Mesobiotus philippinicus, Mapalo, Marc A., Stec, Daniel, Mirano-Bascos, Denise & Michalczyk, Łukasz, 2016

Mapalo, Marc A., Stec, Daniel, Mirano-Bascos, Denise & Michalczyk, Łukasz, 2016, Mesobiotus philippinicus sp. nov., the first limnoterrestrial tardigrade from the Philippines, Zootaxa 4126 (3), pp. 411-426 : 414-422

Mesobiotus philippinicus sp. nov.

( Tables 4 –6, Figs 1–51 )

Description of the new species. Animals (measurements and statistics in Table 4 ).

Body white/transparent ( Figs 1–2 ), eyes present (also in mounted individuals). Under PCM, cuticle appears completely smooth with no granulation visible (except in some specimens a very fine granulation barely detectable on legs IV). Under SEM, however, extremely fine granulation (microgranules, ca. 0.05 µm in diameter) is visible on the entire dorso-lateral cuticle ( Figs 3–5 ). The microgranulation is scattered evenly on most of the cuticle, but is denser to the caudo-dorsal region. Moreover, patches of dense, raised granule aggregates are present on external cuticle of all legs, above claws ( Figs 6–9 ). These raised granule aggregates are ca. 0.2 µm in diameter, and consist of two to over thirty microgranules, but more often between five and ten microgranules ( Figs 7, 9 ). Patches on legs I–III are smaller ( Figs 6–7 ) than those on legs IV ( Figs 8–9 ). Cuticular pores absent.

Bucco-pharyngeal apparatus of the Macrobiotus type ( Fig. 10 ), with ten peribuccal lamellae. Oral cavity armature of the harmsworthi- type, composed of three bands of teeth visible in both PCM and SEM ( Figs 10–16 ). The first band appears as small granules/cones placed just behind (sometimes also at the base) of the lamellae under PCM/SEM, respectively, and are arranged in 5–7 irregular rows (PCM: Figs 10–14 ; SEM: 15–16, filled arrowheads). Teeth in the second band ( Figs 15–16 , empty arrowheads) are intermediate in size between those of the first and third bands of teeth, and are in the shape of small ridges parallel to the longitudinal axis of the buccal tube ( Figs 10–14 ). The second band is continuous with the teeth arranged in one row and are positioned in the posterior portion of the oral cavity just behind the ring fold ( Figs 19–20 , rhomboid) and just before the third band of teeth ( Figs 15–16 , marked “L” and “M”). Situated posteriorly in the oral cavity just behind the second band of teeth and just before the buccal tube opening are the third band of teeth comprising three dorsal, distinctly separated, long and thin ridges ( Fig 15 “L” and “M”) and three to six ventral teeth: two lateral ridges ( Fig 16 "L") and 2–4 round or oval median teeth ( Fig 16 “M1–4”). Under PCM, the latero-ventral teeth are wing-shaped, thicker in their median portions ( Figs 10–14 ), and under SEM are flat and serrated, with their height almost twice that of the teeth in the second band ( Figs 15–16 ). Buccal tube rigid and slender with the ventral lamina ( Fig 10 ). The pharyngeal bulb is equipped with pharyngeal apophyses, three macroplacoids and a microplacoid, all spaced equidistant from each other ( Fig. 10 and the upper insert). The first and third macroplacoids are rod-shaped whereas the second macroplacoid is granular. The first macroplacoid is thinner anteriorly whereas the third macroplacoid has a sub-terminal constriction. The macroplacoid sequence is 2<3<1. In the majority of individuals, the drop-like microplacoid is larger than the second macroplacoid ( Fig. 10 , Table 4 ).

