Neolycaena ittohtoriti Korb

Korb, Stanislav K., 2017, A new species of the genus Neolycaena de Nicéville, 1890 from Kyrgyzstan (Lepidoptera, Lycaenidae), Zootaxa 4286 (4), pp. 565-572 : 566-568

Neolycaena ittohtoriti Korb , sp.n.

(plate 1: figs. 9–12; plate 2: figs. 3, 4, 7–11; plate 3: figs. 1, 2)

Material. Holotype ♂, 6.vi.2015, Kyrgyzstan, Kirghizsky Mts., Bishkek environs, Ala-Too village , 900 m, leg. S.K. Korb . Paratypes: 34 ♂♂, 12 ♀♀, 6.vi.2015, ditto, leg. S.K. Korb . The holotype has been handed over to the Zoological Institute of the Russian Academy of Sciences; the paratypes are kept in the author’s collection.

PLATE 1. Neolycaena spp., type specimens. 1, 2: N. carbonaria baidula Zhdanko, 2000 , holotype ♂ (ZISP). 3, 6: N. tengstroemi (Erschoff, 1874) , lectotype ♂ (ZMMU). 4, 5: N. carbonaria (Groum-Grshimaïlo, 1890) , lectotype ♂ (ZISP). 7, 8: N. tengstroemi submontana Zhdanko , [1996], holotype ♂ (ZISP). 9–12: N. ittohtoriti sp.n., holotype ♂ (9, 12) and paratype ♀ (ZISP).

Description. Forewing length 13–21 mm. Upperside of wings dark brown, almost black, with thin whitish marginal edge on hindwing in males. Forewing underside brown, anal part colored much darker. Marginal edge thin, greyish, with antemarginal pattern of black big external and small internal spots. Submarginal strokes are white, separated by veins, internal side with black stroke-shaped borders. White spot on distal cell linear, poorly visible (in about half of specimens not present). Hindwing underside brown, basal part of wing with greenishbrown scales suffusion. Marginal spots regular, black, two in each cell, inside with an orange spot and with white scales around. Submarginal band with irregular hollow white spots. Discal spot white, v-shaped, poorly visible.

Fringes brown in both sides of both wings. Sexual dimorphism is weak, males are less than females, size difference is about 10–20%; wing pattern differences are very small, almost invisible (females are slightly lighter, with slightly thiner wing pattern elements).

PLATE 2. Genital structures of Neolycaena : 1, 2: N. tengstroemi baitenovi (Zhdanko, 2011) , West Tianshan, Syrdaryinsky Karatau Mts., Beresek valley, 900 m, male genitalia (1), female genitalia (2). 5, 6: N. carbonaria submontana Zhdanko , [1996], Kyrghyzstan, Terskey Ala-Too Mts., Kok-Moynok – Kochkor road (4th km), 1750 m, male genitalia (3), female genitalia (4). 3, 4, 7–11: N. ittohtoriti sp.n., paratypes male (3, 4, 9–11) and female (7, 8).

5’ COI sequence (two specimens sequenced, GenBank accession numbers: KT989879, KT989878 ):

TAGGAACATCTTTAAGAATTTTAATTCNAATAGAATTAGGAACTCCTGGATCTTTAATTGGAGATGATC AAATTTATAATACTATTGTAACAGCTCACGCTTTCATTATAATTTTTTTTATAGTAATACCTATTATAATTG GAGGATTCGGAAATTGATTAGTACCTTTAATATTAGGAGCTCCMGATATAGCATTTCCMCGAATAAATA ATATAAGATTTTGATTATTACCTCCTTCATTAATATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCA GGAACTGGATGAACAGTTTATCCCCCACTTTCATCTAATATTGCTCATAGTGGATCATCAGTTGATTTAG CTATTTTTTCTTTACATTTAGCAGGTATTTCATCAATTTTAGGAGCTATTAACTTTATTACAACTATTATTA ATATACGAATTAATAATTTATCTTTTGATCAAATATCATTATTTATTTGAGCAGTAGGAATTACAGCATTAT TATTACTTTTATCATTACCTGTATTAGCAGGTGCTATTACTATATTATTAACTGATCGAAATTTAAATACTT CATTTTTTGACCCTGCAGGAGGAGGAG

Genitalia. Male (plate 2: figs. 3, 4, 9–11): lobes of uncus wide, gnathos branches long, curved; valva pearlshaped, with rounded apex; aedeagus of typical shape for the genus, long, about 2 times longer than valva. Female (plate 2: figs. 7, 8): ductus bursae short, rounded; bursa with twospined signi and sclerotized in ductus bursae area; genital plate triangle; antrum two-folded with square-shaped hole.

Diagnosis. The main difference from the similar species N. tengstroemi and N. carbonaria is the dark brown, almost black wings upperside of the new species (plate 1). Further differences between N. tengstroemi and N. ittohtoriti sp.n. are in the presence of the marginal white edge on hindwing upperside in males. Male genitalia of N. tengstroemi , N. carbonaria and N. ittohtoriti sp.n. are identical (plate 2: figs. 1–6, 9–11). The differences in female genitalia between the new species, N. carbonaria and N. tengstroemi : in N. tengstroemi antrum is one-folded with no hole, in N. carbonaria antrum is two-folded with triangular hole, in N. ittohtoriti sp.n. antrum is two-folded with square-shaped hole; in N. carbonaria and N. tengstroemi bursa copulatrix with no sclerotized areas, in the new species it has sclerotized area near ductus bursae; in N. tengstroemi and N. carbonaria bursa copulatrix with onespined signi, in the new species bursa copulatrix with two spined signi (plate 2: figs. 2, 6–8). The COI sequence differences are in plate 4.

Variability within the group. The genus Neolycaena have almost no variability in male genitalia and very few variable characters within the female genitalia (bursa copulatrix structure and ostium shape) ( Zhdanko, 1998a, 1998b). The wing pattern and coloration are also quite conservative, variation is only present in the size of the white spots on the wings underside and sometimes in their number. The COI variability within this group was not studied. The morphological features of the new species are out of these borders.

Habitat (plate 3: figs. 1–3). Low-mountainous steppe (vertical zone: 700 – 1500 m). Host plant: Caragana sp. (plate 3: fig. 1).

Etymology. This new beautiful species is named after IT-Tohtorit Oy, one of the leading data recovery companies in the world, located in Helsinki, Finland and has been the sponsor of my expeditions for many years.

Distribution. Only known from its type locality. Most likely can be widely distributed in Kirghizsky mountain ridge and its surroundings.