Symmerista inbioi Chacon

Chacon, Isidro A., Janzen, Daniel H. & Hallwachs, Winnie, 2014, Four new species of Symmerista Huebner, 1816 (Notodontidae, Nystaleinae) from Costa Rica, ZooKeys 421, pp. 39-63 : 45-47

Taxon classification Animalia Lepidoptera Notodontidae

Symmerista inbioi Chacon sp. n. Figs 10-16

Material examined.

21 specimens (21 males).

Type material.

Holotype male: INB0003487050 (dissected, COI barcoded), Costa Rica, Prov. Cartago, El Guarco, Reserva Forestal Rio Macho, Macizo de la Muerte, Sector La Esperanza 9.686771-83.87775, 2600 m, May 2002, R. Delgado (INBio).

Paratypes: Male: INB0003153991 Costa Rica, Prov. Cartago, El Guarco, San Isidro, Est. La Esperanza 9.687685-83.884582, 2450 m, March 2001, R. Delgado (INBio). 2 males: INB0003316531, INB0003316537 Costa Rica, Prov. Cartago, El Guarco, Macizo de la Muerte, Sector La Esperanza, 9.686771-83.87775, 2600 m, June 2001, R. Delgado (INBio). Male: INB0003320716 Costa Rica, Prov. Cartago, Parque Nacional Tapanti, El Guarco, San Isidro, Est. La Esperanza, 9.683922-83.876688, 2600 m, May 2001, R. Delgado (INBio). Male: INB0003334468 Costa Rica, Prov. Cartago, Parque Nacional Tapanti, Macizo de la Muerte, Est. La Esperanza, 9.686771-83.87775, 2600-2700 m, April 2001, R. Delgado (INBio). 3 males: INB0003339195, INB0003339197, INB0003339198 Costa Rica, Prov. Cartago, El Guarco, Parque Nacional Tapanti, Macizo de la Muerte, Est. La Esperanza 9.686771-83.87775, 2600 m, July 2001, R. Delgado (INBio). Male: INB0003387640 Costa Rica, Prov. Cartago, Reserva Forestal Rio Macho, El Guarco, Macizo de la Muerte, 9.686771-83.87775, 2600 m, October 2001, R. Delgado (INBio). Male: INB0003478225 (dissected, COI barcoded), Costa Rica, Prov. Cartago, Parque Nacional Tapanti, Macizo de La Muerte, Est. La Esperanza, 9.69397-83.854504, 2700 m, 13-14 May 2002, J. Montero (INBio). 2 males: INB0003536236 (dissected, COI barcoded), INB0003536239 (COI Barcoded) Costa Rica, Prov. Cartago, Parque Nacional Tapanti, Macizo de La Muerte, Est. La Esperanza, 9.69129-83.876832, 2600 m, September 2002, R. Delgado (INBio). Male: INB0003545219 (dissected, COI barcoded) Costa Rica, Prov. Cartago, Parque Nacional Tapanti, Macizo de La Muerte, Est. La Esperanza, 9.69129-83.876832, 2600 m, October 2002, R. Delgado (INBio). 3 males: INB0003756229, INB0003756321, INB0003756418 Costa Rica, Prov. Limon, Parque Internacional La Amistad, Valle del Silencio, Alrededor del Refugio y Sendero Circular, 9.110281-82.961934, 2450 m, 22-27 September 2003, D. Rubi, R. Gonzalez, R. Delgado(INBio). Male: INBIOCRI001359567 Costa Rica, Prov. Cartago, Quebrada Segunda, Parque Nacional Tapanti, 9.762583-83.788328, 1250 m, February 1993, G. Mora. Male: INBIOCRI002210601 Costa Rica, Prov. Cartago, La Represa, Tapanti, 9.695643-83.768399, 1800 m, July 1995, R. Delgado (INBio). Male: INBIOCRI002253344 Costa Rica, Prov. Cartago, Rio Grande de Orosi, desde Puente Rio Dos Amigos hasta la Represa, 9.695643-83.768399, 1400-1800 m, March 1995, R. Delgado (INBio). Male: INBIOCRI002423774 Costa Rica, Prov. Cartago, Rio Grande de Orosi, desde Puente Rio Dos Amigos hasta la Represa, 9.695643-83.768399, 1800 m, February 1995, R. Delgado (INBio). Male, INBIOCRI002427627 Costa Rica, Prov. Cartago, Rio Grande de Orosi, desde Puente Rio Dos Amigos hasta la Represa, 9.695643-83.768399, 1400-1800 m, 22 August– 15 September 1995, R. Delgado (INBio).

Etymology.

This species is dedicated to the Instituto Nacional de Biodiversidad (INBio) in recognition of its 25 years of support for developing an understanding of the biodiversity of Costa Rica and exporting that understanding to the nation and the world.

Diagnosis.

