Catharylla paulella Schaus, 1922 Figs 8, 10, 32, 33, 41, 44

Catharylla paulella Schaus, 1922: 131; Bleszynski and Collins 1962: 226; Bleszynski 1967: 97; Munroe 1995: 35; Nuss et al. 2013.

Type material.

Holotype. ♀, with labels as follows: "Sao Paulo | S.E. Brazil."; "Collection | W[illia]mSchaus"; "Type No. | 25533 | U.S.N.M." [orange label]; "SLIDE | SB ♀ | No.4641" [light blue label]; "Catharylla | paulella | type Sch[au]s" [hand written]; "Genitalia Slide | By SB | USNM 111,535" [green rectangular label with thin black line submarginally]. Deposited in USNM.

Other specimens examined. 2 ♂, 7 ♀. BOLIVIA: 2 ♂ (genitalia on slides GS-6652-SB and Pyralidae Brit. Mus. Slide No. 15890), Prov.[incia] del Sara, 450 m, iv.1910 (J. Steinbach) (CMNH, BMNH). BRAZIL: 1 ♀ (genitalia on slide BL 1752), Federal District, Planaltina, 15°35'S, 47°42'W, 1000 m, 3.xi.1977 (V. O. Becker n°22055) (Becker Coll.), 1 ♀ (genitalia on slide BL 1751) with same locality, 16.x.1990 (V. O. Becker n°96854) (Becker Coll.); 1 ♀, Maranhão, Feira Nova, Faz[enda]. Retiro, 480m, 07°00'S, 46°26'W, 1-3.xii.2011 (V. O. Becker n°148263) (Becker Coll.); 1 ♀ (genitalia on slide BL 1712), Mato Grosso, Urucum, 15 miles S[outh]. of Columbá, 650 f[ee]t, 19. iv. [19]27, at light (C. L. Collenette) (BMNH); 1 ♀, Parà, Belém, 20m, i.1984 (V. O. Becker n°46993) (Becker Coll.); 1 ♀ (genitalia on Pyralidae Brit. Mus. Slide N° 17692), São Paulo (BMNH); 1 ♀ (used for DNA sequencing and barcoding LEP 965, BC MTD 1705, genitalia on slide TL 5), São Paulo, São Luiz do Paraitinga, 23°20'S, 45°06'W, 900 m, 13-20.iii.2001 (V. O. Becker n°132357) (Becker Coll.).

COI barcode sequence of specimen LEP 965 (654 bp): ACATTATATTTTATTTTTGGAATTTGAGCAGGTATACTAGGAACTTCACTTAGAT TATTAATTCGTGCTGAATTAGGTAATCCTGGATCTCTTATTGGTGATGATCAAATTTATAATACTATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGTGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGTGCACCAGATATAGCTTTCCCTCGAATAAATAATATGAGATTTTGATTATTACCCCCATCATTAACTCTTTTATTTT ?TAGAAGAATTGTCGAAAATGGAACTGGAACAGGATGAACAGTTTACCCACCCTTATCATCCAATATTGCTCATAGAGGTAGATCAGTAGATCTAGCAATTTTTTCTTTACATTTGGCTGGAATTTCATCAATCTTAGGAGCTATTAATTTTATTACAACAATTATCAATATACGAATTAATAATTTATCTTTTGATCAATTATCATTATTTATTTGATCTGTAGGTATTACAGCTTTACTTTTATTATTATCATTACCAGTTCTAGCTGGAGCTATTACTATACTTTTAACTGATCGAAATCTTAATACATCATTTTTTGATCCTGCAGGAGGAGGTGATCCTATCTTGTATCAACATTTA

Diagnosis.

This species can be easily separated from the other Catharylla species by the forewing median transverse line with two strongly pronounced spots at 1/3 and 2/3. The forewing is also sparkled with dark brown scales, which is unique in the genus. In male genitalia, the two S-like projections of the costal arm of the valva discriminate this species from the other species of Catharylla . In female genitalia, the sterigma forms a pair of shallow rounded pockets on each side of middle, and the ductus bursae is narrow, with the rounded corpus bursae clearly differentiated from it in Catharylla paulella, whereas it forms double rounded cavities with a mustachio-shape arrangement of short spines in ventral view, and the ductus bursae is wide, progressively widening toward corpus in Catharylla mayrabonillae .

