Dicranomyia (Idiopyga) boreobaltica Salmela

Salmela, Jukka, Kaunisto, Kari M & Vahtera, Varpu, 2014, Unveiling of a cryptic Dicranomyia (Idiopyga) from northern Finland using integrative approach (Diptera, Limoniidae), Biodiversity Data Journal 2, pp. 4238-4238 : 4238

Dicranomyia (Idiopyga) boreobaltica Salmela sp. n.

Materials

Type status: Holotype. Occurrence: catalogNumber: JES-20120094 ; recordedBy: T. Nieminen; individualCount: 1; sex: male; Taxon: genus: Dicranomyia; subgenus: Idiopyga; specificEpithet: boreobaltica; scientificNameAuthorship: Salmela; Location: country: Finland; stateProvince: Ostrobothnia borealis pars ouluensis; verbatimLocality: Oulunsalo, Papinkari; verbatimLatitude: 64.9060; verbatimLongitude: 25.3764; verbatimCoordinateSystem: decimal degrees; verbatimSRS: WGS84; Event: samplingProtocol: Malaise trap; eventDate: 2005-8-11/10-8; habitat: Baltic coastal meadow; Record Level: institutionCode: ZMUT

Type status: Paratype. Occurrence: recordedBy: T. Nieminen; individualCount: 1; sex: male; Taxon: genus: Dicranomyia; subgenus: Idiopyga; specificEpithet: boreobaltica; scientificNameAuthorship: Salmela; Location: country: Finland; stateProvince: Ostrobothnia borealis pars ouluensis; verbatimLocality: Hailuoto, Pökönnokka; verbatimLatitude: 65.0790; verbatimLongitude: 24.8883; verbatimCoordinateSystem: decimal degrees; verbatimSRS: WGS84; Event: samplingProtocol: Malaise trap; eventDate: 2005-8-11/10-8; habitat: Baltic coastal meadow; Record Level: institutionCode: JSO

Type status: Paratype. Occurrence: recordedBy: T. Nieminen; individualCount: 1; sex: male; Taxon: genus: Dicranomyia; subgenus: Idiopyga; specificEpithet: boreobaltica; scientificNameAuthorship: Salmela; Location: country: Finland; stateProvince: Ostrobothnia borealis pars ouluensis; verbatimLocality: Hailuoto, Pökönnokka; verbatimLatitude: 65.0790; verbatimLongitude: 24.8883; verbatimCoordinateSystem: decimal degrees; verbatimSRS: WGS84; Event: samplingProtocol: Malaise trap; eventDate: 2005-8-11/10-8; habitat: Baltic coastal meadow; Record Level: institutionCode: ZMUT

Type status: Paratype. Occurrence: catalogNumber: DIPT-JS-2014-0248 ; recordedBy: J. Salmela; individualCount: 1; sex: male; Taxon: genus: Dicranomyia; subgenus: Idiopyga; specificEpithet: boreobaltica; scientificNameAuthorship: Salmela; Location: country: Finland; stateProvince: Ostrobothnia borealis pars borealis; verbatimLocality: Tornio, Isonkummunjänkä Mire Conservation Area, Kusiaiskorpi; verbatimLatitude: 65.8880; verbatimLongitude: 24.4792; verbatimCoordinateSystem: decimal degrees; verbatimSRS: WGS84; Event: samplingProtocol: Malaise trap; eventDate: 2013-8-1/9-26; habitat: Rich fen, rusty spring; Record Level: institutionCode: JES

Type status: Paratype. Occurrence: catalogNumber: DIPT-JS-2014-0251 ; recordedBy: J. Salmela; individualCount: 1; sex: female; Taxon: genus: Dicranomyia; subgenus: Idiopyga; specificEpithet: boreobaltica; scientificNameAuthorship: Salmela; Location: country: Finland; stateProvince: Ostrobothnia borealis pars borealis; verbatimLocality: Tornio, Isonkummunjänkä Mire Conservation Area, Kusiaiskorpi; verbatimLatitude: 65.8880; verbatimLongitude: 24.4792; verbatimCoordinateSystem: decimal degrees; verbatimSRS: WGS84; Event: samplingProtocol: Malaise trap; eventDate: 2013-8-1/9-26; habitat: Rich fen, rusty spring; Record Level: institutionCode: JES

