Santarosamyia woodorum Fleming & Wood, 2025

Fleming, A. J., Smith, M. Alex, Hallwachs, Winnie & Janzen, Daniel, 2025, A new genus and a new species in the tribe Eryciini (Diptera, Tachinidae) from Area de Conservación Guanacaste in north-western Costa Rica, Biodiversity Data Journal 13, pp. e 161853-e 161853 : e161853-

Santarosamyia woodorum Fleming & Wood sp. nov.

Materials

Type status: Holotype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR 0019111 ; recordedBy: D. H. Janzen, W. Hallwachs & gusaneros; individualID: DHJPAR 0019111 ; individualCount: 1; sex: M; lifeStage: adult; preparations: pinned; otherCatalogNumbers: 00-SRNP-18594 , BOLD: AAA 1961, ASTAI 1758-07 ; occurrenceID: 8CF487EE-BF53-59E4-A5BB-6F042019AC6D; Taxon: scientificName: Santarosamyia woodorum ; phylum: Arthropoda; class: Insecta; order: Diptera ; family: Tachinidae ; genus: Santarosamyia ; specificEpithet: woodorum ; scientificNameAuthorship: Fleming & Wood, 2025; Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Guanacaste; county: Sector Santa Rosa; locality: Area de Conservacion Guanacaste ; verbatimElevation: 295; verbatimLatitude: 10.837600; verbatimLongitude: - 85.618700; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.8376; decimalLongitude: - 85.6187; Identification: identifiedBy: AJ Fleming; dateIdentified: 2024; Event: samplingProtocol: Reared from a Crambidae larva, Eulepte Janzen 06 00-SRNP-18594 ; verbatimEventDate: 24 - Oct- 2000; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen

Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR 0019109 ; recordedBy: D. H. Janzen, W. Hallwachs & gusaneros; individualID: DHJPAR 0019109 ; individualCount: 1; sex: M; lifeStage: adult; preparations: pinned, dissected; otherCatalogNumbers: 00-SRNP-18614 , BOLD: AAA 1961, ASTAI 1756-07 ; occurrenceID: EF600D3A-022F-5E82-BDF1-0925F3CFFD05; Taxon: scientificName: Santarosamyia woodorum ; phylum: Arthropoda; class: Insecta; order: Diptera ; family: Tachinidae ; genus: Santarosamyia ; specificEpithet: woodorum ; scientificNameAuthorship: Fleming & Wood, 2025; Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Guanacaste; county: Sector Santa Rosa; locality: Area de Conservacion Guanacaste ; verbatimLocality: Vado Nisperal; verbatimElevation: 295; verbatimLatitude: 10.837600; verbatimLongitude: - 85.618700; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.8376; decimalLongitude: - 85.6187; Identification: identifiedBy: AJ Fleming; dateIdentified: 2024; Event: samplingProtocol: Reared from a Crambidae larva, Eulepte concordalis ; verbatimEventDate: 19 - Sep- 2000; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen

Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR 0019110 ; recordedBy: D. H. Janzen, W. Hallwachs & gusaneros; individualID: DHJPAR 0019110 ; individualCount: 1; sex: M; lifeStage: adult; preparations: pinned; otherCatalogNumbers: 00-SRNP-18593 , BOLD: AAA 1961, ASTAI 1757-07 ; occurrenceID: FA189C84-7C68-5E13-9009-52420C1E65ED; Taxon: scientificName: Santarosamyia woodorum ; phylum: Arthropoda; class: Insecta; order: Diptera ; family: Tachinidae ; genus: Santarosamyia ; specificEpithet: woodorum ; scientificNameAuthorship: Fleming & Wood, 2025; Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Guanacaste; county: Sector Santa Rosa; locality: Area de Conservacion Guanacaste ; verbatimElevation: 295; verbatimLatitude: 10.837600; verbatimLongitude: - 85.618700; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.8376; decimalLongitude: - 85.6187; Identification: identifiedBy: AJ Fleming; dateIdentified: 2024; Event: samplingProtocol: Reared from a Crambidae larva, Eulepte concordalis ; verbatimEventDate: 22 - Oct- 2000; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen

Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR 0017098 ; recordedBy: D. H. Janzen, W. Hallwachs & Lucia Vargas; individualID: DHJPAR 0017098 ; individualCount: 1; sex: F; lifeStage: adult; preparations: pinned; otherCatalogNumbers: 07-SRNP-12386 , BOLD: AAA 1961, ASTAP 536-07 ; occurrenceID: 72A34A57-D486-5A08-95E3-40839717FEC9; Taxon: scientificName: Santarosamyia woodorum ; phylum: Arthropoda; class: Insecta; order: Diptera ; family: Tachinidae ; genus: Santarosamyia ; specificEpithet: woodorum ; scientificNameAuthorship: Fleming & Wood, 2025; Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Guanacaste; county: Sector Santa Elena; locality: Area de Conservacion Guanacaste ; verbatimLocality: Vado Nisperal; verbatimElevation: 20; verbatimLatitude: 10.847100; verbatimLongitude: - 85.771400; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.8471; decimalLongitude: - 85.7714; Identification: identifiedBy: AJ Fleming; dateIdentified: 2024; Event: samplingProtocol: Reared from a Crambidae larva, Omiodes cuniculalis ; verbatimEventDate: 27 - Mar- 2007; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen

Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR 0019112 ; recordedBy: D. H. Janzen, W. Hallwachs & gusaneros; individualID: DHJPAR 0019112 ; individualCount: 1; sex: F; lifeStage: adult; preparations: pinned; otherCatalogNumbers: 00-SRNP-18220 , BOLD: AAA 1961, ASTAI 1759-07 ; occurrenceID: 33F7A385-7246-5057-B75B-68F67ABD95D7; Taxon: scientificName: Santarosamyia woodorum ; phylum: Arthropoda; class: Insecta; order: Diptera ; family: Tachinidae ; genus: Santarosamyia ; specificEpithet: woodorum ; scientificNameAuthorship: Fleming & Wood, 2025; Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Guanacaste; county: Sector Santa Elena; locality: Area de Conservacion Guanacaste ; verbatimElevation: 290; verbatimLatitude: 10.863200; verbatimLongitude: - 85.663200; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.8632; decimalLongitude: - 85.6632; Identification: identifiedBy: AJ Fleming; dateIdentified: 2024; Event: samplingProtocol: Reared from a Pyralidae larva, Chloropaschia granitalis ; verbatimEventDate: 21 - Oct- 2000; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen

Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR 0019797 ; recordedBy: D. H. Janzen, W. Hallwachs & Lucia Vargas; individualID: DHJPAR 0019797 ; individualCount: 1; sex: M; lifeStage: adult; preparations: pinned; otherCatalogNumbers: 07-SRNP-12395 , BOLD: AAA 1961, ASTAB 345-07 ; occurrenceID: 95D52D36-5C88-5C2C-B9FC-19C9752A6DE0; Taxon: scientificName: Santarosamyia woodorum ; phylum: Arthropoda; class: Insecta; order: Diptera ; family: Tachinidae ; genus: Santarosamyia ; specificEpithet: woodorum ; scientificNameAuthorship: Fleming & Wood, 2025; Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Guanacaste; county: Sector Santa Elena; locality: Area de Conservacion Guanacaste ; verbatimElevation: 20; verbatimLatitude: 10.847100; verbatimLongitude: - 85.771400; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.8471; decimalLongitude: - 85.7714; Identification: identifiedBy: AJ Fleming; dateIdentified: 2024; Event: samplingProtocol: Reared from a Crambidae larva, Omiodes cuniculalis ; verbatimEventDate: 28 - Mar- 2007; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen

Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR 0037222 ; recordedBy: D. H. Janzen, W. Hallwachs & Lucia Vargas; individualID: DHJPAR 0037222 ; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: 07-SRNP-12403 , BOLD: AAA 1961, ASHYE 2055-10 ; occurrenceID: 6F277DFA-0504-5494-89D3-5D4D3D1B230C; Taxon: scientificName: Santarosamyia woodorum ; phylum: Arthropoda; class: Insecta; order: Diptera ; family: Tachinidae ; genus: Santarosamyia ; specificEpithet: woodorum ; scientificNameAuthorship: Fleming & Wood, 2025; Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Guanacaste; county: Sector Santa Elena; locality: Area de Conservacion Guanacaste ; verbatimElevation: 20; verbatimLatitude: 10.847100; verbatimLongitude: - 85.771400; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.8471; decimalLongitude: - 85.7714; Identification: identifiedBy: AJ Fleming; dateIdentified: 2024; Event: samplingProtocol: Reared from a Crambidae larva, Omiodes cuniculalis ; verbatimEventDate: 15 - May- 2007; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen

Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR 0070383 ; recordedBy: D. H. Janzen, W. Hallwachs & Minor Carmona; individualID: DHJPAR 0070383 ; individualCount: 1; sex: M; lifeStage: adult; preparations: pinned; otherCatalogNumbers: 22-SRNP-26507 , BOLD: AAA 1961, ACGBA 15868-23 ; occurrenceID: E69D8967-3C76-5544-8AD6-0A00B7DC8393; Taxon: scientificName: Santarosamyia woodorum ; phylum: Arthropoda; class: Insecta; order: Diptera ; family: Tachinidae ; genus: Santarosamyia ; specificEpithet: woodorum ; scientificNameAuthorship: Fleming & Wood, 2025; Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Guanacaste; county: Sector Rincon Rain Forest; locality: Area de Conservacion Guanacaste ; verbatimElevation: 326; verbatimLatitude: 10.970700; verbatimLongitude: - 85.314300; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9707; decimalLongitude: - 85.3143; Identification: identifiedBy: AJ Fleming; dateIdentified: 2024; Event: samplingProtocol: Reared from a Crambidae larva, Eulepte concordalis ; verbatimEventDate: 04 - Mar- 2022; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen

Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR 0070378 ; recordedBy: D. H. Janzen, W. Hallwachs & Minor Carmona; individualID: DHJPAR 0070378 ; individualCount: 1; sex: F; lifeStage: adult; preparations: pinned; otherCatalogNumbers: 22-SRNP-26509 , BOLD: AAA 1961, ACGBA 15869-23 ; occurrenceID: 1EFC71D9-58DB-54FD-AAE1-DE446454B19F; Taxon: scientificName: Santarosamyia woodorum ; phylum: Arthropoda; class: Insecta; order: Diptera ; family: Tachinidae ; genus: Santarosamyia ; specificEpithet: woodorum ; scientificNameAuthorship: Fleming & Wood, 2025; Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Guanacaste; county: Sector Rincon Rain Forest; locality: Area de Conservacion Guanacaste ; verbatimElevation: 326; verbatimLatitude: 10.970700; verbatimLongitude: - 85.314300; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9707; decimalLongitude: - 85.3143; Identification: identifiedBy: AJ Fleming; dateIdentified: 2024; Event: samplingProtocol: Reared from a Crambidae larva, Eulepte concordalis ; verbatimEventDate: 04 - Mar- 2022; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen

Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR 0070379 ; recordedBy: D. H. Janzen, W. Hallwachs & Minor Carmona; individualID: DHJPAR 0070379 ; individualCount: 1; sex: F; lifeStage: adult; preparations: pinned; otherCatalogNumbers: 22-SRNP-26512 , BOLD: AAA 1961, ACGBA 15870-23 ; occurrenceID: 9BD0A312-5B2D-5CE2-AF21-89561BF43F58; Taxon: scientificName: Santarosamyia woodorum ; phylum: Arthropoda; class: Insecta; order: Diptera ; family: Tachinidae ; genus: Santarosamyia ; specificEpithet: woodorum ; scientificNameAuthorship: Fleming & Wood, 2025; Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Guanacaste; county: Sector Rincon Rain Forest; locality: Area de Conservacion Guanacaste ; verbatimElevation: 326; verbatimLatitude: 10.970700; verbatimLongitude: - 85.314300; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9707; decimalLongitude: - 85.3143; Identification: identifiedBy: AJ Fleming; dateIdentified: 2024; Event: samplingProtocol: Reared from a Crambidae larva, Eulepte concordalis ; verbatimEventDate: 04 - Mar- 2022; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen

Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR 0070380 ; recordedBy: D. H. Janzen, W. Hallwachs & Minor Carmona; individualID: DHJPAR 0070380 ; individualCount: 1; sex: F; lifeStage: adult; preparations: pinned; otherCatalogNumbers: 22-SRNP-26513 , BOLD: AAA 1961, ACGBA 15871-23 ; occurrenceID: 682AEB94-D846-5F82-AFCB-1B0A7EC01D55; Taxon: scientificName: Santarosamyia woodorum ; phylum: Arthropoda; class: Insecta; order: Diptera ; family: Tachinidae ; genus: Santarosamyia ; specificEpithet: woodorum ; scientificNameAuthorship: Fleming & Wood, 2025; Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Guanacaste; county: Sector Rincon Rain Forest; locality: Area de Conservacion Guanacaste ; verbatimElevation: 326; verbatimLatitude: 10.970700; verbatimLongitude: - 85.314300; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9707; decimalLongitude: - 85.3143; Identification: identifiedBy: AJ Fleming; dateIdentified: 2024; Event: samplingProtocol: Reared from a Crambidae larva, Eulepte concordalis ; verbatimEventDate: 04 - Mar- 2022; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen

Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR 0111696 ; recordedBy: D. H. Janzen, W. Hallwachs & Janzen 2023; individualID: DHJPAR 0111696 ; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: 23-SRNP-26255 , BOLD: AAA 1961, ACGBA 16794-23 ; occurrenceID: 57EFF960-31A6-5B9E-9C5A-A9BD8ED4BA99; Taxon: scientificName: Santarosamyia woodorum ; phylum: Arthropoda; class: Insecta; order: Diptera ; family: Tachinidae ; genus: Santarosamyia ; specificEpithet: woodorum ; scientificNameAuthorship: Fleming & Wood, 2025; Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Guanacaste; county: Sector Rincon Rain Forest; locality: Area de Conservacion Guanacaste ; verbatimCoordinateSystem: Decimal; Identification: identifiedBy: AJ Fleming; dateIdentified: 2024; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen

Description

Male (Fig. 5), Head: vertex 1 / 3 head width; gena 1 / 6 of head height, approximately 1 / 5 of eye height; with one row of frontal setae, these extending below base of pedicel and one pair of reclinate orbital setae, nearly in line with frontal row; gena dark grey, covered in short black setulae; fronto-orbital plate dark grey with a silver sheen, covered in black setulae surrounding frontal setae; facial ridge setose, along lower 2 / 3 of its length; pedicel black; postpedicel black, 4 x as long as pedicel; arista, distinctly thickened on the basal half. Palpus dark brown, almost black, densely setulose, digitiform, not distinctly clubbed.

Thorax: scutum black ground colour, covered in a grey tomentum which appears to fade along posterior edge; four dorsal vittae, outer pair broken at suture, extending beyond third postsutural dorsocentral seta, inner pair unbroken extending beyond 2 nd postsutural dorsocentral, vittae becoming more prominent under certain angles of light; postpronotum bearing four setae, middle basal seta in line with outer and inner basal setae; anterior margin of anepimeron with only 2–4 long setae. Chaetotaxy: acrostichal setae 3: 3; dorsocentral setae 3: 4; intra-alar setae 3: 3; supra-alar setae 2: 3; 4 katepisternal setae; scutellum black with dark maroon along basal edges, with one pair of discal setae and three pairs of long flat marginal setae; apical setae long.

Abdomen: ground colour reddish – brown laterally to black dorsally; abdominal tomentum dull gold, forming conspicuous bands on dorsal surfaces of T 3 – T 5, these bands being bisected by a narrow median black stripe; median discal setae present T 3 and T 4.

Male terminalia (Fig. 6): sternite 5 with a deeply excavated median cleft along the posterior edge, approximately 1.4 x as wide as long, V-shaped, inner margins covered in dense tomentum; posterior lobes flattened somewhat apically, two strong setae surrounded by many shorter, weaker setulae; unsclerotised " window " on anterior plate of sternite 5 almost entirely translucent, almost indistinct directly basal to posterior lobes. Epandrium setulose, cercus triangular, slightly longer than surstyli; cercus apically pointed, completely separate along most of their length. Cercus in lateral view, with a slight downward curve at apex, densely setose along basal 2 / 3. Surstylus in lateral view, wide and robust, round medially, rounded and blunt at apex, not tapering to a point, giving the structure a wide digitate appearance; surstylus not fused with epandrium; when viewed dorsally, surstyli wide, slightly divergent, bearing a slight outward bend at apices. Pregonite broad, well-developed, apically rounded, blunt, with 6–7 setae along margin. Postgonite, slightly narrowed, up to 1 / 2 as wide as pregonite, curved at apex. Basiphallus with a well-developed narrow and curved epiphallus, distiphallus broad with a thick median longitudinal sclerotised reinforcement on its posterior surface pointed with a distinctive downward curve at apex and a broad, anterolateral, sclerotised acrophallus, on the anterior surface also curving downwards at the apex.

