Elymiotis tlotzin (Schaus, 1892) Schaus, 1892

Chacon, Isidro A., Janzen, Daniel H. & Hallwachs, Winnie, 2014, Four new species of Symmerista Huebner, 1816 (Notodontidae, Nystaleinae) from Costa Rica, ZooKeys 421, pp. 39-63 : 54-59

Taxon classification Animalia Lepidoptera Notodontidae

Elymiotis tlotzin (Schaus, 1892) comb. n. Figs 37-45

Material examined.

11 males 12 females.

Wild-caught adults:

2 Males: INBIOCRI000584965 Costa Rica, Prov. Guanacaste, Bagaces, Ref. Nac. Fauna Silv. R. L. Rodriguez, Estacion Palo Verde, 10.349119-85.352345, 10 m, May 1991, U. Chavarria (INBio). Male: INB0003072431 Costa Rica, Prov. Guanacaste, Bagaces, Pque. Nal. Palo Verde, Sector Palo Verde, 10.366668-85.383266, 0-50 m, 3 May 2000, H. Mendez (INBio). Male: INBIOCRI000386810 Costa Rica, Prov. Guanacaste, Liberia, P. N. Sta. Rosa, Playa Naranjo, 10.80275-85.666572, 0-10 m, May 1991, E. Alcazar (INBio). Male: INBIOCRI002426620 Costa Rica, Prov. Guanacaste, Liberia, Sector Las Pailas, 4.5 Km. SW del Volcan Rincon de la Vieja, 10.776784-85.351913, 800 m, 24 June 1995, K. Taylor (INBio). Male: INB0004065577 Costa Rica, Prov. Guanacaste, Liberia, Santa Rosa Nat. Pk., 10.83641-85.615491, 300 m, 4-6 December 1979, D. H. Janzen (INBio). Male: INB 0003319696 Costa Rica, Prov. Guanacaste, Nicoya, P.N. Barra Honda, Sector Barra Honda, 10.169826-85.379137, 50 m, 25-30 December 2000, H. Mendez (INBio). Female: INBIOCRI001184551 Costa Rica, Prov. Guanacaste, Bagaces, P. N. Palo Verde, Estacion Palo Verde, 10.349119-85.352345, 10 m, 20 June 1993, U. Chavarria (INBio). Female: INB0003300310 Costa Rica, Prov. Guanacaste, Hojancha, Z.P. Nosara, Hojancha, R.F. Monte Alto, 10.011248-85.402778, 400 a 500 m, 27 July - 3 August 2000, H. Mendez (INBio). Female: INBIOCRI000674401 Costa Rica, Prov. Guanacaste, Liberia, P.N.Sta. Rosa, Playa Naranjo, 10.802713 - 85.67479, 0-10 m, March 1991, E. Alcazar (INBio). Female: INB0003956448 Costa Rica, Prov. Guanacaste, Nicoya, San Antonio, Humedal Mata Redonda, 10.328094-85.42111, 8 m, 6 July 2005, B. Gamboa, J. Azofeifa, J. Gutierrez, M. Moraga, Y. Cardenas (INBio).

Reared from wild-caught caterpillars feeding on foliage of Zizyphus guatemalensis ( Rhamnaceae ):

Male: 94-SRNP-2964 Costa Rica, Area Conservacion Guanacaste, Prov. Guanacaste, Sector Santa Rosa, Estero Naranjo, 10.80426-85.68285, 2 m, 9 June 1994, Gusaneros. Male: 98-SRNP-9137 (COI barcoded), Costa Rica, Area Conservacion Guanacaste, Prov. Guanacaste, Sector Santa Rosa, Area Administrativa, 10.83764-85.61871, 295 m, 14 August 1998, Manuel Pereira. Male: 01-SRNP-17295 (COI barcoded), Costa Rica, Area Conservacion Guanacaste, Prov. Guanacaste, Sector Santa Rosa, Sendero Carbonal, 10.77594-85.65799, 7 m, 2 November 2001, Gusaneros. Male: 06-SRNP-13290 (COI barcoded), Costa Rica, Area Conservacion Guanacaste, Prov. Guanacaste, Sector Santa Rosa, Estero Naranjo, 10.80426-85.68285, 2 m, 31 May 2006, Eilyn Camacho.