Claws of the Mesobiotus type, with a septum and well-developed accessory points ( Figs 17–20 ). Lunules smooth in claws I–III ( Figs 17–18 ) and lightly to moderately crenulated in claws IV ( Figs 19–20 ). Lunules, connected to the claw with a peduncle, present in all claws ( Fig. 17–20 ). Double W-shaped transverse bars under claws I–III ( Fig. 17 , filled arrowhead); a horseshoe-shaped structure connects anterior and posterior lunules IV ( Fig. 19 ).

Egg (measurements and statistics in Table 5 ). White, laid free, spherical in shape and equipped with conical to dome-shaped processes ( Figs 21–32 , 37–39 ). The processes are evenly spaced and exhibit considerable variability in size and shape between eggs: from low domes to high cones ( Figs 21–24, 29–32 , 37–39, 46–48 ). Process surface covered with wrinkles forming a rose-like whorl, clearly identifiable under SEM ( Figs 40–48 ) but under PCM identifiable only as serration on an intersected process wall ( Figs 30, 32 ). Very rarely processes have smooth walls ( Fig. 31 ). The labyrinthine layer is visible under PCM as a reticulum in process walls, with mesh size varying considerably between eggs ( Figs 33–35 ). Some processes are terminated with one to several short but thin and flexible portions, visible in both PCM ( Figs 30–32 , indented arrowheads) and in SEM ( Figs 49–51 ), covered irregularly with small granules that are visible only in SEM ( Figs 49–51 ). Small pores (0.3 µm) are present on the bases of some processes and scattered across the inter-process surface. The pores are clearly visible in SEM ( Figs 40–48 ) but only occasionally detectable under PCM ( Figs 33–34 , filled arrowheads). Egg surface clearly wrinkled, with wrinkles radiating out from the process bases, but not forming a connective network ( Figs 33–36 , 40–48 ).

DNA sequences. A single haplotype was found for each sequenced marker across the eight analysed individuals, thus only one sequence per locus was deposited in the GenBank.

The 18S rRNA sequence (GenBank: KX129793 ), 1690 bp long:

TCTAAGTACTTGCTTTAACAAGGCGAAACCGCGAATGGCTCATTAAATCAGTTATGGTTCACTAGATCGTATATCCTACA CGGATAACTGAGGTAATTCTTCAGCTAATACGTGCTACAAGCTCGTTCCCTTGTGGAGCGAGCGCAGTTATTAGAACAAA ACCAATCCGGCCTTCGGGTCGGTTAAAATGGTGACTCTGAATAACCGAAGCGGAGCGTATGGTCTCGTACCGACGCCAGA TCTTTCAAGTGACTGCTCTATCAGCTTGTTGTTAGGTTATGCTCCTAACAAGGCTTCAACGGGTAACGGGGTATCAGGGT CCGATACCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCACTCCCAGCA CGGGGAGGTAGTGACGAAAAATAACGATGCGAGGGCATATTGCTTCTCGTAATCGGAATGGGTACACTTTAAATCCTTTA ACGAGGATCTATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGCTGC GGTTAAAAAGCTCGTAGTTGATCGTAGACGTAGGATGAGTGGTGCGCTTTCCGGCGCTACTGCTTGTTCCGACGTCAAAA GCCGGTCATGTCTTGCATATCCTTCACTGGGTGTGCTTGGCGGCCGGAGCGTTTACTTTGAAAAAATTAGAGTGCTCAAA GCAGGCGTACGGCCTTGCATAATGGTGCATGGAATAATGGAATAGGACCTCGGTTCTATTTTGTTGGTTATCGGAGCTCG AGGTAATGATTAAGAGGAACAGACGGGGGCATTCGTATTGCGGCGTTAGAGGTGAAATTCTTGGATCGTCGCAAGACGCA CTACTGCGAAAGCATTTGCCAAGAATGTTTTCATTAATCAAGAACGAAAGTTAGAGGTTCGAAGGCGATCAGATACCGCC CTAGTTCTAACCATAAACGATGCCAACCAGCGATCCGCCGATGTTCTTTTGATGACTCGGCGGGCAGCTTCCGGGAAACC ACAAGTGCTTAGGTTCCGGGGGAAGTATGGTTGCAAAGCTGAAACTTAAAGGAATTGACGGAAGGGCACCACCAGGAGTG GAGCCTGCGGCTTAATTTGACTCAACACGGGAAAACTTACCCGGCCCGGACACTGTAAGGATTGACAGATTGAGAGCTCT TTCTTGATTCGGTGGGTGGTGGTGCATGGCCGTTCTTAGTTGGTGGAGCGATTTGTCTGGTTAATTCCGATAACGAACGA GACTCTAGCCTGCTAAATAGCCAACCGATCCGCAGCGTCGGTTGCTACAAAAGCTTCTTAGAGGGACAAGTGGCGTTTAG TCACATGAGATTGAGCAATAACAGGTCTGTGATGCCCTTAGATGTCCGGGGCCGCACGCGCGCTACACTGAAGGGATCAG CGTGCTTAATCGCCTTGCCCGGAAGGGCTGGGGAATCCGATTAAACCCCTTCGTGATTGGGATTGAGCTTTGTAATTATC GCTCATGAACGAGGAATTCCCAGTAGGCACGAGTCATAAGCTCGTGTCGATTAAGTCCCTGCCCTTTGTACACACCGCCC GTCGCTACTACCGATTGAACCCTTTAGTGAGGTCTTCAGACCGGCCGTGGCGGCAGACTTTGTCTGCAGCTCACAGGTTG GGAAGACGAC

