Amauropelma krabi S. Li & Yao, 2022

Chu, Chang, Lu, Ying, Li, Shuqiang & Yao, Zhiyuan, 2022, Taxonomic notes on eleven species of the subfamily Cteninae (Araneae, Ctenidae) from Asia, Biodiversity Data Journal 10, pp. 96003-96003 : 96003

Amauropelma krabi S. Li & Yao sp. n.

Materials

Type status: Holotype. Occurrence: recordedBy: Z. Chen; individualCount: 1; sex: female; lifeStage: adult; Taxon: order: Araneae; family: Ctenidae ; genus: Amauropelma ; Location : country: Thailand; stateProvince: Krabi; verbatimLocality: Ao Luk District , Klang Cave ; verbatimElevation: 36 m a.s.l.; verbatimLatitude: 8°20.268'N; verbatimLongitude: 98°44.707'E; Event: year: 2015; month: 10; day: 12; Record Level: institutionCode: IZCAS-Ar 43530

Description

Male

Unknown.

Female (IZCAS-Ar 43530): PL 3.3, PW 2.4, AW 1.6, OL 3.1, OW 1.6. Eye diameters and interdistances: AME 0.10, ALE 0.13, PME 0.11, PLE 0.11, AME-AME 0.04, AME-ALE 0.11, PME-PME 0.06, PME-PLE 0.24, AME-PME 0.06, ALE-PLE 0.08, clypeus AME 0.12, clypeus ALE 0.17. Palp and leg measurements: palp 3.8 (1.3, 0.7, 0.8, -, 1.0), I 10.3 (2.8, 1.6, 2.8, 2.1, 1.0), II 9.2 (2.4, 1.4, 2.4, 2.0, 1.0), III 9.0 (2.4, 1.3, 2.0, 2.2, 1.1), IV 12.2 (3.1, 1.4, 2.9, 3.5, 1.3). Leg formula 4123. Spination of palp and legs: palp 130, 100, 1111, 1212; femora I p002, d111, r010, II p010, d111, r010, III p111, d111, r012, IV p002, d111, r102; patellae I-IV 001; tibiae I-II v22222, III p11, d111, r11, v222, IV p111, d11, r11, v222; metatarsi I-II v222, III p112, d010, r112, v222, IV p112, r112, v222. Chelicerae with 3 promarginal, 4 + 1 retromarginal teeth, without denticles. Retromargin of chelicerae close to fang base without bristle. Tarsi and metatarsi without scopula. Claw tufts arising separately, but intermingle with each other distally. Palpal claw with 3 secondary teeth, leg claws I-II with 3, III with 2 and IV with 3 secondary teeth. Position of tarsal organ: I 0.76, II 0.72, III 0.68.

Copulatory organ (Fig. 2 a, b, Fig. 3 a and b). Epigynal plate width/length: 9.8/6.5; anterior width/posterior width: 9.8/7.5; heart-shaped and with a mating plug, the anterior part with a pair of pointed apophyses ventrally. Lateral teeth pointing postero-medially. Internal duct system with small oval spermathecae not fully visible, separated from each other by more than their diameter; fertilisation ducts elongate and laminar, pointing postero-medially.

Colour (Fig. 2 c and d). Reddish-brown to yellowish without patterns. Dorsal prosoma slightly reddish-brown to yellowish, with eyes marked with black rings, fovea distinct, reddish-brown. Chelicerae reddish-brown. Sternum, ventral coxae, labium yellowish-brown without patterns. Gnathocoxae yellowish-brown with lighter distal lips. Legs yellowish-brown. Opisthosoma yellowish. Spinnerets yellowish.

Diagnosis

Small Ctenidae (total length female 6.4). The new species can be distinguished from all known congeners by the median plate roughly heart-shaped and with a mating plug (Fig. 2 a and Fig. 3 a), by the anterior part of median plate with a pair of pointed apophyses ventrally (arrowed in Fig. 2 a, arrowed in Fig. 3 a), by the internal duct system with small oval spermathecae not fully visible (Fig. 2 b and Fig. 3 b) and by the fertilisation ducts which are elongate and laminar, almost twice as long as the spermathecae (Fig. 2 b and Fig. 3 b).

Etymology

The specific name refers to the type locality and is a noun in apposition.

Distribution

Thailand (Krabi, type locality; Fig. 1 ).

DNA Barcode

Female (IZCAS-Ar 43530):

TGTTTGGAGCTTGAGCTGCTATAGCAGGAACTGGAATAAGAGTGTTGATTCGAATAGAGTTAGGTCATCCTGGTAGATTGTTAGGAGATGATCATTTATATAATGTTATTGTAACTGCTCATGCTTTTGTAATGATTTTTTTTATAGTAATACCAATTTTGATTGGTGGATTTGGAAATTGATTAGTTCCGTTGAGATTGGAGCACCTGATATATCATTTCCTCGAATAAATAATTTGTCGTTTTGATTACTACCTCCTTCTTTATTTTTATTAATAATATCATCAATAGTAGAAATAGGTGTTGGAGCGGGATGAACTGTTTATCCTCCTTTAGCATCTAGTATTGGGCATATAGGAAGATCTATAGATTTTGCTATTTTTTCTCTTCATTTGGCTGGAGCTTCTTCTATTATAGGAGCAGTAAATTTTATTTCTACTATTATTAATATACGGTTGTATGGAATGAGTATAGAAAAGGTTCCTTTGTTTGTGTGGTCTGTTTTTATTACTGCTATTTTGTTATTATTGTCGTTACCTGTGTTAGCAGGTGCTATTACTATATTATTGACTGATCGAAATTTTAATACTTCTTTTTTTGACCCTGCGGGAGGGGGAGATCCTATTTTGTTTCAACATTTATTTTGATTTTTTG (GenBank accession number OP561682).

Figures

Figure 1. Distribution records of ctenid spiders from Asia in this study. 1. Amauropelma krabi sp. n.; 2. Am. phangnga sp. n.; 3. Am. saraburi sp. n.; 4. Anahita medog sp. n.; 5. An. popa; 6. Bowie fascination; 7. B. ninhbinh sp. n.; 8. B. vinhphuc sp. n.; 9. B. borneo sp. n.; 10. B. engkilili sp. n.; 11. B. sabah sp. n.

Figure 2. Amauropelma krabi sp. n., holotype female. a: Epigyne, ventral view, arrow points at pointed apophysis; b: Vulva, dorsal view; c: Habitus, dorsal view; d: Habitus, ventral view. FD = fertilisation duct, IF = internal fold, LT = lateral teeth, SP = spermathecae. Scale bars: 0.2 mm (a, b), 1.0 mm (c, d).

Figure 3. Amauropelma krabi sp. n., holotype female. a: Epigyne, ventral view, arrow points at pointed apophysis; b: Vulva, dorsal view. FD = fertilisation duct, IF = internal fold, LT = lateral teeth, SP = spermathecae. Scale bars: 0.2 mm (a, b).