Arctozenus australis, Ho & Duhamel, 2019

Ho, Hsuan-Ching & Duhamel, Guy, 2019, A new species of the fish genus Arctozenus from the Kerguelen Islands, with comments on the lost teeth in adults (Aulopiformes: Paralepididae), Zootaxa 4651 (3), pp. 497-512 : 503-508

Arctozenus australis sp. nov.

New English name: Southern spotted barracudina

Figs. 1D,E , 2C,D , 3C,D , 4 , 5A,B ; Table 1

Holotype. MNHN 2000-0260 (281 mm SL), “La Curieuse” off Kerguelen Islands , “Icthyoker” cruise, International Young Gadoid Pelagic Trawl ( IYGPT), station 44, 49°58’S, 71°48’E, 350 m, 13 Feb.1998.

Paratypes. Thirteen specimens, 255–287 mm SL. MNHN 1992-1217 (1, 265), “Skif” off Kerguelen Islands , SKALP cruise, 48°39’00”S, 71°01’58.8”E, Rectangular Midwater trawl ( RMT) station 3, 600– 700 m, 28 Feb. 1988 . MNHN 1992-1218 (2, 270–280), “ Kalper”, SKALP cruise, Bottom trawl, 47°16’58.8”S, 70°46’58.8”E, 295 m, 27 Apr. 1988 . Collected with “La Curieuse” off Kerguelen Islands , “Icthyoker” cruise, IYGPT, near the type locality at same period: MNHN 2000-0254 (1, 257), station 6, 50°22’S, 72°56’E, 345 m, 6 Feb.1998 . 2000-0255 (1, 274), station 135, 48°36’S, 71°10’E, 378 m, 5 Mar.1998. 2000-0256 (1, 255), station 133, 48°35’S, 71°16’E, 188 m, 5 Mar.1998. 2000-0257 (1, 287), station 28, 50°17’S, 73°59’E, 265 m, 12 Feb.1998. 2000-0258 (1, 261), station 28, 50°17’S, 73°59’E, 265 m, 12 Feb.1998. 2000-0259 (1, 272), station 84, 49°12’S, 71°21’E, 205 m, 25 Feb.1998. 2000-0261 (1, 270), station 127, 49°02’S, 71°03’E, 420 m, 1 Mar.1998. 2000-0262 (1, 258), station 28, 50°17’S, 73°59’E, 265 m, 12 Feb.1998. 2000-4962 (1, 275), station 452, 48°20’S, 71°55’E, 160 m, 1 Apr.1999. 2000-4969 (1, 291) station 508, 49°32’S, 71°03’E, 350 m, 20 Apr.1999.

Non-types. Four specimens, 245–270 mm SL. MNHN 1981-1251 (1, 245), “Vzmorie” 50°00’S, 70°49’58.8”E, Commercial bottom trawl, 250–300 m, 5 Dec. 1980. MNHN 1999-1219 (2, 268–270) , “La Curieuse” off Kerguelen Islands , “Ipeker” cruise, IYGPT , station 32, 49°10’ 58.8”S, 71°16’58.8”E, 350 m, 4 Mar. 1995. MNHN 2004-1110 (1, damaged) , same cruise as previous lot, station F3, 47°06’S, 74°37’E, 160 m, 17 Apr. 2000. MNHN 2011-0452 (broken, posterior part cut off for genetic analysis) , “Poket 2” cruise, station 3, 46°24’14.4”S, 67°33’43.2”E, off Kerguelen Islands , 791–792 m, 28 Aug. 2010; genetic voucher, field number POKER9202 , BIN number BOLD: ABW7005 .