Female (Fig. 7), as in male, differing in the following traits: Head: bearing two pairs of proclinate orbital setae and two pairs of reclinate orbital setae, palpus dark ochraceous appearing brown to black, antennal pedicel dark orange almost brown, but distinctly lighter than postpedicel. Thorax: tomentum more brilliant yellow – gold than male, thinner post suturally, but apparently extending over the entirety of thorax and scutellum. Wings slightly more hyaline than male. Abdomen: abdominal tomentum gold, overall appearing more globose than males and in its terminalia.

Diagnosis

Santarosamyia woodorum sp. nov. can be distinguished from other Santarosamyia by the following combination of traits: fronto-orbital plate dark grey with a silver sheen, covered in black setulae surrounding frontal setae, frontal setae extending below base of pedicel; facial ridge strongly setose along 2 / 3–4 / 5 of its length. Santarosamyia woodorum sp. nov. is separated in the key from S. erecta comb. nov. by the gold tomentosity of the thorax and abdomen, its pale white translucent lower calypters and by its COI sequence clustered within the Barcode Identification Number (BIN) BOLD: AAA 1961.

The BOLD BIN BOLD: AAA 1961 contains both Santarosamyia woodorum (from Costa Rica) and S. unipilum from Canada. The two species are easily differentiated in the barcode region by 8 bp (Fig. 3 ).

Consensus DNA barcode for S. woodorum :

ACTTTATATTTTATTTTTGGAGCCTGAGCTAGTATAATTGGAACATCTTTAAGTATATTAATTCGAATTGAATTAGGACATCCCGGTTCATTAATTGGAAATGATCAAATTTACAATGTAATTGTAACAGCTCATGCATTTGTTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTTTAAT R TTAGGAGCCCCAGATATAGCCTTTCCACGAATAAATAATATAAGTTTTTGACTCCTTCCTCCTGCATTAACACTTTTATTAACAAGAAGTATAGTAGAAAGCGGATCTGGGACAGGATGAACAGTTTATCCCCCTTTATCTTCTATTATTGCTCATGGAGGAGCTTCTGTTGATTTAGCTATTTTTTCTTTACACTTAGCTGGAATTTCTTCTATTTTAGGAGCTGTAAATTTTATTACTACTGTTATTAATATACGATCATCAGGAATTACTTTTGATCGAATACCTTTATTTGTTTGATCAGTTGTTATTACAGCTTTATTACTCTTATTATCTTTACCTGTATTAGCCGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGATCCAGCGGGAGGAGGTGATCCTATTTTATATCAACATTTATTT

Etymology

Santarosamyia woodorum sp. nov. is named in honour of Dr. D. Monty Wood (1933–2020) and Grace Wood for their many years of dedication to the study of Diptera and, in particular, the family Tachinidae of ACG. Their legacy lives in Monty's invaluable contributions to science and the countless people he educated and collaborated with. Interim species-specific names for Santarosamyia woodorum sp. nov., included in previously circulating databases and publications, are tachinidWood 12 Wood 01 and Nilea Wood 01.

Distribution

Costa Rica, ACG, Guanacaste Province, 20–326 m elevation.

Ecology

Santarosamyia woodorum sp. nov. has been reared twelve times from at least two species of Lepidoptera in the family Crambidae : Omiodes cuniculalis Guenée, 1854 (n = 3), Eulepte Janzen 06 (n = 1) and Eulepte concordalis Hübner, 1825 (n = 7) and one species in the family Pyralidae : Chloropaschia granitalis (C. Felder, R. Felder & Rogenhofer, 1875) (n = 1) in dry forest, at elevations ranging from 20–326 m.

Figures

Figure 3. Phylogeny of 181 BINS from 12 genera of tachinid flies reared in ACG Costa Rica from the Eryciini. Santarosamyia gen. nov. shown in red.