Amynthas daeari sp. n.

Material examined.

IV0000261261, mature specimen complete but broken in two at clitellum after being figured and dissected. Collected from small valley at Jeollabuk-do, Wanju-gun, Dongsang-myeon, Daea-ri (35.9801N, 127.2981E); collected 27th July, 2012 by Dr Hong-Yul Seo. DNA tissue sample code - w53.

Etymology.

Noun from location.

Diagnosis .

Amynthas with two pairs of spermathecal pores in 6/7/8 complying with an Amynthas tokioensis -group; spermathecae with compressed clavate diverticula; GMs median to spermathecal and male pores with patches around the former and the latter bracketed laterally by small C-shaped clefts.

Distribution.

Only known from a single specimen from type locality.

Habitat.

In litter layer in forest.

Behaviour. Habitat, pigmentation and gut contents indicate activity in the litter layer.

Description.

Length. 150 mm.

Width. ca. 7 mm at male pore level.

Segments. 107.

Colour. Brown in alcohol, possibly darker in life as liquid was stained.

Prostomium. Open epilobous.

First dorsal pore. 12/13.

Setae. Ca. 60 per segment, approximately 22-24 between spermathecal and male pores.

Nephropores. Not found.

Clitellum. Annular 14-16, setae occluded.

Male pores. On 18 centred on small, round porophore (found by following a pin from prostate gland exit) with GMs anterio-median and shallow clefts laterally (that function as seminal ducts and/or suction cups?).

Female pores. Single on 14.

Spermathecal pores. 6/7/8 ca 0.3 C apart at edge of puckered area and lateral to GMs.

Genital markings. Paired discs just median to male and spermathecal pores as noted; composite glands on spermathecal pore GMs but none found for GMs near male pores although the body here is macerated and they may well have broken off and dissipated.

Septa. Nephridial forests on septa 5 & 6; 7/8 thin, 8/9/10 aborted.

Dorsal blood vessel (dbv). Single.

Hearts. Last hearts in 13 (preceding vascularization unclear/damaged).

Gizzard. Single in 8-9.

Calciferous glands. Absent.

Intestine. Indeterminate as specimen macerated; caeca ventrally incised from 27; typhlosole not noted.

Nephridia. Meroic.

Male organs. Holandric, seminal vesicles in 11 & 12.

Ovaries. In 13 as usual.

Prostates. Racemose glands in 17-19, duct short and muscular.

Spermathecae. Two pairs in 7 and 8; that in 7lhs inflated, that in 8lhs deflated (showing how meaningless such a distinction is although relied on by some authors).

Gut contents. Coarse organic debris, i.e., a litter diet suggesting superficial feeding.

DNA COI barcode.

>w53 Amynthas daeari Holotype.

CTATATTTCATTTTAGGAATTTGAGCTGGAATAATTGGGGCAGGAATAAGACTGCTTATTCGAATTGAGCTAAGACAGCCGGGCTCTTTTCTAGGAAGGGATCAACTCTATAATACAATTGTAACA GCTCATGCATTTTTAATAATCTTCTTTCTTGTAATACCAGTATTTATTGGTGGGTTTGGAAATTGACTTCTACCTCTAATACTAGGTGCCCCAGATATAGCTTTCCCGCGACTTAACAATATAAGATTCTGATTACTGCCCCCATCACTAATTTTACTAGTATCGTCTGCAGCAGTAGAAAAAGGTGCCGGAACAGGATGGACAGTGTACCCCCCACTTGCGAGAAACATTGCACATGCCGGCCCTTCAGTAGATCTTGCAATTTTTTCTCTCCATCTAGCCGGAGCATCATCAATTCTCGGTGCCATCAACTTCATTACTACCGTAATTAATATACGATGATCTGGGCTACGCTTAGAACGAATTCCTCTATTTGTATGAGCAGTTGTAATTACTGTAATTCTTTTACTTCTATCTTTACCAGTCTTAGCCGGTGCTATTACAATATTACTAACAGACCGAAACCTAAATACATCATTTTTTGATCCAGCGGGAGGAGGTGATCCAATTCTATATCAACACTTATTT

megaBLAST result: " Amynthas tappensis " (AB542547.1) from Japan max. identity <88% this then is a different and likely new taxon. The closest match from current Korean studies with BLASTn identity 565/653 (87%) is WO49, an immature Amynthas sp. from Jeju that itself comes closest to the Amynthas tokioensis / Metaphire hilgendorfi spp. complexes (see Blakemore 2013a: Appendix).

Remarks.

Of Amynthas species with spermathecae in 6/7/8, twenty or so in the Amynthas tokioensis -group of Sims and Easton (1972) mostly have manicate caeca, such as Amynthas kanrazanus (Kobayashi, 1937); about twenty other species, many placed in this group after 1972, have simple intestinal caeca. Only four have simple incised caeca as here, but they all differ in characteristics of their GMs, at least, and none of these latter are known from Korea (Blakemore unpublished). The incised caeca is assumed to be a characteristic transitional or intermediate from simple to complex/manicate. The GMs in 7-8 obviously correspond to those in 18 during amphimixis but it is not known whether they interlock serially. The shape of the spermathecae and spermathecal pores are further distinguishing characteristics of Amynthas daeari that, along with its objective DNA barcode data, now serve to define this taxon.