Diagnosis. A species of Arctozenus differing from the only congener in having a pale body with lower half mostly devoid of chromatophores; body slender, its depth 14–19 in SL; a slender head, its depth at middle of eye 4.3–5.1 in HL. Compared to similar size specimens (> 250 mm SL) of A. risso , A. australis has relatively slender body (5.2–7.3%, vs. 7.7–10.6% SL); the ratio of snout length/eye diameter relatively large 3.1–3.9 (vs. 2.7–3.4); origin of pelvic fin slightly but clearly behind dorsal-fin base (vs. usually below dorsal-fin base); and anterior lateral-line scales long, about twice as long as its height (vs. width subequal to the height).

Description. Following data are presented for holotype with paratypes in parentheses, except where otherwise indicated. Meristic values in square brackets are for all specimens, including 3 non-types when available; values were taken from both sides when paired.

Dorsal-fin rays 9 [9(13), 10(1)]; pectoral-fin rays 12 [11(3), 12(22), 13(3)]; pelvic-fin rays 9; anal-fin rays 30 [30(5), 31(8), 32(2)]. Vertebrae: prehaemal 39 [38(5), 39(6), 40(4)]; caudal 43 [41(1), 42(5), 43(5), 44(3), 45(1)]; predorsal 37 [36(3), 37(7), 38(6)]; prepelvic 41 [39(1), 40(5), 41(7), 42(2)]; preanal 53 [50(3), 52(8), 53(4), 54(1)]; and total 82 [79(1), 80(1), 81 (2), 82(8), 83(2), 84(1)]. Lateral-line scales: predorsal 36 [35(1), 36(8), 37(11), 38(16)]; prepelvic 40 [40(13), 41(8), 42(7)]; preanal 52 [51(6), 52(9), 53(10), 54(1)]; total 63 [62(3), 63(9), 64(5), 65(7), 66(4)]. Gill rakers 9 (7–10) on upper limb (epibranchial) and 35 (26–35) on lower limb, 13 (10–13) on ceratobranchial and 22 (16–22) on hypobranchial.

Body elongate, strongly compressed, depth at deepest area 14–19 times in SL. Caudal-peduncle length subequal to eye diameter. Posterior half of abdomen with slightly developed flap. No ventral adipose fin, but a low fleshy ridge behind the pelvic fin.

Head slender, pointed, triangular in lateral view ( Fig. 2C ), its length 4.4 (4.2–4.6) times in SL, its depth slightly less than the depth of trunk. Mouth terminal, slender, its gape extends to slightly more than one eye diameter in front of the eye; lower jaw not upturned at tip, tip bearing a black non-ossified tissue. Eye relatively small, its diameter 6.9 (6.4–7.3) in HL. First bone well-expended anteriorly, second long, about twice of the third, third to fifth stout, the sixth well-expanded dorsally. Interorbital space narrow, slightly concave, its width 11.3 (10.6–11.9) in HL. Two ridges on each side of interorbital space, inner one extends to tip of snout. Premaxilla rectangular, closely attached to maxilla; maxilla extends to about one eye diameter in front of the eye. Two nostrils closed together, both above tip of maxilla or slightly behind it. Opercle with low ridges under the skin forming radiated pattern, the posterior margin slightly indented. Tongue surrounded by narrow fleshy membrane.

DFO at about posterior third of standard length, pre-dorsal length 1.5 in SL. Pectoral fin above the ventral margin, about lower level of gill cover, its uppermost ray at about same level of lower margin of eye. VFO slightly but clearly behind dorsal-fin base ( Fig. 2D ), pre-pelvic length 1.4 in SL. AFO at posterior fifth of body, pre-anal fin length 1.2 in SL. Anal-fin base short, 6.7 (6.3–7.6) in SL. Dorsal adipose fin above rear end of anal-fin base, about 1.5 its base length before caudal-fin base, its base length less than eye diameter.

