCAGGAATTTCATCTATCTTAGGAGCTATTAATTTCATTACAACAATTAT TAACATACGAATTAAAAATTTATCATTTGATCAAATACCATTATTTATTTGAGCTGTTGGAATTACAGCTCTTTTATTAT TACTTTCTTTACCTGTCTTAGCTGGCGCTATTACTATACTTTTAACTGATCGAAATTTAAATACTTCATTTTTTGATC CAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type locality. Brazil: Santa Catarina , São Bento do Sul, elevation 850 m, GPS coordinates −26.283, −49.417.

Distribution. The species is known only from the Southeast and South regions in Brazil.

Type material. Holotype ( Fig. 2a,b ), male deposited in the National Museum of Natural History , Smithsonian Institution , Washington, DC, USA ( USNM), with the following rectangular white labels: || BRAZIL: Sta Catarina | Sao Bento do Sul | 26°17′S 49°25′W | 25.III.1990 | 850m, leg. Rank || GENITALIA NO. | X-5024 | J.M.Burns 2001 || USNMENT | [barcode image] | 00913850 || DNA sample ID: | NVG-17104 C01 | c/o Nick V. Grishin || . Paratypes: 3 ♂♂ and 5 ♀♀ from Brazil: Espírito Santo and Rio de Janeiro in the Natural History Museum, London, UK ( BMNH), 1 ♂ and 1 ♀ in USNM and 3 ♀♀ in the ZMHB. Type identification labels will be mailed to curators of these collections to be placed on these specimens.

Definition of the new genus. This new genus is erected here to receive species previously included in Salatis Evans, 1952 (type species Papilio salatis Stoll, 1782 ), but not monophyletic with it and instead originating near the base of the group consisting of Bungalotis Watson, 1893 (type species Papilio midas Cramer, 1775 ), Sarmientoia Berg, 1897 (type species Dyscophus faustinus Burmeister, 1878 ), Salatis Evans, 1952 , Nicephellus Austin, 2008 (type species Eudamus nicephorus Hewitson, 1876 ), Salantoia Grishin, 2019 (type species Eudamus eriopis Hewitson, 1867 ), Fulvatis Grishin , new genus (type species Telegonus fulvius Plötz, 1882 ), and Adina Grishin , new genus (type species Nascus adrastor Mabille and Boullet, 1912 ) ( Fig. 1 ). While the wing pattern characters are reserved to define the new species, the new genus is defined by male genitalia that are more likely to be the shared character for the genus if additional congeners are discovered. This genus is distinguished from its relatives by the following characters in male genitalia: uncus undivided, concave and narrow in lateral view, tegumen with two flanges about half of uncus length, valva nearly as broad as long, nearly square in shape, long process of sacculus reaching harpe, harpe twice as broad as long, its distal margin with irregular broad dentations. In DNA, a combination of the following base pairs is diagnostic: aly2487.42.4:G49 T, aly2012.14.3:G1592C, aly185.5.3:G934C, aly2012.62.1: T 90 T (not C), aly 1656.12.3: T 762 T (not C), aly 1656.12.3:A772A (not G), aly527.19.4:G150G (not A), aly294.11.1:A93A (not G), aly2202.33.1: T 40 T (not G), aly 1231.7.2: T 1033 T (not A), aly 1231.7.2:G1019G (not C), aly15220.1.1: T 537 T (not C), aly1603.69.1: T 840 T (not C), aly1139.65.13:C280C (not A), and aly1139.46.3:A70A (not C).

Type species. Ornilius rotundus Grishin, new species.

Species included in the genus. Only the type species.

Parent taxon for the genus. Tribe Phocidini Tutt, 1906 .

Etymology. The genus name is a masculine noun in the nominative singular, given due to the elaborate and embellished shape of the genitalia: Orn [atus] + ilius (from ilia: guts, groin, genitals, etc.). The species name is a masculine adjective proposed for rounded wings on the type species, more so than in most Phocidini .

Figures

Figure 1. Genomic tree of Eudaminae. The tree is constructed from protein-coding regions. The tree is rooted with Pterourus glaucus (Linnaeus, 1758) (NVG-1670), not shown. Statistical support values are shown on nodes. For each specimen, its name adopted in this work is given first, and a previously used name is listed in square brackets (if different), supplemented with the DNA sample number, type status (see Table 2 caption for abbreviations) and general locality. See Table S1 in the Supplemental file for additional data about these specimens. Synonyms are given in parentheses preceded by “=”, and in addition by “‡” for unavailable names. The type status refers to this synonym, if the synonym name is provided. Clades corresponding to new genera, subgenera and species are colored in red, orange and green, respectively, and the names of new taxa are highlighted accordingly. Names of selected tribes, subtribes, genera, and subgenera are labeled at their clades. Clades corresponding to some genera are highlighted in yellow to compare their genetic diversifications (length of the highlight in horizontal dimension) with each other. Groups of similar genetic diversification would ideally correspond to genera. The

Figure 2. Holotypes of the Eudaminae species described in this work: a) Ornilius rotundus Grishin, gen. n., sp. n. dorsal; b) ibid. ventral; c) Dyscophellus australis Grishin, sp. n. dorsal; d) Salantoia metallica Grishin, sp. n. dorsal; e) ibid. ventral; f) ibid. left antennal club in ventro-anterior view, nudum facing up, 1 mm scale above; g) ibid. sterigma and ovipositor in ventral view, 1 mm scale below; h) Telegonus subflavus Grishin, sp. n. dorsal; i) ibid. ventral; j) Dyscophellus basialbus Grishin, sp. n. dorsal; k) ibid. ventral. Specimen images are to scale (shown under image a) and data are in the text. Photograph c (by N.V.G.) is © of the Trustees of the Natural History Museum London and is made available under Creative Commons License 4.0 (https://creativecommons.org/ licenses/by/4.0/).