First record of the genus Venanus (Hymenoptera: Braconidae: Microgastrinae) in Mesoamerica, with the description of two new species from Costa Rica Fernandez-Triana, Jose L Whitfield, James B Smith, M. Alex Hallwachs, Winnie Janzen, Daniel H. Biodiversity Data Journal 2014 2 4167 4167 urn:lsid:zoobank.org:act:874E5AA8-587B-4FA4-835C-B5A3523FB554 Fernandez-Triana & Whitfield Insecta Braconidae Venanus GBIF Animalia Venanus randallgarciai Hymenoptera 0 4167 Arthropoda species randallgarciai  Materials  Type status: Holotype. Occurrence: catalogNumber: CNCHYM 07223; recordedBy: J. Helava; individualID: CNCHYM 07223; individualCount: 1; sex: female; lifeStage: adult; Taxon: scientificName: Venanusrandallgarciai; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: randallgarciai; scientificNameAuthorship: Fernandez-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Alajuela; locality: 500 m North of Colonia Virgen del Socorro, Area de Conservacion Cordillera Volcanica Central; verbatimElevation: 1400 m; verbatimLatitude: 10° 17' N; verbatimLongitude: 84° 10' W; verbatimCoordinateSystem: Degree, minutes; Identification: dateIdentified: 2014; Event: verbatimEventDate: 30-v-1973; Record Level: language: en; collectionCode: Insects; ownerInstitutionCode: CNC; basisOfRecord: PreservedSpecimen  Description Female. Body length: 2.2 mm. Fore wing length: 2.2 mm. Flagellomere 2 length/width: 0.11 mm/0.06 mm. Flagellomere 14: missing. Oculo-ocellar distance: 0.15 mm. Distance between posterior ocelli: 0.08 mm. Diameter of posterior ocellus: 0.05 mm. Metafemur length/width: 0.53 mm/0.18 mm. Metatibia length: 0.66 mm. Mediotergite 1 length/maximum width/minimum width: 0.30/0.15/0.09 mm. Mediotergite 2 length/width at posterior margin: 0.12/0.10 mm. Figs 3, 4. Male. Unknown.  Diagnosis The mediotergite 1 is relatively long and with a slight constriction near anterior end (Fig. 4). That character is also shared with other three species of Venanus. However, V. johnnyrosalesican be separated from V. helavaiby its much smaller size (2.2 mm vs 2.8-3.0 mm) and less sculptured propodeum, from V. yanayacuensisby its wider discal cell in fore wing (1.0 xvs 1.2 xas wide as high), metasoma color (brown vs black) and fore wing vein 2RS significanly longer than vein r (shorter than r in yanayacuensis), and from V. johnnyrosalesiby proportion of veins 2RS and r (2.0 xvs 1.4 x), sculpture of metapleuron and mediotergite 2, and narrower mediotergite 1 (narrowest width 0.6 xwidth at posterior margin vs 0.8 xin johnnyrosalesi).  Etymology  Venanus randallgarciaiis named in honor of Sr. Randall Garcia, currently of San Jose, Costa Rica, but also the first director of ACG and the current Executive Director of the Instituto Nacional de Biodiversidad (INBio), and therefore a major facilitator of ACG biodiversity inventory.  Distribution Only known from a single locality in Area de ConservacionCordillera Volcanica Central, Alajuela, Costa Rica.  Notes We obtained a partial sequence (164 bp) of the DNA barcoding region for the holotype (see also Suppl. material 1). It has the sequence accesion HYCNF533-11 in BOLD (www.boldsystems.org), and the nucleotide sequence is reproduced below: TTATACCAATTATAATTGGAGGATTTGGAAATTGATTGGTGCCATTAATATTAGGGACTCCAGATATAGCTTTCCCTCGTATAAATAATATAAGATTTTGATTACTTATTCCTTCATTAT TTATATTAATTTTAAGAAGATTCATTAATACAGGCGCAGGTACG 30-v-1973 Insects J. Helava Costa Rica 10.283334 500 m North of Colonia Virgen del Socorro, Area de Conservacion Cordillera Volcanica Central 1298 -84.166664 0 4167 CNCHYM 07223 1 1 Holotype