Two or three small fangs anterior upper jaw, followed by a close set row of tiny blade-like teeth along maxilla. Vomerine teeth absent. Two rows of fangs on anterior palatines, in 7 or 8 widely-spaced pairs, those in outer row fixed and much smaller than those in inner row, those in inner row which are depressible, the second and third especially enlarged, followed by single row of smaller fangs. Two or three small fangs at anterior lower jaw, followed by a short row of small teeth, then two rows of fangs, in 7–9 widely-spaced pairs, those in outer row fixed and much smaller than those in inner row which are depressible. About 2 irregular rows of small teeth on each side of outer portions of tongue.

Gill rakers as described in Post (1987, figs. 1c, d), present along most gill arches, shield-shaped, each bearing three or four rows of small teeth, those in inner row longest. Pharyngeal teeth from short, slender, forming two long patches, anterior patch long, triangular with two irregular rows, posterior patch oval with up to 6 rows. Few scattered teeth on fifth ceratobranchial, in one row anteriorly, more irregular posteriorly. Gill filaments present on first to fourth arches, absent in fifth. Anterior half of fifth gill arch connected to forth arch by membrane. Pseudobranch present, as a shallow chamber above first gill arch.

Body completely scaled, mostly lost, leaving distinct pockets. Lateral-line scales originating from above pectoral girdle and running along upper portion of flank to above about middle of anal-fin. Anterior lateral-line scales slightly more than twice length of height, gradually becoming smaller and narrower posteriorly, but not to the degree as Lestrolepinae; one large pore at each corner of posterior margin of scales; pair of smaller pores between or slightly in front of the lager pores; pair of small pores at middle of each scale; one (sometimes 0 or 2) small median pore at front of each scale. Luminous organs absent.

Coloration ( Figs. 1D,E , 3C,D ). Fresh color silvery white. Most specimens with scales entirely lost; musculature milky white; slightly grayish dorsally and paler ventrally. Operculum black; snout and jaws irregularly blackish. Preserved specimens loosely covered by chromatophores and some much larger dots on upper half of body under the microscope; ventral half of body devoid of chromatophores, except for some scattered dots along the abdominal ridge. Dorsal surface of head and snout blackish; tips of jaws black. Gill chamber irregularly blackish; oral cavity mostly pale, blackish posteriorly. Peritoneum black. All fins hyaline, except for several upper rays of pectoral fin with pigment along inner surface.

Size. The largest specimen examined is 291 mm SL; reaching 316 mm SL around the Kerguelen area ( Duhamel et al., 2005).

Etymology. The specific name australis is Latin for “southern”, in reference to the distribution of the present species which appears restricted to the Southern Ocean.

Distribution. Currently described from the Kerguelen Islands (Kerguelen Plateau) ( Fig. 4 ), Indian sector of the Southern Ocean, but probably occurring in other parts the Southern Ocean (see Remarks). A thermal range for the species would be cool-temperate waters to south polar seas close to the Polar front. Specimens have been collected mainly offshore (over depths> 500 m) by pelagic gear in the upper mesopelagic layer (160–420 m) at night, sug- gesting diel vertical migration from deeper water. Some were by-catch of bottom trawl on the slope of the Kerguelen Plateau (480–800 m) ( Duhamel & Hulley, 1993, Duhamel et al., 2005) and South-Georgia ( Gregory et al., 2017).

COI DNA sequence. The following sequence was registered to Barcode of Life Data System ( BOLD; bin number: BOLD:ABW7005) (http://www.boldsystems.org/). CCTCTACCTGTTATTTGGTGCTTGGGCCGGAA TAGTGGGCACAGCGTTAAGCCTACTTATTCGGGCAGAACTAAGCCAGCCCGGAGCCCTATTGGGTGAC GACCAAATTTATAATGTAATCGTAACAGCCCACGCTTTCGTAATAATTTTCTTTATAGTTATACCTGTTAT GATTGGCGGTTTTGGAAATTGACTCATTCCCCTAATGATCGGGGCCCCCGACATAGCCTTCCCCCGAAT AAATAATATGAGCTTCTGACTTCTACCTCCATCTTTCCTCCTTCTCCTAGCTTCCTCTGCAGTAGAAGCC GGAGCCGGCACAGGGTGAACAGTGTATCCCCCTCTTGCCAGCAACTTAGCTCACGCTGGAGCCTCCG TTGACCTGACTATTTTTTCCCTTCACTTAGCAGGGATCTCCTCTATTTTAGGTGCTATTAATTTCATCACA ACTATTGTTAACATAAAACCACCTGCGATTACCCAATACCAGACTCCCTTATTCGTATGAGCGGTACTAA TCACCGCTGTACTTCTTTTACTTTCCCTCCCTGTCTTAGCAGCCGGAATTACGATACTTCTTACGGATCG GAATTTAAATACCAC