Type status: Paratype. Occurrence: recordedBy: J. Salmela; individualCount: 1; sex: female; Taxon: genus: Dicranomyia; subgenus: Idiopyga; specificEpithet: boreobaltica; scientificNameAuthorship: Salmela; Location: country: Finland; stateProvince: Ostrobothnia borealis pars borealis; verbatimLocality: Tornio, Isonkummunjänkä Mire Conservation Area, Kusiaiskorpi; verbatimLatitude: 65.8880; verbatimLongitude: 24.4792; verbatimCoordinateSystem: decimal degrees; verbatimSRS: WGS84; Event: samplingProtocol: Malaise trap; eventDate: 2013-8-1/9-26; habitat: Rich fen, rusty spring; Record Level: institutionCode: ZMUT

Type status: Other material. Occurrence: catalogNumber: DIPT-JS-2014-0114 ; recordedBy: J. Salmela; individualCount: 7; sex: 4 females, 3 males; Taxon: genus: Dicranomyia; subgenus: Idiopyga; specificEpithet: boreobaltica; scientificNameAuthorship: Salmela; Location: country: Finland; stateProvince: Ostrobothnia borealis pars borealis; verbatimLocality: Tornio, Isonkummunjänkä Mire Conservation Area, Kusiaiskorpi; verbatimLatitude: 65.8880; verbatimLongitude: 24.4792; verbatimCoordinateSystem: decimal degrees; verbatimSRS: WGS84; Event: samplingProtocol: Malaise trap; eventDate: 2013-8-1/9-26; habitat: Rich fen, rusty spring; Record Level: institutionCode: JES

Description

Dicranomyia (Idiopyga) intricata Nieminen 2008: 24 (misidentification)

Dicranomyia (Idiopyga) cf. intricata Salmela 2013: 38 (preliminary annotation to the Finnish list)