The 28S rRNA sequence (GenBank: KX129794 ), 755 bp long:

CTGCGAGTGAAACGGGACCAGCCCATCGCCGAATCCTTTCTGGCAACAGTGAAGGAACTGTGGCGTGTAGAAGATGTCTG CCGGTGTGGTTAGTTTGCGTAAGTTCTCCTGAGTGAGACTCCATCCCATGGAGGGTGCAAGGCCCGTACCGCAAGCAGCT GATGCCGGTTAGCGTCTTTCGGAGAGTCGCCTTATTTGTGAGTATAAGGTGAAGTCGGTGGTAAACTCCATCGAAGGCTA AATATGGCCGCGCGTCCGATAGCGAACAAGTACCGTGAGGGAAAATTGAAAAGCACTTTGAAGAGAGAGCGAAACAGTGC GTGAAACGGCTCAGAGGCAAGCAGATGGGGCCTCGAAGGCAGAGCAGCGAATTCAGCCGGTAGTTTGTGCGGATGGCGGT TGTCGGGATCGTAAGACTCGGTGGCTGTCAGTGCTGTGTGTACAACTGCTGGTGCACTTTCGTTGCACGATACACAACCG CCGTTGAGCGAGCATCCGTTGAGCTGGCAGCGTGGAGCCTTATTCCCCTTAAAAAGGCATAGGTGCTTACAGCTGGCTTT AACGCGTTTGCGCCTCAACCGGTCAAGTCTATGTATGCCATGCTTCGGCAGTGGGACCGGCTTGCTCCGATTTGGCGTTA GGAATGACGACTTTGTCGGCTTCTTGGCGTTAGGTGGACTCGATGTCGGTTATCCACGTAGGCATATTGTTGATTCGGTT GTGAGTAGATGGCAGCCTATCTAACCCGTCTTGAA

The ITS-2 sequence (GenBank: KX129795 ), 481 bp long:

