Catharylla chelicerata T. Leger & B. Landry
publication ID |
https://dx.doi.org/10.3897/zookeys.375.6222 |
publication LSID |
lsid:zoobank.org:pub:8BCC6418-E8CD-470A-8A1A-57CC67822F53 |
persistent identifier |
https://treatment.plazi.org/id/10B2350D-F0E5-4E09-BDE8-CE7D3F58A33F |
taxon LSID |
lsid:zoobank.org:act:10B2350D-F0E5-4E09-BDE8-CE7D3F58A33F |
treatment provided by |
|
scientific name |
Catharylla chelicerata T. Leger & B. Landry |
status |
sp. n. |
Catharylla chelicerata T. Leger & B. Landry sp. n. Figs 2, 9, 13, 14, 35, 43
Type material.
Holotype. ♂, with labels as follows: "/600/ Parcelles CIRAD de Combi, | plantations expérimentales pk 1,8 | 5°18'N, 52°55'30"W | 3.XII.2010 | B[ernard]. Hermier | [ piège lumineux]"; 1 ♂, "Hermier | n° 23939"; "MHNG | ENTO ♂ | 00007213"; "Don de Bernard | Hermier | MHNG 2013"; "HOLOTYPE | Catharylla | chelicerata | T. Léger & B. Landry" [red label]. Deposited in MHNG.
Paratypes. 20 ♂, 4 ♀. BRAZIL: 1 ♂ (genitalia on slide BL 1714), Amazonas, Rio Negro, Mirapinima, 8.iv.1972 (E. G., I. & E. A. Munroe) (CNC); 9 ♂, 1 ♀, Reserva Ducke, km 26 Manaus–Itacoatiara Highway, 15.iv.1972 (1 ♂), 18.iv.1972 (1 ♂, with genitalia on slide BL 1721), 21.iv.1972 (2 ♂, one with genitalia on slide BL 1709), 16.v.1972 (2 ♂), 17.v.1972 (2 ♂, one with genitalia on slide BL 1738), 18.v.1972 (1 ♂, 1 ♀ with genitalia on slide BL 1711) (E.G., I. and E.A. Munroe) (CNC). FRENCH GUIANA: 5 ♂, 1 ♀, 36km SE, Roura (Camp Patawa), 21.xi.2007 (1 ♂, genitalia on slide MHNG ENTO 6239), 29-30.xi.2007 (3 ♂, 1 ♀, one ♂ with wings on slide MHNG ENTO 6272, 2 ♂ used for DNA sequencing and barcoding, one with labels LEP 963, BC MTD 01703, genitalia on slide TL 1, one with labels LEP 964, BC MTD 01704, genitalia on slide TL 2, ♀ with genitalia on slide MHNG ENTO 6240), 30.xi.2007 (1 ♂) (MHNG); 1 ♀ (abdomen used for DNA sequencing LEP 1290, genitalia on slide BL 1750) with same data as holotype; 1 ♂, same data as holotype except 2.ix.2011 (Hermier n° 24755); 1 ♀, same data as holotype except /604/ and 4.iii.2011 (Hermier n° 24344); 2 ♂, Beauséjour, N[ationale] 1 pk 28.5, 4°42'30"N, 52°23'30"W, 3.vi.2011, piège lumineux (Hermier n° 24545 & 24546) (B. Hermier) (MHNG); 1 ♂, Route d’Apatou pk 25.5 spk 2+4.4, 1.x.2011, piège lumineux (B. Hermier) (Hermier n° 24956) (MHNG); 1 ♂ (genitalia on slide BL 1749), R[ou]te forestière de Saut Léodate pk 4.5, 4°55'N, 52°33'W, 31.x.1995 piège lumineux (B. Hermier) (Hermier n° 8457) (MHNG).
Other specimens. 1 ♀ (genitalia on slide GS-5949-SB), Nova Olinda, Rio Purus, v.1922 (S. M. Klages) (CMNH); 1 ♀ (genitalia on slide Pyralidae Brit. Mus. Slide N° 17693), Teffé [sic], vi.1906 (W. Hoffmanns) (BMNH).
COI barcode sequence of paratype BC MTD 01703 (654 bp): ACTTTATATTTTATCTTTGGAATTTGAGCAGGAATAATTGGAACATCCTTAAGACTACTAATTCGAGCAGAATTAGGTAATCCTGGATCTCTTATCGGGGATGACCAAATTTATAACACTATTGTTACTGCTCATGCATTTGTAATAATCTTTTTTATAGTTATACCAATTATAATTGGTGGATTTGGAAACTGATTAGTACCTTTAATGCTAGGGGCACCAGATATAGCATTCCCTCGTATAAATAATATAAGATTTTGACTTCTTCCCCCCTCTTTAACCCTATTAATTTCAAGTAGAATTGTAGAAAATGGGGCAGGAACAGGATGAACCGTTTATCCACCTTTATCATCTAATATTGCCCATGGAGGCAGATCAGTAGATCTGGCAATTTTTTCACTACATTTAGCTGGAATTTCATCAATTTTAGGGGCAATTAATTTTATTACAACAATTATTAATATACGAATTAATAATCTTTCATTTGATCAAATACCCCTATTTGTTTGATCAGTAGGTATTACAGCATTACTATTACTTCTATCTTTACCAGTATTGGCGGGAGCTATTACCATACTTCTAACTGACCGAAATCTCAATACTTCCTTTTTTGATCCAGCAGGGGGGGGAGACCCTATTTTATATCAACACCTA
Diagnosis.