Comparisons. The species is very similar to the widespread Arctozenus risso in body proportions and meristics. Post (1987) provided the evidence that vertebral numbers change with latitude, and the body shape changed with the spawning stage. Our specimens agreed well with the data from southern Atlantic Ocean (30°S south). However, by examining the specimens closely, we found compared to the similar size of A. risso , our specimens have a paler body ( Fig. 2 ), more slender body, and longer head, snout and jaws ( Table 1 ; Fig. 5 )

Specimens of A. australis examined were 255–291 mm SL, whereas A. risso were 191–280 mm SL in present study. Accordingly, the data set of the later is divided into two groups at 250 mm SL in order to compare the similar size of both species. Post (1987) provided data separated in two groups at ca. 140 mm SL for the Atlantic populations from 30°S south and 30°N north, respectively. The specimens greater than 140 mm SL in these two geographic regions showed similar body proportions.

Although all specimens have lost scales in the trawl, their skins are complete and scale pockets are detectable. There are scattered chromatophores on upper half of body above the lateral line and almost entirely devoid of chromatophores on lower half of body in all individuals in A. australis ( Figs. 3C, D ). In contract, A. risso has entire body densely covered by chromatophores ( Figs. 3A, B ); while in smaller specimens, or individuals with most scales lost, the body will appear paler, there are always numerous melanophores around scale pockets visible under magnification.

In all individuals of A. australis examined by us, the VFO is slightly, but clearly, behind the dorsal-fin base; whereas the VFO is always below the posterior half of dorsal-fin base in A. risso (see Fig. 2D vs 2B).

The body is relatively slender in A. australis than in A. risso ( Table 1 , Fig. 5A ). In specimens of A. risso <250 mm SL, the body is relatively slender (body depth 6.3–7.7% SL), becoming distinctly deeper (7.7–10.6% SL) when> 250 mm SL. In all specimens of A. australis , the body depth is clearly narrower (5.2–7.3% SL) than that of A. risso with body size> 250 mm SL ( Fig. 5A ).

The head length is relatively slender in lateral view in A. australis , whereas that of A. risso is relatively deep posteriorly ( Fig. 2C vs. Fig. 2A ). The proportion of head length (21.6–23.8% SL) overlaps with that of A. risso <250 mm SL (20.6–22.9% SL), however, only slightly in specimens> 250 mm SL (20.0–21.7% SL). All specimens of A. australis have a longer head (> 58.4 mm) than those specimens of A. risso > 250 mm SL (51.8–56.2 mm).

The head depth at middle of eye can separate the two species in all stages; 4.4–5.2% SL or 19.6–23.4% HL in A. australis and 5.1–5.8% SL or 24.8–27.2% HL in A. risso > 250 mm SL and 5.3–6.3% SL or 24.5–28.9% HL <250 mm SL. The ratio of head length/head depth is clearly larger in A. australis (4.3–5.1), compared to that of A. risso (3.5–4.1 overall) ( Fig. 5B ).

The bony interorbital width is slightly narrower in A. australis (1.9–2.1% SL), compared to that of A. risso (2.1–2.5% SL). Both upper and lower jaw are slightly longer in A. australis (upper jaw 8.9–9.7% SL and lower jaw 12.7–13.7% SL), compare to that of A. risso (upper jaw 8.2–9.2% SL and lower jaw 11.7–12.9% SL).