AGAACGCAGCAAGATGTGAGACGTAACTGGAATTGCAGGACTTGTGACAGTTTATTCTTCGAATGCAAATCGCGGCGTTG GGTTAACCGACGCCACGCCTGGTTGAGGGTCAGTTGAATTAAACAAATCATAGTCGCGCAATGATTATGGATTGTCTGAA CAGTGCGTCAAGCACTGGCAGATGAAGTACAGACCCCAGACGTTGAGTGTCATGCGTACCGCTGCTGGTGCGATTGACGT TATATGGGACTTGTGCCGCAGTTGCACAGTAAACAGTCTCATGCACGTCCGATCGGCAAGTCGGCCTCGCTGCACAACCG CTGTTAGCTATAGCGGTAAGCGATATAGCGTCTGTGTATAAAACGACGTTTGACAACAAGCGATCGATCGGTCAATTGCT CGACTAATCGTCGCACAATCGTCGGATACTTTTTCTTTTGACCTCAGCTCAGACGAGATTACCCGCTGAACTTAAGCATA T

The COI sequence (GenBank: KX129796 ), 763 bp long:

TTTTTTTTTGGATTATGAGCAGCTACGGTAGGTACATCACTTAGAATAATCATTCGATTAGAGCTAAGACAACCTGGAAG ATTATTTAATGACGAACAATTCTATAATGTAGTTGTAACTAGACACGCATTTATTATAATTTTTTTTTTTGTTATACCTA TTCTGATCGGTGGATTTGGTAACTGACTAGTTCCACTTATACTAAATGCACCTGACATAGCATTTCCCCGAATAAATAAC CTAAGATTTTGATTACTTCCTCCATCTTTAATTTTAATTTTATCTAGTTCAATCGTAGAACAGGGTGCAGGCACCGGATG AACTGTTTATCCGCCCCTATCAAGATTTTTTGCGCATAGAGGACCTAGAGTCGACATAACCATTTTTTCCCTTCATGTAG CTGGAGCTTCCTCAATTCTTGGGGCTATCAACTTTATTACAACTATTTTAAACATACGAATACATAATATGACAATAGAA CTACTACCCCTATTTGTATGATCAGTTCTTCTTACTGCTATTTTATTGCTCTTATCCCTCCCTGTACTTGCAGGTGCAAT CACTATATTACTTTTAGATCGAAATTTTAACACCTCCTTTTTCGACCCAAGAGGAGGAGGAGACCCTATTCTATACCAAC ACTTATTTTGATTCTTCGGTCATCCCGAAGTCTATATTTTAATTCTTCCTGGGTTTGGAATTATTTCACAACTAATTATC CATTTCAGTGGAAAACATTTAACTTTCGGGCATATCGGAATGA

Type locality. Locale: 14°38'54.4"N, 121°04'14.8"E, 62 m a.s.l.: UP Science Park, near the Institute of Mathematics, University of the Philippines, Diliman, Quezon City, Philippines. Habitat: shady urban park. Substrate: moss on a tree trunk. Coll. Marc Mapalo, Maynard Gian Valdez, Rafael Fernando and Gamaliel Cabria.

Etymology. The new species is named after the Philippines, where it was discovered and documented as the very first eutardigrade reported in the country.

Type depositories. The holotype (slide PH.001.19), 15 paratypes and 18 eggs (slides PH.001.4–7, 10–11, 15– 16, 20–22) are preserved at the Protein Structure and Immunology Laboratory of the National Institute of Molecular Biology and Biotechnology, University of the Philippines-Diliman, Quezon City, Philippines; 16 paratypes, 14 eggs and 15 chorions (slides PH.001.1–3, 8–9, 12–14, 17–18, 23–24) are preserved at the Department of Entomology, Institute of Zoology, Jagiellonian University, Kraków, Poland.

Figures

FIGURES 1 – 5. Mesobiotus philippinicus sp. nov. — habitus: 1 — dorso-ventral projection (holotype, PCM); 2 — dorsal view (paratype, SEM); 3 — dorsal cuticle between legs I and II; 4 — dorsal cuticle between legs II and III; 5 — dorsal cuticle between legs III and IV. Scale bars in µm.