From Catharylla gigantea , Catharylla chelicerata differs in having the male costal arm hook shaped, longer, and thinner than in Catharylla gigantea , and the juxta is strongly downcurved, apically conical whereas it is long, almost straight, without apical conical projection downward in Catharylla gigantea . In female genitalia the sterigma forms a strongly sclerotized symmetrical structure made of two asymmetrical bell-shaped cavities, opened anterad in Catharylla chelicerata whereas it forms a pair of shallow pockets opened posterad in Catharylla gigantea .
Description.
Male (n = 21) (Figs 2, 9): Head with ochreous to brown chaetosemata. Antenna greyish brown with light brown scales, with patch of brown scales at base. Maxillary palpus ochreous to dark brown, lightly ringed with dark brown at 2/3, white tipped. Labial palpus: 1.3-2.0 mm long; ochreous, basally white, tip of segment II light greyish-brown; white tipped. Thorax with dark brown patch at collar. Foreleg coxa white; femur white, ashen brown dorsally, tibia and tarsomeres ochreous, distally ringed with dark brown. Midleg femur white, tibia ashen brown basally, tarsomeres ochreous, brown to ashen brown on upperside, with white ringed tips. Hindleg white, tarsomere I ochreous; II–V brown on upperside, with white ringed tips. Abdomen dull white to light ochreous. Forewing length: 10.5-15.0 mm; costal band wide, brown from base to apex; median and subterminal transverse lines faded brown, sometimes completely faded; dark brown spots on apical margin forming more or less continuous line; fringes brass colored; underside white with costal margin brown; outer margin with somewhat triangular spots. Hindwing snow white, with marginal spots between veins; fringes white; underside silvery white with marginal spots pronounced.
Tympanal organs (n = 9): Transverse ridge almost straight medially. Tympanic pockets conical, extending slightly beyond transverse ridge. Tympanic bridge lightly sclerotized, dorsal base of praecinctorium sclerotized. Tympanic drums elongate, bean shaped, posteriorly reaching transverse ridge or slightly beyond.
Male genitalia (n = 9) (Figs 13, 14): Uncus straight, of about 4/5 length of tegumen arms, dorso-ventrally compressed, with setae dorsally and laterally; apex truncated, slightly rounded, tip with short projection pointing posterad, ventrally convex, sometimes with median bump. Gnathos arms joining at 1/5 of length, regularly hook shaped, forming angle of about 100° with axis of basal arms, about 1/4 longer than uncus. Tegumen arms narrow at base, enlarging progressively toward dorsum to 2 × basal width, projected dorsally with bump at connection, connecting at distal 1/6. Cucculus densely setose, slightly directed upward on distal 1/3, apically truncated; basal 2/3 of costa of valva dorso-ventrally and laterally widened; costal arm hook-shaped, strongly sclerotized, directed upward at about 45° from costal arm base. Juxta triangular, curved downward, tip rounded and sac-like, basal lateral lobes curved ventrally. Saccus short, curved upward medially. Phallus narrow, S-shaped; vesica covered with tiny spicules, with one large, curved, pointed cornutus apically, preceded by string of 13-14 smaller cornuti increasing in size toward apex.
Female (n = 4): Labial palpi: 1.8-2.2 mm long. Forewing: 15-19.5 mm. Frenulum quadruple.
Female genitalia (n = 3) (Fig. 35): Papillae anales dorsally strongly produced posterad, with rounded bulge dorso-apically; ventrally slightly produced. Posterior apophyses 0.3-0.45 × length of papillae. Tergite VIII about half of length of sternite VIII. Anterior apophyses about 0.1 × length of papillae anales, slightly wider and rounded apically. Sternite VIII narrowing ventrally, densely covered with spinules, slightly connected medially at lamella antevaginalis; lamella antevaginalis slightly projected downward. Sterigma forming strongly sclerotized ventro-laterally symmetrical structure made of two asymmetrical bell-shaped cavities in ventral view, opened anterad, with dorsal lobe longer, expanding upward, slightly indented along latero- anterior margin; covered with minute punctuation. Ventro-basal section of ductus bursae tongue shaped, strongly sclerotized; ductus bursae long, ventrally sclerotized, widened and looped in basal half; enlarging progressively into corpus bursae. Corpus bursae egg-shaped with one signum.
Distribution.
The species was found in French Guiana and Brazil (Amazonas) (Fig. 43).
Etymology.
" Chelicerata " refers to the shape of the costal arms of the male valva, which look like mygalomorph chelicerae.
Notes.
Two females included here have been named Catharylla robustella (genitalia on slide GS-5949-SB, CMNH) and Catharylla tenellina (genitalia on slide Pyralidae Brit. Mus. Slide N°17693, BMNH) by S. Bleszynski, as indicated on labels, but these names were never published. These two specimens are probably Catharylla chelicerata , but the bad genitalia preparations do not allow to see details, and therefore they are not included as paratypes.
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.