Male. Head. Vertex dark brown, with short black setae. Rostrum light brown with a few short dark setae. Palpus 5-segmented; first palpomere very short, globular, 1.5 times wider than long; other palpomeres elongated, p2 length 140 µm, p3 100 µm, p4 100 µm and p5 120 µm. First palpomere with a long ventral seta, approximately 2 times longer than width of palpomere. Second and third palpomeres with 5 setae, arranged in the apical half of segments. Fourth palpomere bearing ca. 12 setae and p5 with 13-15 setae, most of these on the apices of the segments. Antennae 14-segmented, dark brown, segments bearing black setae mostly exceeding width of respective segment; setae straight on scape (ca. 10 setae) and pecidel (ca. 15 setae), straight or curved on flagellomeres (ca. 5 setae on each flagellomere). Scape cylindrical, length 200 µm, width 75 µm, pedicel wider apically than basally, length 115 µm, width 75 µm. Flagellomeres oval, longer than wide; f1 length 120 µm, width 65 µm, f2 length 8 µm, width 5 µm, f10 length 110 µm, width 40 µm. Thorax mainly dark brown. Prescutum dark brown, only small yellowish spots on hind lateral corners. Scutum dark brown with longitudinal yellow median line and yellow lateral spots near wing base. Mediotergite and anepisternum dark brown, mediotergite sometimes with narrow yellowish anterior margin. Laterotergite and anepimeron yellowish brown. Katepisternum bicolored: anterior half dark brown, posterior half yellowish brown. Fore coxa brown, mid and hind coxae yellowish brown. Femorae light brown or brown, tibiae and tarsi dark brown. Length of fore femora 4500 µm, tibia 5250 µm, t1 3500 µm, t2 1100 µm, t3 875 µm, t4 300 µm, t5 175 µm, claw 130 µm. Length of mid femora 5575 µm, tibia 5625 µm, t1 3200 µm, t2 1150 µm, t3 625 µm, t4 275 µm, t5 175 µm, claw 130 µm. Length of hind femora 5600 µm, tibia 5750 µm, t1 3050 µm, t2 1150, t3 650 µm, t4 275 µm, t5 178 µm, claw 130 µm. Halter grayish-brown. Wing clear, veins light brown - brown, pterostigma brown (Fig. 1). Apical part of Sc1, R1, Rs, R3, R4+5, M1+2, M3, CuA1, CuA2, apices of A1 and A2 with macrotrichia, other veins bare. Sc1 ending in C before or opposite base of Rs (Fig. 1). Wing length 6.0-6.5 mm. Abdomen light brown - dark brown, tergites mainly dark, anterior sternites lighter than caudal sternites. Both sternites and tergites covered with short brown setae. 9th tergite and proctiger as in Fig. 2. Gonocoxite and gonostylus with complicated structure. Gonocoxite dark brown, sparsely covered with dark setae. Ventromesal lobe of gonocoxite consisting of two main branches, the main lobe (lgx) and its appendage (algx, Fig. 3). The main lobe (lgx) is rod-like, straight and elongated, apex angular, medially with a patch of hyaline curly setae. The appendage (algx) with two branches, proximal branch smaller, having a small hairy lobe, caudal branch larger in size, apically with tuft of rather long hyaline setae (Fig. 3a). Inner appendage of gonocoxite (iagx, Fig. 4a, b, c) sclerotized, curved structure, apically with number of stout, short setae; apex of iagx rounded and slightly wider than its stalk. Gonostylus consisting of two main lobes (dorsal [dg] and ventral [vg]), ventrobasal lobe of ventral gonostylus (lvg), rostral prolongation (rostrum) of ventral gonostylus (rm) and subrostral prolongation of ventral gonostylus (srm) (Figs 3b, 4). Dg long, narrow, pointed and bare, vg ball-like, weakly sclerotized, bearing setae and microtrichia (Figs 3b, 4a). Lvg tail-like, sinuous and weakly sclerotized, having patches of hyaline setae both basally and apically; apex of lvg oval (Fig. 3). Basal part of rm dorsally covered with dark brown plate, rm light brown, well sclerotized and elongated, bearing two strong spines; apex of rm rounded and rather narrow, bearing a few short setae (Fig. 4a). Srm strongly sclerotized, approximately as long as rm, projected proximad (i.e. toward parameres), being widest medially; srm with number of median and subapical stout black spines; apex rounded in dorsal view, bearing one black and two hyaline stout setae (Fig. 4c, d). Ventral surface of aedeagus bearing hyaline setosity, lateral margin of parameres weakly serrated (Fig. 5).

Female. In general, similar to male. Wing length 6.5 mm. Cerci short, ca. 240 µm in length. Infra-anal plate with a strong caudal peak (Fig. 6a). Other parts of the female post-abdomen are presented in Fig. 6.

Diagnosis

Brownish, small species, very close to D. (I.) intricata . Ventrobasal lobe of ventral gonostylus sinuous, apex oval. Inner appendage of gonocoxite apically rounded. Rostral prolongantion of ventral apically rather narrow and subrostral prolongation simple, not bilobed, bearing dark stout spines. Female infra-anal plate with strong caudal peak.

Etymology

Boreo (borealis, Latin)= north, baltica (Latin)= referring to the Baltic Sea. The species is so far known from the northern Baltic area. The species name is deemed to be a latinized adjective in nominative singular.

Distribution

European, only known from Finland. The species is hitherto known from five separate localities; four of these are shore meadows in Oulunsalo and Hailuoto island (see Nieminen 2008), and the fifth locality is in Tornio, a rich fen ca. 12 km inland from the coast line, 15 m above sea level (Fig. 14).