FIGURES 6 – 9. Mesobiotus philippinicus sp. nov. — granulation of the external side of the legs: 6 — patch of leg granulation above claws III; 7 — a closer look at leg III granulation reveals a complex structure of the granules; 8 — patch of leg granulation above claws IV; 9 — a closer look at leg IV granulation shows that granules are in fact aggregations of conical microgranules. All paratypes in SEM, scale bars in µm.

FIGURES 10 – 16. Mesobiotus philippinicus sp. nov. — buccal apparatus: 10 — buccal apparatus seen in PCM (paratypes), dorso-ventral projection with dorsal teeth and dorsal placoids, upper insert shows ventral placoids (of the same paratype) whereas the lower insert shows ventral teeth with the medio-ventral tooth divided into 4 oval teeth (a different paratype); 11 – 14 — ventral teeth seen in PCM, in Figs 11 – 12 the medio-ventral tooth is divided into two oval teeth whereas in Figs 13 – 14 into three oval teeth; 15 – 16 — oral cavity armature seen in SEM (paratype) — dorsal and ventral teeth, respectively; filled arrowheads indicate teeth of the first band, empty arrowheads indicate teeth of the second band, teeth of the third band are marked with “ M ” (median teeth) and “ L ” (lateral teeth), rhombi indicate the ring fold. Scale bars in µm.

FIGURES 17 – 20. Mesobiotus philippinicus sp. nov. — claws: 17 – 18 — claws II with small and smooth lunules (PCM and SEM, respectively, both paratypes), a flat arrowhead on Fig. 17 indicates the W-shaped cuticular bar under the claws; 19 – 20 — claws IV with enlarged and indented lunules (PCM and SEM, respectively, both paratypes), an indented arrowhead on Fig. 19 indicates the horseshoe structure connecting the anterior and the posterior claw. Scale in µm.

FIGURES 21 – 36. Mesobiotus philippinicus sp. nov. — PCM images of eggs: 21 – 24 — midsections; 25 – 28 — surfaces; 29 – 32 — midsections of egg processes (indented arrowheads indicate flexible endings); 33 – 36 — egg surfaces under a greater magnification (flat arrowheads indicate hardly detectable pores between processes; vertical panes show different eggs ordered by increasing processes height. Photos in each column show details of a single egg. Scale bars in µm.

FIGURES 37 – 51. Mesobiotus philippinicus sp. nov. — SEM images of eggs: 37 – 39 — entire eggs; 40 – 42 — egg surface with processes; 43 – 45 egg surface between processes, with well visible pores and wrinkles; 46 – 48 — egg processes; 49 – 51 — flexible tips at the end of process apices covered by fine granules; vertical panes shows different eggs ordered by increasing processes height. Photos in each column show details of a single egg. Scale bars in µm.

Tables

TABLE 4. Measurements (in µm) of selected morphological structures of individuals of Mesobiotus philippinicus sp. nov. mounted in Hoyer’s medium (N—number of specimens / structures measured. RANGE refers to the smallest and the largest structure among all measured specimens; SD—standard deviation).

