Staphylus (Vulga) vula Grishin, 2023

Zhang, Jing, Cong, Qian & Grishin, Nick V., 2023, Supplementary Materials and Appendix, Insecta Mundi 2023 (26), pp. 1-115 : 33-34

Staphylus (Vulga) vula Grishin , new species

https://zoobank.org/ 1E5D2A3B-D751-4144-A814-9F916BD25F36

( Fig. 3 part, 75–76, 293–294)

Definition and diagnosis. Phylogenetic analysis that included syntypes of Staphylus vulgata (Möschler, 1879) (type locality in Colombia) reveals that Mexican specimens identified as this species are strongly differentiated genetically from and are not even monophyletic with it ( Fig. 3), e.g., their COI barcodes differ by 5.9% (39 bp), and therefore represent a new species. This new species keys to S. vulgata (E.32.6(a)) in Evans (1953) and differs from its relatives by the following combination of characters: costa of valva less convex, valva narrower in lateral view, expansion of ampulla directed distad and reaches about the middle of harpe, its terminal spines shorter, harpe semi-triangular, distally rounded, with slightly concave dorsoposterior margin ( Fig. 293–294). Due to the cryptic nature of this species, most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1146.51.1:T1173C, aly536.133.3:T30C, aly 1244.6.1:C819T, aly 2811.1.8:T52C, aly 2811.1.8:C53A, and COI barcode: T50C, T118C, T205C, T463C, T479C.

Barcode sequence of the holotype. Sample NVG-18058B09, GenBank OR837656, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCTCTAAGTATTCTTATTCGATCAGAATTAGGAACCCCTGGATCTTTAATT GGAGATGATCAAATTTATAACACTATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATT GACTTGTACCCCTTATATTAGGAGCTCCTGATATAGCTTTTCCTCGAATAAATAATATAAGTTTTTGATTATTACCCCCATCCTTAATACTTCTAAT TTCAAGTAGCATTGTAGAAAATGGAGCAGGAACTGGATGAACTGTATATCCCCCACTTTCAGCCAATATTGCCCATCAAGGTTCATCTGTAGATTTA GCTATTTTTTCCCTTCATTTAGCTGGAATTTCTTCCATTTTAGGAGCAATTAACTTCATCACAACTATTATTAACATACGAATTAATAATCTATCAT TTGATCAAATACCTTTATTTGTATGAGCTGTAGGAATCACAGCATTACTTTTACTCCTATCTTTACCAGTATTAGCTGGAGCTATTACTATACTTTT AACTGATCGAAATCTTAATACATCATTTTTTGATCCCGCTGGAGGAGGTGATCCTATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 75–76, bears the following five rectangular labels, four white: [7 mi N Santa | Comapan, Ver., | Mex. V-22-1979 | J. R.Powers,Collr.], [ Staphylus | vulagata ♂ | (Moeschler) | det. H. A. Freeman], [DNA sample ID: | NVG-18058B09 | c/o Nick V. Grishin], [USNMENT | {QR Code} | 01466683], and one red [HOLOTYPE ♂ | Staphylus | vula Grishin ]. Paratypes: 7♂♂ from Mexico, Roy O. Kendall and C. A. Kendall leg., at TAMU, unless stated otherwise: 1♂ NVG-20062D03 Oaxaca, Pluma Hidalgo, 18-Apr-1988, J. Kemner leg., genitalia [ TMMC]; 1♂ NVG-19014D06 Tamaulipas, Ciudad Mante, Los Arcos Ct., larval foodplant Achyranthes aspera L., 11-Jan-1975; 2♂♂ Tamaulipas, Rancho Pico de Oro, vic. Of Los Kikos: NVG-19126A03 21-Dec-1972 and 19126A05 6-Feb-1974; 1♂ NVG-19126A04 Tamaulipas, El Nacimiento, Rio Mante, 23-Jan-1974; 2♂♂ San Luis Potosi, El Naranjo: NVG-19014D03 1-Mar-1976 and NVG-19126A02 13-Feb-1976.

Type locality. Mexico: Veracruz, 7 mi north of Santa Comapan.

Etymology. The name is formed from the species epithet of S. vulgata (in Latin, vulgate means common). By significantly shortening the name, it refers to this most northern species of the S. vulgata complex. The name is a noun in apposition.

Distribution. Widely distributed in Mexico: recorded from Tamaulipas, San Luis Potosi, Veracruz and Oaxaca.

Comment. Reared on Achyranthes aspera L. by Roy O. Kendall and C. A. Kendall.