Cossus romantsovi Yakovlev & Shapoval, 2019

Yakovlev, Roman V., Shapoval, Nazar A., Kuftina, Galina N., Gagarina, Anastasia V. & Gorodilova, Elizaveta Yu., 2019, A DNA-based description of a new carpenter moth species (Lepidoptera: Cossidae) from Morocco, Zootaxa 4711 (2), pp. 393-400 : 396

Cossus romantsovi Yakovlev & Shapoval , sp. n.

Holotype ( Fig. 2a ), male, South Morocco, Ouarzazate province, vicinity of Tagounite , 30°01’21.3”N, 05°32’09.3”W, 30.03.2011, P. Romantsov leg., deposited in the Zoological Institute of the Russian Academy of Science (Russia, St. Petersburg); field code YC066; GenBank accession number for mitochondrial cytochrome c oxidase subunit I (COI) gene MK440661 .

COI barcode sequence of the holotype (658 base pairs):

AACATTATATTTTATTTTTGGAATCTGATCTGGAATAGTTGGAACTTCGTTAAGACTTTTAATTC- GAGCTGAATTAGGAAACCCAGGATCTTTAATTGGGAATGATCAAATTTATAACACTATTGTAACAGCT- CATGCATTTATTATAATTTTCTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAG TTCCTTTAATATTAGGGGCTCCTGATATAGCCTTCCCTCGAATAAATAATATAAGATTCTGATTACTCCC- GCCATCTCTAGCCCTTTTAATTTCCAGAAGTATTGTCGAAAATGGAGCTGGAACAGGATGAACT- GTTTATCCTCCTCTATCATCAAATATCGCCCACGGAGGAAGTTCAGTTGATTTAGCAATTTTTTCA CTTCACCTAGCTGGTATTTCCTCAATTTTAGGGGCAATTAATTTTATTACAACCATTATTAACATAC- GACCCAACAATATATCATTTGATCAAATACCTTTATTTGTATGAGCCGTAGGAATTACTGCACTATTAT- TATTACTTTCCCTACCAGTTTTAGCTGGAGCAATTACTATATTATTAACAGATCGAAATCTAAATACAT- CATTTTTCGACCCTGCGGGAGGAGGAGATCCTATTCTTTATCAACATTTATTT

Paratypes. 1 male, Morocco, High Atlas , Tizi-n-Test pass, 2100 m, 27.07.1988, leg. G. Behounek, deposited in the Museum Witt ( Germany, München); field code YC470; GenBank accession number for mitochondrial cytochrome c oxidase subunit I (COI) gene is MK 440664 . 2 males, Morocco, High Atlas , Ourika, Agaiouar forest, 1100‒1600 m, 1‒ 10.07.2012, leg. G. Müller, E. Revay et al., deposited in the Museum Witt ( Germany, München); field codes YC468, YC469; GenBank accession numbers for mitochondrial cytochrome c oxidase subunit I (COI) gene MK 440662 and MK 440663 .

Diagnosis. Cossus romantsovi ( Fig. 2a ) is phenotypically similar to the allopatric C. cossus , but the ground colour of the upper side of fore- and hindwings is light, sand grey in the new species compared to the dark grey of the nominotypical C. cossus ( Fig. 2a ) and C. cossus albescens ( Fig. 2c ). The new species can be easily distinguished from C. cossus by the structure of the male genitalia ( Fig. 3 ): processes of the transtilla short and nearly straight, and valva rather narrow. In C. cossus the transtilla is noticeably longer, curved in the middle third, and the valva is considerably broader. Genetically, the new species differs from most closely related C. cossus by at least 23 fixed nucleotide substitutions (p-distance is 3.5%) within the 658 bp fragment of the mitochondrial COI gene ( Fig. 4 ).

Description. Male. Wingspan 69 mm. Antenna greyish-brown, bipectinate along length, processes of pecten 1.7‒2.0 times diameter of flagellomere. Thorax and abdomen densely covered with dark grey hairs, patagium light grey, tegula dark grey. Forewing with a rounded apex, sand grey with a specific for the genus wavy pattern (thin transverse lines over entire wing) and thin transverse band in submarginal and postdiscal areas (from costal edge to cubital zone). Hindwing with a rounded apex, sand grey with a broad dark grey field in basal zone, and with a reticulate pattern consisting of thin transverse lines in discal and postdiscal areas. Fringe of fore- and hindwing monochrome grey. Genitalia with uncus wide, triangular with a strongly sclerotized apex and small hook, tegumen large, trapezoidal. Gnathos medium-sized, covered with small spinules, gnathos arms thick, long. Valva strongly sclerotized, with a well-developed binary crest on costal margin near apex, valva apex membranous, triangular, arms of transtilla thick, apically pointed, narrow. Juxta strongly sclerotized, with triangular excision on dorsal surface and two lateral processes directed oppositely and dorsally. Saccus large, semicircular. Phallus thick, shorter than the valva, slightly curved, with slantingly cut apex. Opening of the vesica dorso-apical, about ½ length of phallus. Vesica without cornuti.

Etymology. The new taxon is named after the entomologist Pavel Romantsov ( Russia, Saint-Petersburg), who provided the holotype for the study.

Figures

FIGURE 2. Wing pattern of males of Cossus species. A. Cossus romantsovi sp.n., from Morocco, holotype. B. Cossus cossus from Lithuania. C. Cossus cossus albescens from Spain.

FIGURE 3. Male genitalia of Cossus species. A. Cossus romantsovi from Morocco. B. Cossus cossus from Lithuania. Scale Bar = 2 mm.

FIGURE 4. Haplotype network of representatives of the genus Cossus. CS_01-CS_19 are COI haplotypes. Every mutation (nucleotide substitution) is shown as 1-step edge. Cossus romantsovi, Cossus cossus, and Cossus afghanistanus haplotypes are highlighted in orange, blue, and green, respectively.