Female: 92-SRNP-736 Costa Rica, Area Conservacion Guanacaste, Prov. Guanacaste, Sector Santa Rosa, Vado Nisperal, 10.80212-85.65372, 10 m, 20 May 1992, Gusaneros. Female: 96-SRNP-1331 (COI barcoded), Costa Rica, Area Conservacion Guanacaste, Prov. Guanacaste, Sector Santa Rosa, Sendero Palo Seco, 10.79342-85.6666, 5 m, 31 May 1996, Gusaneros. Female: 96-SRNP-1332 Costa Rica, Area Conservacion Guanacaste, Prov. Guanacaste, Sector Santa Rosa, Sendero Palo Seco, 10.79342-85.6666, 5 m, 2 June 1996, Gusaneros. Female: 98-SRNP-9134 (COI barcoded), Costa Rica, Area Conservacion Guanacaste, Prov. Guanacaste, Sector Santa Rosa, Area Administrativa (adult at light), 10.83764-85.61871, 295 m, 2 August 1998, Guillermo Pereira. Female: 98-SRNP-9137 Costa Rica, Area Conservacion Guanacaste, Prov. Guanacaste, Sector Santa Rosa, Area Administrativa (adult at light), 10.83764-85.61871, 295 m, 14 August 1998, Guillermo Pereira. Female: 01-SRNP-17336 (COI barcoded), Costa Rica, Area Conservacion Guanacaste, Prov. Guanacaste, Sector Santa Rosa, Sendero Carbonal, 10.77594-85.65799, 7 m, 28 October 2001, Gusaneros. Female: 01-SRNP-17336 Costa Rica, Area Conservacion Guanacaste, Prov. Guanacaste, Sector Santa Rosa, Sendero Carbonal, 10.77594-85.65799, 7 m, 28 October 2001, Gusaneros. Female: 07-SRNP-112736 (COI barcoded), Costa Rica, Area Conservacion Guanacaste, Prov. Guanacaste, Sector Santa Rosa, Sendero los Patos (adult at light), 10.82097-85.63323, 251 m, 8 December 2007, H. Cambronero & S. Rios. Female: 11-SRNP-12732 (COI Barcoded), Costa Rica, Area Conservacion Guanacaste, Prov. Guanacaste, Sector Santa Rosa, Area Administrativa (adult at light), 10.83764-85.61871, 295 m, 1 June 2011, Daniel H. Janzen

Diagnosis.

Adults - (Figs 37-40) Medium-sized notodontid moths, FW = 15.42-19.28 mm, females larger than males; male antenna narrowly bipectinate, gradually narrowing to apex, which is simple; antennae of female simple; labial palpus porrect, composed by three segments; haustellum is well developed, ocelli absent; eyes smooth, round. Thorax mostly gray, tegula gray, all scales of the thorax are long and forked; patagium and prothorax with beige and light brown scales. FW costa straight, outer margin almost straight; accessory cell present. Male genitalia - (Figs 41-43) valvae elongated, sclerotized and mildly setose; sacculus pleats highly developed; uncus thin and long, with apex acute and setose, each socius wide at the base with two thin projections, acute and setose; saccus acute (Figs 41); phallus robust, wide at the base with two single subterminal lateral bumps, vesica long but shorter than phallus, wide at the base, long and thin distally, caltrop cornuti (Fig. 42); T8 rectangular shorter than St8, lateral margins straight, anterior margin simple and membranous, posterior margin slightly concave; St8 wide at anterior margin, posterior margin with a single median depression and two sclerotized small projections (Fig. 43). Female genitalia (Figs 44, 45) - The papillae anales small, roughly ovoid with elongated dorsal setae; lateral procecess of postvaginal plate with apices acute and sclerotized; posterior apophyses short and thin; lamella postvaginalis rectangular, sclerotized; ostium sclerotized, wide, funnel shape; DB short; CB wide and long, ovoid with surface membranous slightly rough; signum brick shape with a rough surface.

Thiaucourt (2007) "The species was described in the genus Edema , cited by DRUCE (1898) in this genus, the species should be now in another genus." KIRBY (1892) lists Edema (Walker, 1855) as a junior synonym of Symmerista Hubner, [1821].

The adult lacks the apical white stripe, the male genitalia framework places the genus in the Nystaleini , but it differs from that of Symmerista (Plate II, Fig. 10). Male genitalia: uncus with acute and long apex; socci in brackets; valve costa without apical membranous area, pleats highly developed; exopenis with two single subterminal lateral bumps; beam cornuti extensions, obsolete; distal edge St 8 with a single median depression, two sclerotized thickenings near the distal edge of T8.

We propose that Symmerista tlotzin should be allocated to the genus Elymiotis Walker, 1857 for the following characteristics of the male genitalia: valvae elongated, sclerotized and setose; sacculus pleats highly developed; uncus thin and long, with apex acute and setose; socius wide at the base with two thin projections, acute and setose and caltrop cornuti.

Natural history

(Figs 46, 47, 48). 33 rearing records from Sector Santa Rosa, ACG.

Food plants.

Rhamnaceae , Zizyphus guatemalensis Hemsl. (n=33).

Parasitoids.

Eulophidae : Euplectrus (n=1).

Distribution and habitat.

Adult Elymiotis tlotzin have been collected in the dry forest ecosystem of Peninsula de Nicoya, and in the dry forests of Sector Santa Rosa and Sector Pailas of ACG, at elevations of 0 to 800 m. (Fig. 49).

Remarks.

DNA barcode female 11-SRNP-12732.

MHMYM2073-11 | 11-SRNP-12732 | Elymiotis tlotzin | COI-5P:

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCAGGATCTTTAATTGGTGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATGCCTATTATAATTGGAGGATTTGGAAATTGACTAGTTCCATTAATATTAGGAGCCCCAGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGACTACTTCCACCCTCACTAACTTTATTGATTTCAAGAAGTATTGTAGAAAATGGAGCAGGAACTGGATGAACAGTTTATCCCCCCCTTTCATCTAA 0TATTGCACATAGAGGAAGATCTGTAGATTTAGCAATTTTTTCACTTCATTTAGCTGGTATTTCATCGATTTTAGGAGCTATTAATTTTATTACAACGATTATTAATATACGACTTAATAACATAACTTTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGAATTACAGCTTTTTTATTATTATTATCTTTACCTGTTTTAGCCGGAGCGATTACTATATTATTAACAGACCGTAATTTAAATACTTCATTTTTCGACCCTGCTGGTGGAGGAGATCCAATTCTTTATCAACATTTATTT