Redescription.

Male (n = 2): Head with ochreous chaetosemata. Antenna ochreous with white scales, with patch of dark brown scales at base. Maxillary palpus light ochreous, white tipped. Labial palpus: 1.4-1.7 mm long, light ochreous, white tipped. Thorax light ochreous at collar. Foreleg coxa whitish ochreous, femur light ochreous, dorsally ochreous; tibia and tarsomeres greyish brown, distally ringed with dark brown. Midleg and hindleg whitish ochreous; midleg tibia basally brown, hindleg tibia white; midleg and hindleg tarsomeres with white tips. Forewing length: 7-8 mm; costal line thin, brown or dirty white; median transverse line ochreous, with two dark brown strongly pronounced spots at 1/3 and 2/3; subterminal transverse line thin, ochreous, with small triangular spot on costal margin; with ochreous bar on costal margin following subterminal transverse line; outer margin ochreous with short dark brown lunules or dashes; fringes brass colored; underside light ochreous with brownish suffusion; with pronounced marginal spots. Hindwing white; outer margin with thin ochreous line in apical half; fringes white; underside dull white with dark brown marginal spots more or less connected on apical half.

Male genitalia (n = 2) (Figs 32, 33): Uncus almost straight, densely setose, about 1/4 length of tegumen arms. Gnathos with arms joining at 3/5, then directed upward at slightly less than 90° angle; apically narrowly rounded. Tegumen arms regularly widening toward uncus, connecting at about half their length. Cucculus of medium width, slightly curved upward in distal 1/4; costal arm of valva divided with short spatula at base and S-shaped projection with rounded apex apically. Juxta triangular with distal third narrower, apically rounded, with baso-lateral narrow, triangular projections pointing anterad. Phal lus with apex more thickly sclerotized, with blunt apical margin, with short triangular ventral projection; vesica covered on basal 1/4 with tiny spicules, with barely visible microspicules all along, with one wide and curved cornutus at about 1/4 length of phallus.

Female (n = 7) (Figs 8, 10): Labial palpi: 1.4-1.7 mm long; forewing length: 9-9.5 mm; frenulum triple.

Tympanal organs (n = 5) (Fig. 10): Transverse ridge medially straight. Tympanic pockets not reaching beyond transverse ridge, rounded. Tympanic drum bean shaped, somewhat oval, just reaching transverse ridge.

Female genitalia (n = 5) (Fig. 41): Papillae anales ventrally slightly projected; sclerotized line at base enlarging medially to triangular shape covered by minute punctuation. Posterior apophyses 0.4-0.5 × length of papillae anales, narrow, tubular, with rounded tips. Tergite VIII short, about half of length of greatly enlarged sternite VIII. Anterior apophyses 0.05-0.1 × length of papillae anales. Lamella antevaginalis of sterigma dorsally covered with minute spicules; pair of shallow rounded pockets on each side of middle opened posterad. Base of ductus bursae sclerotized, forming circular membranous and narrow pocket. Corpus bursae regularly rounded, without signum.

Distribution.

The species has been found in Brazil (Federal District, Maranhão, Mato Grosso, Pará, Saõ Paulo) and in Bolivia (Fig. 44).

Notes.

The original description doesn’t mention the original number or sex of the specimens but it is assumed that there was only one. S. Bleszynski gave the new name of Catharylla hibisca to specimens that appear to be Catharylla paulella . The BMNH São Paulo specimen is associated with slide n° 17692, but the genitalia on this slide seem to be wrongly associated, given the inscription "wrong abdomen?" on the label, as well as the size of the abdomen, which is much bigger than those of Catharylla paulella . Therefore, this specimen cannot be identified with certainty. An error is possible in the association of the sexes of this species as there are no series of both sexes from the same locality or other means of associating them with 100% confidence.