Ecology

The species is probably halophilous, occurring in Baltic coastal meadows characterised by vascular plants such as Phragmites australis , Lysimachia thyrsiflora , Eleocharis palustris , Carex halophila and C. paleacea ( Nieminen 2008, as D. (I.) intricata ). These coastal meadows are produced by a phenomenon called land uplift, that is, the rebound of earth's crust after the retreating of the ice sheet; in the Bothnian Bay the rate of land uplift is about 8 mm/year ( Rehell 2006). In addition to the meadows influenced by brackish water, the species has been collected from a calcareous rich spring fen. This rich spring fen is known to have high concentrations of e.g. Ca (53 mg/l), Na (5.3 mg/l), Fe (32 mg/l) and having high specific conductivity (42.7 mS/m), alkalinity (4.85 mmol/l) and pH (7.9, T. Sallantaus, personal communication). This spring fen is located quite close to the current shore line, and extrapolating from Okkonen 2003 (fig. 21), one may estimate that this fen was on the Baltic shore some 600-700 years ago. It may be that high concentrations of dissolved minerals in the fen resemble brackish water habitat, allowing the survival of this halophilous crane fly species. It may thus be assumed that D. (I.) boreobaltica Salmela sp.n. is a recent relict species in the fen. It should be noted that some plants typical for the Baltic shores or brackish water have isolated populations on calcareous ponds or mires far from coastal areas (e.g. Tricloghin maritima , Potamogeton filiformis , Hämet-Ahti et al. 1998)

Conservation

Due to its apparent rarity, that is, small area of occupancy and extent of occurrence, the species could most likely be assessed as a threatened species according to IUCN criteria. Habitats of this species are highly endangered, usually small and isolated. There are a total of ca. 4200 ha of Baltic coastal meadows along the Finnish coast, and all such habitat types are red-listed ( Schulman et al. 2008). Also spring fens are threatened habitats ( Leka et al. 2008). Furthermore, Salmela ( Salmela 2005) studied adult crane fly fauna of 20 springs, of which 10 were calcareous springs, only some 30-60 km northeast from Kusiaskorpi rich fen, and D. (I.) boreobaltica Salmela sp.n. was absent from the samples. This and other negative records (i.e. absence) from>500 Malaise trapping sites in Finnish wetlands ( Salmela 2012, Salmela 2013, J. Salmela unpublished) indicate a very restricted range of this species. In a matter of fact, there are some endemic or highly disjunct plant (e.g. Alisma wahlenbergii , Euphrasia bottnica , Primula nutans ) and insect ( Elachista vonschantzi , Holopyga metallica , Macroplea pubipennis ) species in the Baltic coastal areas ( Hultén 1950, Dahl 1998, Mutanen 2003, Kölsch et al. 2006, Paukkunen et al. 2014). Hence, by using the above mentioned plants and insects as surrogates, D. (I.) boreobaltica Salmela sp.n. could either be i) a recently evolved allopatric species that survived Pleistocene glaciations and is currently only present in the Baltic area or ii) a disjunct species having populations in other (coastal) areas.

