Quadrus (Zera) vivax, Zhang & Cong & Shen & Song & Grishin, 2023

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2023, Genomics-based taxonomic rearrangement of Achlyodini and Carcharodini (Lepidoptera: Hesperiidae: Pyrginae), Insecta Mundi 2023 (16), pp. 1-33 : 12

Quadrus (Zera) vivax Grishin, new species

http://zoobank.org/ 6B5F54D9-0706-4CDC-9811-05E1A9414155

Definition and diagnosis. Evans misidentified (at least some) Achlyodes servius Plötz, 1884 (type locality in Brazil), which he treated as a subspecies of Zera hyacinthinus (Mabille, 1877) (type locality not specified, likely in Central America). Above, we placed Zera Evans, 1953 (type species Achlyodes zera Butler, 1870 ) in the genus Quadrus Lindsey, 1925 (type species Papilio cerialis Stoll, 1782 ) as a subgenus. Also, as shown above, A. servius is not closely related to Q. hyacinthinus but instead is a distinct species closer to Quadrus (Zera) tetrastigma (Sepp, [1847]) (type locality in Suriname). However, the species that keys to Evans’ “ Zera hyacinthinus servius ” and indeed is closer related to Q. hyacinthinus does not have a name and is described here. It is a species-level taxon, not a subspecies of Q. hyacinthinus , due to genetic differentiation ( Fig. 2a ), e.g., their COI barcodes differ by 2% (13 bp) in the presence of consistent phenotypic differences described below. Furthermore, while this species is in the same clade as Q. hyacinthinus , it is sister to Quadrus (Zera) hosta ( Evans, 1953) (type locality in Costa Rica), differing from it by 3.8% (25 bp) in the COI barcode. This new species keys to E.38.5b in Evans (1953) and is distinguished from its relatives by the following combination of characters: dorsal forewing without a hyaline spot in cell CuA 1 -CuA 2, dark central area extending neither to the wing base nor the end of discal cell, wing base violaceous, dark area in discal cell more extensive than in relatives and without prominent, continuous pale bar crossing it, but with one or two small, pale, sometimes narrowly connected spots; ventral forewing with a conspicuous tawny spot by the apex and tornal area broadly tawny, could be extending to and reaching costal margin, mostly unmarked, but sometimes with submarginal dark spot(s); dark discal band absent or vestigial on dorsal hindwing; tornal half of ventral hindwing bluish-white, contrasting with the tawny area and not gradually merging into it as in Q. servius .

Barcode sequence of the holotype. Sample NVG-19086H02, GenBank OR721875, 658 base pairs:

AACCTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACTTCTTTAAGTTTGTTAATTCGAACTGAATTAGGAAATCC TGGATCTTTAATTGGAGATGATCAAATTTATAATACTATCGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAA TTATAATTGGAGGATTTGGAAATTGACTAGTACCCCTTATACTAGGAGCACCTGATATAGCTTTCCCCCGAATAAATAATATAA GTTTTTGGTTATTACCCCCTTCTTTAATATTATTAATCTCAAGTAGTATTGTAGAAAATGGAGCTGGTACAGGTTGAACAGTTT ACCCACCTCTTTCAGCTAATATTGCCCATCAAGGATCATCTGTAGATTTAGCAATTTTTTCTCTTCATTTAGCAGGAATTTCTT CAATTCTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAGTCAATAATCTTTCCTTAGATCAAATACCCCTTTTTGTT TGATCCGTAGGAATTACAGCATTACTTTTATTATTATCTTTACCTGTTTTAGCTGGAGCTATTACTATACTATTAACTGATCGAA ATTTAAATACATCATTTTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♂ currently deposited in the National Museum of Natural History , Smithsonian Institution, Washington, DC, USA [ USNM], illustrated in Fig. 2c , bears four printed (date handwritten) labels: three white [ BRAZIL: RJ | Petropolis 900m | 6 Aug. ’78 | S. S. Nicolay], [DNA sample ID: | NVG-19086H02 | c/o Nick V. Grishin ], [USNMENT | {QR Code} | 01588802] and one red [HOLOTYPE ♂ | Quadrus (Zera) | vivax Grishin] . Paratypes: 1♂ 1♀ from Brazil: 1♂ Rio de Janeiro, Teresópolis , elevation 1000 m, GPS −22.4500, −42.9833, 17-Feb-1995, Robbins and Caldas leg. (NVG-19086H09, USNMENT 01588809) [ USNM] ; 1♀ Santa Catarina, Sao Bento do Sul , Feb-1984, Rank leg., from D. and J. Jenkins collection (NVG-15093C04) [ MGCL] .

Type locality. Brazil: Rio de Janeiro, Petrópolis.

Etymology. In Latin, vivax means lively or vibrant, given for the contrasty and more vivid appearance of this species compared to its relatives: ventral side of wings with more conspicuous tawny patches and spots and brighter, whiter, better defined pale area on the hindwing. The name is an adjective.

Distribution. Southeast and South Brazil.

Figures

Figure 2. Quadrus (Zera) nuclear genome-based phylogeny and type specimens. a) The nuclear genome-based phylogeny of selected species: Q. vivax sp. n. (red), Q. hyacinthinus (purple), Q. hosta (cyan), Q. servius stat. rest. (blue and magenta, with its synonym Achlyodes erisichthon labeled in blue) rooted with the remaining Zera species (not shown; see Fig. 1). Specimens shown below are highlighted in yellow; see Fig. 1 for other notations. b) Lectotype of Quadrus (Zera) servius designated herein, with its labels shown above on the right. c) Holotype of Quadrus (Zera) vivax sp. n. Specimens are in dorsal (left) and ventral (right) views, data in text. The scale bar at the bottom refers to specimens; the scale bar at the top refers to labels reduced by 1/3 compared to specimens.