Catharylla mayrabonillae T. Leger & B. Landry sp. n. Figs 7, 30, 31, 40, 44
Type material.
Holotype. ♂, with labels as follows: "Col. BECKER | 101668"; "ECUADOR: NAPO | Misahualli | 450m xii.1992 | V.O.Becker Col"; "HOLOTYPE | Catharylla | mayrabonillae | Léger & Landry" [red label]. Deposited in Becker Collection.
Paratypes. 16 ♂, 37 ♀. BRAZIL: 1 ♀ (genitalia on slide BL 1729), [Acre] Rio Branco, 1924 (Dengler) (SMNS); 2 ♀, Amazonas, Manaus, Reserva Ducke, AM-010, km 26, 2°55'S, 59°59'W, 15.xii.1993, U[ltra]V[iolet] Light (J. B. Sullivan & R. W. Hutchings) (USNM); 1 ♂ (genitalia on Pyralidae Brit. Mus. Slide No. 11341), Amazonas, Fonte Boa, ix.1906 (S. M. Klages) (BMNH); 1 ♀ (genitalia on slide BL 1713), Federal District, Estaçao Florestal, Cabeca do Vedao, 1100m, 18.x.1971 (E.G., I. & E.A. Munroe) (CNC); 2 ♂, Maranhão, Feira Nova, Faz[enda]. Retiro, 480m, 07°00'S, 46°26'W, 1-3.xii.2011 (V. O. Becker n°148263) (Becker Coll.); 2 ♀, Pará, Belém, 20m, i.1984 (V. O. Becker n°46981) (Becker Coll.); 1 ♀, Pará, Capitao Poco, 25-31.i.1984 (V. O. Becker n°97880) (Becker Coll.); 1 ♂, Rondonia, Cacaulãndia, 140m, xi.1991 (V. O. Becker n°79592) (Becker Coll.); 1 ♀, Rondonia, 62km S[outh] Ariquemes, Fazenda Rancho Grande, 165m, 10°32'S, 62°48'W, 18-26.iv.1991 (R. Leuschner) (USNM). COLOMBIA: 1 ♂, Valle, J[un]ct[ion]. Old B’ [uena]v[en]tura R[oa]d. and Rio Dagua, 50m, 8.ii.1989 (J. B. Sullivan) (USNM). COSTA RICA: 1 ♀ (used for DNA Barcoding by Janzen, 07-SRNP-113921), Alajuela, Area de Conservacion Guanacaste, Estacion Caribe, 12.xi.2007 (S. Rios & H. Cambronero) (INBio); 1 ♀, Alajuela, Area de Conservacion Guanacaste, Rio Negro, 25.i.2009 (H. Cambronero & F. Quesada) (INBio); 2 ♂ (one used for DNA sequencing LEP 966, with genitalia on slide TL 3, other used for DNA sequencing LEP 967, with genitalia on slide TL 4), Alajuela, San Carlos, Arenal National Park, Send[ero] Pilón, Rio Celeste, 700m, light trap, 17-19.x.2001 (G. Rodriguez) (INBio); 1 ♂, Prov[incia] Guanacaste, F[in]ca Pasmompa, Est[acion] Pitilla, 5km SO S[an]ta Cecilia, 400m, xii.1990 (P. Rios & C. Moraga) (INBio). ECUADOR: 4 ♀ with same data and deposition as holotype; 4 ♂, 8 ♀ (1 ♂ used for DNA barcoding BC MTD 01844) with same data (USNM); 1 ♀ (genitalia on slide BL 1726, used for DNA sequencing and barcoding LEP 969, BC MTD 1707), Napo, 6km NW Tena, Lumu Caspi, 0°54'37"S, 77°49'32"W, 590m, 29.ix.2002 (Schouten Coll.); 1 ♀ (genitalia on slide BL 1715, used for DNA sequencing and barcoding LEP 968, BC MTD 1706), Pastaza, 1km N Santa Clara, 1°16'02"S, 77°52'57"W, 630m, 28.ix.2002 (Schouten Coll.). FRENCH GUIANA: 1 ♂, 4 ♀ (♂ genitalia on Pyralidae Brit. Mus. Slide No 7816, ♀ genitalia on slides BL 1720, BL 1725, and Pyralidae Brit. Mus. Slides No. 5953 and 19020), Saint Jean de Maroni (E. Le Moult) (BMNH); 2 ♀, Piste Nancibo, km 6, 4°41'N,; 52°25'W, in logged rain forest, at 125W[atts] mer[cury]-vapor light and 15W[atts] U[ltra]V[iolet], 11.i.1985 (J.