Taxon discussion

Based on morphology and COI sequence divergence, the new species is very closely related to the Holarctic species D. (I.) intricata . As already stated in the title of this article, the new species is cryptic, meaning that it is hard to distinguish from its sister species by morphological characters. Strictly speaking, cryptic species may mean taxa that are morphologically indisguishable ( Pfenninger and Schwenk 2007, but see Tan et al. 2010), but the new species described here can be separated from its sister species by using a genetic marker (barcoding region of COI) and morphology. However, morphological differences between these two species are not great and the only reliable diagnostic characters are found from male and female genitalia. These two species are allopatric, their closest known populations lay some 180 km apart. Despite these species not being from sympatric populations, we assume that their differences are well sufficient to keep their gene pools separated even in the case of possible secondary contact. Their COI divergence or K2P distance (5 %) is far too high to be considered as an intraspecific variation among majority of other insects (e.g. Hausmann et al. 2011, Park et al. 2011) or crane flies ( Pilipenko et al. 2012). Instead, intraspecific variation among insects is typically smaller than 2 % and higher COI divergence usually indicates two separate species ( Mutanen et al. 2013, Pentinsaari et al. 2014). Considering morphology, there is a recent case study from Israel ( Stary et al. 2012) showing that two closely related, allopatric Phyllolabis crane flies were treated as separate species although they have almost identical genitalia and the closest populations of these species live only 30 km apart. In Israel, the species were separated by a dispersal barrier (Rift Valley, Stary et al. 2012); in Fennoscandia, D. (I.) boreobaltica Salmela sp.n. and D. (I.) intricata are not separated by a distinct barrier, they have non-overlapping ranges perhaps because of biogeographic factors driven by climate (see e.g. Luoto et al. 2006, Väisänen et al. 1992) and availability of habitat (brackish water, calcareous springs in the vicinity of coast line).

External characters, such as wing venation and body coloration, between D. (I.) boreobaltica Salmela sp.n. and D. (I.) intricata are practically identical. The most important differences in male and female post-abdomen between the species are summarized in Table 2. Among other D. (Idiopyga) species, the new species is quite close to D. (I.) esbeni . Besides other details, the ventrobasal lobe of gonocoxite in D. (I.) esbeni is sinuous (see Stary 2007, fig. 1), and rather straight in D. (I.) boreobaltica Salmela sp.n. Dicranomyia (I.) melleicauda complicata de Meijere is also quite close to the new species, but has rather stout iagx and apically wide lvg (see de Meijere 1919, plates 5-6). Males of other species are easily separated from the new species based on differences in the stucture of hypopygium. Considering females, we refrain from further discussion due to the lack of comparative material.

DNA barcode

Standard 5′ region (658 bp) of the cytochrome c oxidase I (COI) sequence of Dicranomyia (I.) boreobaltica Salmela sp.n. BOLD Sample ID JES-20120094, holotype specimen:

TACCTTATACTTTATTTTTGGAGCTTGAGCAGGAATAGTGGGAACTTCATTAAGTATTATTATTCGAGCAGAATTAGGACACCCAGGTGCATTAATTGGAGACGACCAGATTTATAATGTGGTAGTTACTGCCCATGCTTTTATTATAATTTTCTTTATAGTTATACCAATTATAATTGGAGGATTCGGTAATTGATTAGTTCCTTTAATATTAGGAGCCCCAGATATAGCTTTCCCTCGAATAAATAATATAAGTTTTTGAATACTTCCCCCTTCTTTAACTTTATTATTAGCTAGAAGCATAGTTGAAAACGGGGCAGGAACTGGCTGAACAGTATACCCTCCCCTTTCTTCTGGAATTGCCCATTCAGGGGCTTCTGTAGATTTAGCTATTTTTTCTCTTCACCTAGCAGGTATTTCTTCTATTTTAGGAGCTGTTAATTTTATTACAACTGTTATTAATATACGTTCAGCAGGAATTTCATTTGATCGAATACCATTATTTGTTTGATCAGTAGTAATTACTGCTATTTTATTGCTTTTATCACTTCCTGTTTTAGCCGGAGCTATTACAATATTATTAACAGATCGAAACTTAAATACTTCATTTTTTGATCCCGCAGGTGGAGGAGACCCTATTTTATATCAGCATTTATTT

Based on K2P ( Kimura 1980) distances, the new species is closest to D. (I.) intricata (K2P distance 5.13 %), D. (I.) esbeni (7.16 %) and D. (I.) magnicauda (9.51 %); other distances within examined D. (Idiopyga) species range between 10.76 and 15.70 %.