Jemasonia pater ortizi (Orellana, [2010]) Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Orellana, Andrés, Brockmann, Ernst, Mielke, Carlos G. C., Mielke, Olaf H. H., Costa, Mauro & Grishin, Nick V., 2023

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Orellana, Andrés, Brockmann, Ernst, Mielke, Carlos G. C., Mielke, Olaf H. H., Costa, Mauro & Grishin, Nick V., 2023, Lessons from the genomic analysis of Hesperiidae (Lepidoptera) holotypes in the MIZA collection (Maracay, Venezuela), Zootaxa 5319 (4), pp. 573-581 : 578

Jemasonia pater ortizi (Orellana, [2010]) , stat. nov.

Genomic analysis reveals close clustering of the holotype of Jemadia ortizi Orellana, [2010] (type locality in Venezuela: Táchira) in the MIZA collection with specimens of Jemasonia pater ( Evans, 1951) (type locality in Colombia: Cundinamarca) ( Fig. 1 ). Their COI barcodes could be 100% identical in some specimens. As stated (and illustrated) in the original description, genitalia of J. ortizi are the same as J. pater (“Igual a los de J. pater ”) ( Orellana [2010]), with the major difference between the two taxa being in the dark palpi and darker body coloration beneath. Taxa differing in coloration but similar in genomes and genitalia are traditionally regarded as subspecies. Therefore, we propose to treat J. ortizi as a subspecies of J. pater : Jemasonia pater ortizi (Orellana, [2010]) , stat. nov. The COI barcode sequence of the holotype of J. p. ortizi , sample NVG-22029C07, GenBank accession OR178495, 658 base pairs is:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAATTGGAACATCCCTTAGATTACTAATTCGAACTGAATTAGGAACTCCAGAATCTTTAATTGGA GATGATCAAATTTATAATACTATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATGCCAATTATAATTGGAGGATTTGGAAATTGACTAG TTCCTCTAATATTAGGAGCACCTGATATAGCTTTCCCCCGAATAAATAACATAAGATTTTGATTATTACCCCCTTCATTAACTTTACTTATTTCAAGAAG CATTGTAGAAAATGGTGCCGGAACTGGATGAACAGTTTACCCCCCTCTTTCCTCTAATATCGCCCACCAAGGAGCTTCTGTAGATTTAGCTATTTTTTCT TTACATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATCAATATACGAATTAAAAACTTATCTTTTGATCAAATACCTT TATTTGTTTGAGCCGTAGGAATTACAGCATTATTATTACTTTTATCATTACCTGTATTAGCAGGAGCTATTACTATATTATTAACAGATCGAAATATTAA TACTTCTTTTTTTGATCCTGCTGGAGGAGGTGATCCTATTTTATATCAACATTTATTT

This sequence is identical to the barcode of Jemasonia albescens (Röber, 1925) neotype (DZ72.148), suggesting a possibility of introgression between these species, because in the Z chromosome tree, the neotype is sister to J. pater being separated from it by a branch with the length characteristic of closely related but distinct species ( Fig. 1a ). Their genitalia also differ ( Grishin et al. 2014; Mielke et al. 2022).

Figures

FIGURE 1. Phylogenetic trees of selected Pyrrhopyginae species constructed from protein-coding regions in a) Z chromosome and b) mitochondrial genome: Amenis pionia (gray), Amenis pedro stat. nov. (dark blue), Amenis picia (maroon), Amenis ponina (green), Jemadia pseudognetus (blue), Jemadia hospita (purple), Jemadia demarmelsi (orange), Jemasonia pater (cyan), Jemasonia albescens (red), Jemasonia hewitsonii (oilve), and Jemasonia sosia stat. rest. (aquamarine) The holotypes of species proposed by Orellana ([2010]) are labeled in magenta and highlighted in yellow. Statistical support values are shown at nodes. For each specimen, the name adopted in this work is given first, with comments or previously used name listed in square brackets (if different), supplemented with the DNA sample number, type status (see Materials and Methods for abbreviations) general locality and year it was collected (old means around and prior to the beginning of the 20th century, exact year not specified). See NCBI database entries in the bioproject PRJNA986225 for additional data about these specimens. Synonyms are given in parentheses preceded by “=”. The type status refers to this synonym, if the synonym name is provided.