[-]F. Landry) (USNM); 1 ♂, Roura, Montagne des Chevaux, xii.2008 (S. Delmas) (MHNG); 1 ♂ (genitalia on slide Pyralidae Brit. Mus. Slide No 7792), Cayen[ne] (BMNH). GUYANA: 1 ♀ (genitalia on slide BL 1723), Omai, vi.1908 (S. M. Klages) (BMNH); 1 ♀ (genitalia on slide BL 1722), Potaro i.1908 (S. M. Klages) (BMNH). PANAMA: 1 ♀, Rio Trinidad, 12.iii [no year data] (A. Busck) (USNM). PERU: 1 ♂ (genitalia on slide BL 1724), Agnaytia, Huallaga, 400m, ix.1961 (F. H. Walz) (CNC); 1 ♀ (genitalia on slide GS-6908-SB), Yurimaguas, Huallaga 14.iv.[19]20 (CMNH). SURINAME: 2 ♀ (genitalia on slides BL 1727 and BL 1728), Kabo, 5°16'N, 55°44'W, Saramaca, black light, respectively 15-16.iii.1983 and 13-14.i.1983 (K.E.Neerling) (Schouten Coll.); 1 ♀ (genitalia on slide BL 1710), Sipaliwini Distr[ict]., Tibiti area, Kabo Creek, partly swampy primary forest on hilly slopes, ca 2km from river, vi.1989 (J. Beerlink) (Schouten Coll.).
Other specimen examined. 1♀ (used for DNA sequencing Lep 1126), Peru, Huánuco, Rio Llullapichis, Panguana, 74,945°W / 9,614°S, 23.9.-10.10.2011 (SMTD).
COI barcode sequence of paratype 07-SRNP-113921 (654 bp): ACATTATATTTTATTTTCGGGATTTGAGCAGGTATAGTAGGAACTTCACTTAGATTATTAATTCGTGCTGAATTAGGTAACCCTGGCTCTCTTATTGGAGATGATCAAATTTATAATACTATTGTAACAGCCCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATCGGTGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGGGCACCAGATATAGCTTTCCCTCGAATAAATAACATAAGATTTTGATTATTACCACCATCATTAACTCTTTTAATTTCTAGAAGAATTGTAGAAAATGGAGCTGGAACAGGATGAACAGTTTATCCACCTTTATCATCTAATATTGCCCATGGGGGTAGATCTGTAGATTTAACAATTTTTTCATTACATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCATTTGATCAATTATCATTATTTATTTGATCAGTAGGAATTACTGCTTTACTTTTATTATTATCATTACCAGTTTTAGCTGGGGCTATTACTATACTTTTAACTGATCGAAATCTTAATACATCATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTA
Diagnosis.
The best discriminant characters externally between the two species of the mayrabonillae group are the shape of the forewing outer margin, which is slightly produced apically in Catharylla mayrabonillae and not produced in Catharylla paulella, and the forewing median transverse line with two strongly pronounced spots at 1/3 and 2/3 in Catharylla paulella, whereas these spots are lacking in Catharylla mayrabonillae . The hindwing of Catharylla mayrabonillae has a faded subterminal transverse line on costal half whereas the hindwing of Catharylla paulella lacks this marking. In male genitalia, the heavily sclerotized sacculus bears a dorso-lateral sclerotized string of short spines on distal 1/4 whereas the two processes of the costa are S-shaped in Catharylla paulella, and the apex of the phallus is trifid, rounded medially, shortly triangular laterally, whereas it is simply rounded in Catharylla paulella . In female genitalia, the sterigma forms double rounded cavities with a mustachio-shape arrangement of short spines in ventral view, and the ductus bursae is wide, progressively widening toward corpus in Catharylla mayrabonillae, whereas the sterigma forms a pair of shallow rounded pockets on each side of middle and the ductus bursae is narrow, with the rounded corpus bursae clearly differentiated from it in Catharylla paulella .
Description.