Symmerista inbioi differs from Symmerista luisdiegogomezi on: dorsal FW ground color light brown; from the reniform spot to the apex there is an uniform long, thin, white cream-colored band; fringe reddish brown; dorsal HW dirty beige. Male genitalia: St8 wide at base, anterior margin convex, posterior margin slightly irregular with a pair of very short projections, these sclerotized with blunt apices; valva membranous, saccular margin slightly jagged, costal margin smooth, with a distal protuberance near the apex; elongate finger-shaped process on the saccular margin at the internal base of the valve; uncus plate slightly concave, with papillae and setae on the dorsal and ventral edge; socii elongated, broad at base, narrow and flattened at the apex, with papillae and setae in the dorsal surface; length of the phallus 3.9 mm, proximal part of phallus curved at the base, slightly narrow in the middle, distal part of phallus tube sclerotized, narrow at the base, robust, irregular and wide at the end, with a tubular lateral projection with the distal nipple; proximal part of the vesica with a dorsal scobinate patch, distal part of the vesica bulbous. The genital armature of Symmerista inbioi is more robust and larger than Symmerista luisdiegogomezi .

Description.

Male (Figs 10, 11, 12-16). Head - Antenna bipectinate nine terminal flagellomeres without rami, antenal shaft cream dorsally and light brown ventrally, scape bearing a long tuft of yellow-brown scales; haustellum vestigial; eye smooth, round, black; frons dark brown; labial palpus porrect, brown; patagium light brown near midline, dark brown laterally. Thorax and abdomen - Tegula dark brown at base, a mix of cream and dark brown scales distally; mesoscutellum black; thoracic pleuron dark brown; legs dark brown with cream-colored scales between segments; abdominal dorsum light brown, venter dark brown.

Wings - Dorsal FW ground color light brown; with reniform spot black; from reniform spot to apex with a uniform, long, thin, creamy-white band; costal margin black until R1; AD black; purple scales between terminal line and the AD; fringe reddish brown; dorsal HW dirty beige, fringe light brown (Figs 10, 11) (WL 16.42-19.44 mm). Male genitalia (Figs 12-16) - T8 rectangular, wider than long, posterior margin slightly sclerotized and serrated; St8 wide at base, anterior margin convex, posterior margin slightly irregular with a pair of very short projections, these sclerotized with blunt apices (Fig. 14); valva membranous, costulate absent, saccular margin slightly jagged, costal margin smooth, with a distal protuberance near apex; elongate finger-shaped process on saccular margin at internal base of valve; tegumen narrow at point of intersection of both arms, margins heavily sclerotized (Figs 12, 13); uncus plate concave, with papillae and setae on dorsal and ventral edge; socii elongated, broad at base, narrow and flattened at apex, with papillae and setae in dorsal surface (Figs 12, 13, 15); juxta heart shaped (Fig. 13); vinculum membranous, slightly sclerotized (Fig. 12); length of phallus 3.9 mm, proximal part of phallus curved at base, slightly narrow in middle, distal part of phallus tube sclerotized, narrow at base, robust, irregular and wide at end, with a tubular lateral projection with distal nipple; proximal part of vesica with a dorsal scobinate patch, distal part of vesica bulbous (Fig. 16).

Female: unknown

Distribution and habitat.

Symmerista inbioi has been collected only at elevations betwen 1250 and 2700 m in highland cloud forests of the Cordillera de Talamanca (Talamanca Mountain Range) (Fig. 49).

Remarks.

DNA barcode of holotype male INB0003487050

MHMXP003-08 | INB0003487050 | Symmerista inbioi | COI-5P:

AACATTATATTTTATTTTTGGGATTTGAGCAGGTATAGTAGGAACTTCTTTAAGTCTATTAATTCGAGCTGAATTAGGAAACCCCGGATCACTTATTGGGGATGATCAAATTTATAATACAATTGTTACAGCCCATGCCTTTATTATAATTTTTTTTATGGTAATACCTATTATAATTGGGGGATTTGGTAATTGATTAGTCCCTCTTATACTAGGAGCCCCAGATATAGCATTCCCCCGCATAAATAATATAAGTTTTTGACTTTTGCCCCCTTCTTTAACCCTTTTAATTTCAAGAAGAATCGTAGAAAATGGAGCAGGAACTGGATGGACAGTGTACCCCCCACTATCCGCCAACATTGCCCATAGTGGAAGTTCTGTAGATTTAGCTATTTTTTCCCTTCATTTAGCTGGAATTTCCTCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGCCTCAATAATATATCTTTTGATCAAATACCTTTATTTGTTTGAGCTGTTGGAATTACAGCATTTTTACTTTTACTTTCTTTACCTGTTTTAGCGGGAGCTATTACAATACTACTAACTGACCGTAATTTAAATACATCCTTTTTTGACCCTGCTGGGGGAGGAGATCCAATTTTATACCAACATTTATTT