CHARACTER	N	RANGE	MEAN	SD	Holotype
		µm pt	µm pt	µm pt	µm pt
Body length	23	238 – 442 765 – 1102	379 941	53 93	432 1075
Buccopharyngeal tube
Buccal tube length	24	31.1 – 48.1 –	40.4 –	4.1 –	40.2 –
Stylet support insertion point	24	24.6 – 37.1 76.4 – 79.8	31.6 78.1	3.2 1.0	31.6 78.6
Buccal tube external width	24	4.5 – 8.0 1 1.8 – 1 7.3	6.5 16.0	0.8 1.1	6.5 16.2
Buccal tube internal width	24	3.7 – 6.1 1 1.0 – 1 6.2	5.0 12.4	0.6 1.0	4.9 12.2
Ventral lamina length	21	18.2 – 26.3 51.4 – 58.8	22.2 55.5	2.0 2.1	22.1 55.0
Placoid lengths
Macroplacoid 1	24	3.9 – 6.9 1 1.3 – 1 4.7	5.3 13.0	0.7 1.0	5.9 14.7
Macroplacoid 2	24	2.8 – 5.2 7.3 – 11.0	3.7 9.1	0.6 0.8	3.7 9.2
Macroplacoid 3	24	3.5 – 5.7 10.4 – 13.5	4.7 11.6	0.6 0.8	4.7 11.7
Microplacoid	24	3.1 – 5.7 9.1 – 1 2.3	4.3 10.5	0.6 0.9	4.1 10.2
Macroplacoid row	24	12.7 – 20.5 39.7 – 47.4	17.0 42.0	1.9 1.8	17.1 42.5
Placoid row	24	16.8 – 28.7 50.8 – 60.7	22.3 55.2	2.7 2.6	23.5 58.5
Claw I lengths
External primary branch	20	9.3 – 14.1 25.4 – 31.2	11.6 28.9	1.3 1.4	11.4 28.4
External secondary branch	18	7.9 – 12.1 19.5 – 26.3	9.7 24.2	1.2 1.9	8.8 21.9
Internal primary branch	16	8.9 – 13.3 25.7 – 29.7	11.0 27.5	1.2 1.2	10.8 26.9
Internal secondary branch	13	7.4 – 11.9 18.1 – 25.4	9.1 22.9	1.3 2.0	8.9 22.1
Claw II lengths
External primary branch	20	11.1 – 14.8 29.3 – 33.5	12.8 31.1	1.1 1.1	13.2 32.8
External secondary branch	17	8.3 – 12.5 21.8 – 28.1	10.1 24.9	1.1 1.7	10.5 26.1
Internal primary branch	22	9.3 – 13.3 24.8 – 30.1	11.2 27.6	1.2 1.5	10.4 25.9
Internal secondary branch	18	6.9 – 10.9 19.7 – 26.7	9.4 23.0	1.2 2.1	9.8 24.4
Claw III lengths
External primary branch	19	10.0 – 16.1 27.0 – 34.0	12.7 31.3	1.5 1.9	11.6 28.9
External secondary branch	14	8.9 – 12.5 22.0 – 28.4	10.4 25.5	1.1 1.8	9.2 22.9
Internal primary branch	16	8.8 – 13.2 24.2 – 29.7	11.0 27.2	1.2 1.4	11.0 27.4
Internal secondary branch	13	7.0 – 11.4 19.2 – 26.3	9.2 23.6	1.3 2.2	10.2 25.4
Claw IV lengths
Anterior primary branch	16	11.1 – 16.3 29.9 – 35.2	13.4 32.6	1.5 1.4	13.3 33.1
Anterior secondary branch	16	8.6 – 13.2 24.7 – 28.6	11.1 27.0	1.2 1.1	11.5 28.6
Posterior primary branch	18	11.7 – 17.5 33.1 – 38.7	14.7 35.7	1.5 1.8	15.5 38.6
Posterior secondary branch	17	9.7 – 14.5 24.1 – 33.4	11.7 28.2	1.3 2.2	11.0 27.4

TABLE 5. Measurements (in µm) of selected morphological structures of eggs of Mesobiotus philippinicus sp. nov. mounted in Hoyer’s medium (N—number of eggs / structures measured, RANGE refers to the smallest and the largest structure among all measured specimens; SD—standard deviation).

CHARACTER	N	RANGE	MEAN SD
Egg bare diameter	23	62.7 – 79.9	70.7 4.5
Egg full diameter	23	71.4 – 97.5	83.4 6.6
Process height	69	2.1 – 13.7	7.2 2.8
Process base width	69	7.1 – 13.0	9.6 1.4
Process base/height ratio	69	76% – 433%	159% 79%
Distance between processes	69	2.4 – 6.7	4.6 1.0
Number of processes on the egg circumference	22	15 – 17	16.0 0.7