Male (n = 17) (Fig. 7): Head with light ochreous chaetosemata. Antenna brown, with white scales dorsally and patch of dark brown scales at base. Maxillary palpus light ochreous, ringed with dark brown at 2/3; white tipped. Labial palpus: 1-1.4 mm; white, with patch of dark brown scales at 1/3 and 2/3 laterally. Thorax with patch of light ochreous scales at collar. Foreleg coxa whitish brown, femur white, dorsally ashen brown, tibia and tarsomeres ochreous, distally ringed with dark brown. Midleg femur white, tibia light ochreous, basally brown, tarsomeres II–V ochreous with tips ringed white. Hindleg white, except tarsomeres, as in midleg. Abdomen dull white. Forewing length: 7.5-8.5 mm; with apex slightly produced; costal line thin, ochreous or white in basal half, white in apical half; median transverse line ochreous, slightly undulated; subterminal transverse line ochreous; transverse lines enlarging into brown spot on costal margin with ochreous bar on costa following subterminal transverse line; terminal sector with light ochreous between veins, margin with thin, dark brown line from apex to CuA1, with two dark brown spots in cubital sector, with spot between CuA1 and CuA2 slightly displaced toward base; fringes brass colored; underside light ochreous with some brownish scales, with thin brown margin. Hindwing white with thin transverse subterminal line faded ochreous, in continuity with forewing median transverse line; outer margin line pronounced, dark brown; underside dull white with thin faded brown margin; fringes white.
Tympanal organs (n=7): Transverse ridge regularly rounded, medially slightly flattened. Tympanic pockets broadly rounded, extended widely beyond transverse ridge, connected medially at base of praecinctorium. Tympanic drum bean-shaped, elongated, extended beyond tympanic pockets.
Male genitalia (n = 7) (Figs 30, 31): Uncus thick and wide, about 2/5 length of tegumen arms, densely setose, with shortly projecting apex dorsally rounded. Gnathos reaching about 1/4 longer than uncus; arms wide, joining at 2/5 of length; distal 2/5 at angle of about 85°. Tegumen almost regularly narrow, joined in last 1/4. Cucculus narrow, shorter than sacculus, apically rounded; sacculus greatly enlarged, thickly sclerotized, directed upward, then apically straight, slightly narrowing toward apex, laterally with string of short spines and 2-3 longer basal spines pointing downward; costal arm of valva directed upward, located at about 1/3 of costal margin, thin, strongly sclerotized, slightly curved. Vinculum arms narrow; saccus short and wide, tongue shaped, projecting posterad apically. Juxta elongate, distal 1/4 narrowed with rounded tip; wide base with ear-like lobes laterally and baso-lateral angle projected anterad. Phallus slightly bent sideways in distal 1/4, with trifid sclerotized apex rounded medially and shortly triangular laterally; vesica basally covered with tiny spicules, microspicules barely visible all along, with long spine-like, down-curved cornutus of about 2/5 length of phallus.
Female (n = 37): Labial palpi length: 1.1-1.3 mm. Forewing length: 9.5-10.5 mm; frenulum triple.
Female genitalia (n = 16) (Fig. 40): Papillae anales strongly curved in lateral view; sclerotized line along papillae expanding ventrally into triangle. Posterior apophyses 0.35-0.45 × length of papillae anales. Tergite VIII about 1/3 length of sternite VIII; postero-dorsal margin with few setae of moderate length; anterior apophyses 0.03-0.1 × papillae anales; sternite VIII with patches of minute setae antero-ventrally on each side of bare median band. Sterigma forming double rounded cavities with mustachio-shaped arrangement of short spines (in ventral view); remaining cavity wall with tiny spines. Ductus bursae short and wide, enlarged near middle; partly sclerotized on right side of enlargement and posterior section. Corpus bursae circular to elongate, about as long as tergite VII; single signum faintly pronounced.
Distribution.
The species has been found so far in Panama, Costa Rica, Colombia, Venezuela, Guyana, Suriname, French Guiana, Ecuador, Peru and Brazil (Acre, Amazonas, Distritò Federal, Pará, Rondônia) (Fig. 44). It is the most widespread species of Catharylla and the only one so far found in Central America and in Venezuela, Columbia, Ecuador and Peru.
Etymology.
Catharylla mayrabonillae is named in honor of Ms. Mayra Bonilla of San Jose, Costa Rica, in recognition of her artistic portrayal of the biodiversity and ecosystems of Costa Rica and her many years of support for the existence of the rain forest in Area de Conservacion Guanacaste.
Notes.
The relatively strong COI barcode divergence of 4.34% between samples LEP 1126 from Peru and 07-SRNP-113921 from Costa Rica (Table 5) is notable but it is not associated with morphological variation.