Kolla brevis Feng & Zhang sp. nov.
(Figs. 1 E–H, 3A–I)
Material examined. Holotype: ♂, China, Xizang Autonomous Region (Tibet), Linzhi, Bomi, Bolonggong, 80K, 15 June 2015, coll. Zhai Qing with Malaise trap . Paratype: 1♂, same data as holotype .
Measurement. Length of male 6.8–7.0 mm.
Description of male. Crown yellow to brown, with large irregular black median spot between ocelli; face yellow with obvious clypeal muscle impressions, the inverted triangle black marking almost covering all the postclypeus, anteclypeus with a small light brown spot; pronotum black without any spots; scutellum black with small brown to yellow apex; forewing black except extraordinarily narrow transparent yellow stripe next to costal margin, with the apex membranous transparent. Male pygofer side moderately produced posteriorly, slightly shorter than plate, with macrosetae evenly distributed on half of posterior and dorsal margin; each process following ventral margin of pygofer, then curving posterodorsad, with a group of microsetae in base. Connective arms and long manubrium surrounded by membrane; style wide and membranous at base, then currently acute at apex; plate subtriangular, with inner margin obviously concave near midlength, with a large amount of stubby microsetae in inner margin, with 2 rows of macrosetae distributed near median of the plate, outside row of macrosetae short, median row of macrosetae long, along the outer margin covered with microsetae; aedeagus bent anterodorsad in lateral view, shaft with a pair of lobes widely divergent, with a protuberance reaching the 2/3 of two lobes in caudoventral view.
Etymology. This new specific epithet is the Latin word “ brevis ”, referring to the aedeagal protuberance being much shorter than lobe.
Female. Unknown.
Distribution. China (Xizang Autonomous Region).
Molecular Characters. Partial mitochondrial COI gene sequence with GenBank accession number: KX498029. Material: 1♂, China, Xizang Autonomous Region, Linzhi, Bomi, Bolonggong, 80K, 15 June 2015, coll. Zhai Qing and Wang Baohai. The gene sequence is as follows:
TACAATGTATTTTATATTTGGTATCTGGGCGGGGATAATTGGTACTATACTAAGAATAATTATTCGTGTCG AATTAGCACAACCAGGATCATTTTTAGGTAACGATCAATTATATAATGTAATTGTTACTTCTCATGCATTT ATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGTTTCGGTAATTGATTACTCCCTTTAATAATT GGTGCGCCAGACATAGCATTTCCACGGATAAACAATATAAGATTTTGGATACTGCCCCCCTCTATAGTT TTATTACTCGTTAGATCTTTAGTTGAATCAGGAGCAGGTACAGGCTGAACAGTTTACCCTCCCCTATCT GGGAATATCGCTCACTCAGGGGCTAGAGTAGACTTAACAATTTTTTCTCTTCACTTGGCTGGAATTTCA TCTATCTTAGGGGCAGTAAATTTTATTACTACGGTAATTAACATGCGAACAACTGGAATAAATTTGGATC GAACTCCATTATTTGTTTGGTCAGTAATAATTACGGCTGTACTTTTGCTTCTTTCTCTACCAGTTTTGGC TGGAGCAATTACAATATTATTAACAGACCGAAATATTAATACTAGTTTTTTTG
Remarks. This new species is very similar to K. atramentaria (Motschulsky, 1859), but it can be distinguished by the following characters: crown with large black median spot between ocelli (Figs 1 E, 1G); pygofer process curved dorsad before apex in lateral view (Figs 3 A, 3C, 3E); aedeagus shaft with a pair of lobes widely divergent, with a protuberance, reaching the 2/3 of the lobes, between two lobes in caudoventral view (Figs 3 H, 3I).
This species is also very similar to K. procerula Feng & Zhang, 2015, but can be easily differentiated from the latter by: crown with large irregular black median spot between ocelli (Figs 1 E, 1G); face with an inverted triangular black marking occupying most of postclypeus (Fig. 1 H); pygofer process curving posterodorsad (Figs 3 A, 3C, 3E); plate with multiseriate macrosetae (Figs 3 B, 3D); aedeagus shaft with a pair of widely divergent lobes and protuberance reaching 2/3 length of two lobes in caudoventral view (Figs 3 H, 3I).