Chalarus gynocephalus Jervis, 1992
publication ID |
https://doi.org/ 10.5281/zenodo.184950 |
DOI |
https://doi.org/10.5281/zenodo.5622216 |
persistent identifier |
https://treatment.plazi.org/id/367D87D6-FFD7-8D62-FF78-FC32FDD4E028 |
treatment provided by |
Plazi |
scientific name |
Chalarus gynocephalus Jervis, 1992 |
status |
|
Chalarus gynocephalus Jervis, 1992 View in CoL
Chalarus gynocephalus Jervis, 1992: 274 View in CoL .
Diagnosis: Male with broad frons, at its narrowest point ~3–3.5 times frontal ommatidial facets, and with 3–6 pairs of fronto-orbital setae (J92 Fig. 5 View FIGURES 1 – 6 C–D); genitalia (as in Fig. 1 View FIGURES 1 – 6 ) with phs gently curved; tdp short and pointed, Lmtdp:Ltdp~2.0; php absent; all ejaculatory ducts placed distally on mtdp; ejaculatory apodeme parasol-shaped (as in Fig. 18 View FIGURES 12 – 23 ). Female unknown. See Table 1 for coxI and ITS2 barcode sequence accession numbers.
Annotations: The taxon can be readily identified by means of the fronto-orbital setae on their frons. Inner genitalia are conspecific with C. fimbriatus and C. pughi . It is likely that it will be found to be the missing partner of C. basalis as they share the same ITS2 genotype together with CK21 and CK64 (these two males lack any fronto-orbital setae and are treated as C. fimbriatus agg. here) ( Table 2 View TABLE 2 ). No host records available.
Chalarus gynocephalus seems to be widespread in the Palaearctic as one male was studied from South Korea: 1ɗ, Republic of South Korea, Ch’ungch’ongnam-Do Province, Kumsan-Gun, Kumsan, Posoksa, 4.– 13.VI.1995, Tripotin (MNHN).
TABLE 2. Excerpt from the genotype table of ITS 2 of the C. basalis assemblage.
C. | pughi F CK24 | TATATATATTTTATATATGTAACTTT | … | ACCTTAAACT--AATAATGTA |
---|---|---|---|---|
C. | pughi F CK47 | ·························· | … | ··········--········· |
C. | pughi F CK100 | ·························· | … | ··········--········· |
C. | pughi M CK98 | ·························· | … | ··········--········· |
C. | fimbriatus F CK22 | ··········A··············· | … | ··········AT········· |
C. | fimbriatus F CK41 | ··········A··············· | … | ··········AT········· |
C. | fimbriatus FormC M CK63 | ··········A··············· | … | ··········AT········· |
C. | basalis F CK99 | ··········AC·············· | … | ··········AT········· |
C. | gynocephalus M CK23 | ··········AC·············· | … | ··········AT········· |
C. | fimbriatus agg. M CK64 | ··········AC·············· | … | ··········AT········· |
C. | fimbriatus agg. M CK21 | ··········AC·············· | … | ··········AT········· |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Kingdom |
|
Phylum |
|
Class |
|
Order |
|
Family |
|
Genus |
Chalarus gynocephalus Jervis, 1992
Kehlmaier, Christian & Assmann, Thorsten 2008 |
Chalarus gynocephalus
Jervis 1992: 274 |