The eye is generally smaller in A. australis (13.7–15.5% HL) reflected by the relatively slender head, whereas that is relatively large in A. risso (15.2–18.5% HL), reflected by the relatively short head ( Figs. 2A vs. 2C).

Genetics. The COI sequence of A. australis (603 bp) was compared with 5 sequences of A. risso from several localities in Atlantic Ocean uploading to the BOLD, including GLF165-14 ( Greenland), SCFAC 825-06 ( Canada), NBMF 015-15 ( Norway), MAECO 010-06 (Atlantic Ocean), and ARC 28243 ( Canada). There were a total of 584 positions analyzed in the final dataset. The K2P distances among A. australis and the five A. risso are 0.048 –0.052, whereas the K2P distances among 5 A. risso are 0.000 –0.007. Fig. 6 shows the neighbour-joining (NJ) phylogenetic tree of the K2P distances among the six sequences analyzed. The five sequences of A. risso forming a monophyletic group, whereas A. australis is clearly separated from them. The result supports the establishment of the new species in present study.

Remarks. All specimens examined were collected from off Kerguelen Islands over a 20-year period (1980– 2000). However, it cannot be excluded that some records from the South Atlantic Ocean (or Southern Ocean) might be the same species. Although Post (1987) provided data from 30°S south in South Atlantic Ocean, his specimens have body depth 8.0–11.5% SL so are not likely to be A. australis . Post (1990) provided data of the specimens (collected at 40°S south) with body depth 5.9–7.7% SL, which is not consistent with the values provided by Post (1987). We were unable to locate his material, so were not able to verify the measurements, but his specimens may not be A. australis .

Stewart (2015) reported two distinct populations of A. risso in the Northern and Southern Hemispheres, however, no analysis was provided. The photo provided in Stewart (2015: fig. 82.1) shows the VFO is clearly under dorsal-fin base and thus most likely a A. risso , not A. australis . Kenchington et al. (2017) provided the result of DNA barcoding from Northern Hemisphere Arctozenus , which distinguished basin-scaled cryptic species in Atlantic and Pacific Oceans. Accordingly, the genus needs further investigation.

Figures

FIGURE 1. A–C. Arctozenus risso (Bonaparte, 1840).A. Original drawing which Paralepis risso Bonaparte, 1840, reproduced from Cuvier in Cuvier & Valenciennes, 1829: pl. fig. 66). B. Neotype of Paralepis risso Bonaparte, 1840, MNHN 2018-0246. C. MNHN uncat. (tissue no. BPS-1960), 199 mm SL, photo by Samuel Iglésias. D–E. Arctozenus australis sp. nov. D. Holotype, MNHN 2000-0260. E. Fresh condition, one of paratypes.

FIGURE 2. Comparison of head and relative position of DFO and VFO of A. risso and A. australis. A-B. Neotype of A. risso. C. Paratype of A. australis, MNHN 1992-1218. D. Holotype of A. australis. Bars indicate end of dorsal-fin base (upper) and origin of pelvic fin (below).

FIGURE 3. Microscopy photographs of anterior trunk region (A, C) and close-up of above lateral line at same region (B, D). A–B. Neotype of A. risso. C–D. Holotype of A. australis. Both with complete skin, but most scales lost.

FIGURE 4. Distribution map of Arctozenus australis, including specimens from other cruises.

FIGURE 5. Comparison between two Arctozenus species.A. Body depth versus standard length; upper plots are original values (mm) and lower plots are % SL of specimens. B. Ratio of snout length/eye diameter versus standard length.

FIGURE 6. Neighbour-joining (NJ) phylogenetic tree of the K2P distances among A. risso (5 sequences) and A. australis (1 sequence).