identifier	taxonID	type	CVterm	format	language	title	description	additionalInformationURL	UsageTerms	rights	Owner	contributor	creator	bibliographicCitation
F26F8B8D1E08506ABFD68CDD4185F396.text	F26F8B8D1E08506ABFD68CDD4185F396.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Doggerella (Lelejobracon) chasanica (Tobias 2000)	<div><p>Doggerella (Lelejobracon) chasanica (Tobias, 2000)</p><p>Fig. 4 A ‒ F</p><p>Bracon chasanicus Tobias, 2000, Belokobylskij and Tobias 2000: 148.</p><p>Doggerella (Lelejobracon) chasanica in Samartsev 2016: 124.</p><p>Bracon bitumor Papp, 2018: 26 .</p><p>Bracon planitibiae Yang, Cao &amp; Gould, 2019, in Cao et al. 2019: 430.</p><p>Doggerella (Lelejobracon) chasanica (Tobias, 2000), in Samartsev 2019: 54.</p><p>Doggerella (Lelejobracon) chasanica (Tobias, 2000), in Samartsev et al. 2024: 198.</p><p>Material examined.</p><p>Non-type South Korea • 5 ♀; <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=126.28847&amp;materialsCitation.latitude=33.32369" title="Search Plazi for locations around (long 126.28847/lat 33.32369)">Hangyeong-myeon</a>, Jeju-si, Jeju-do, Korea; 33°19'25.28"N, 126°17'18.48"E; 17.VI. ‒ 2.VII.2019; Moo-Sung Kim (Korea National Arboretum) leg.; Host insect: Monochamus alternatus . • 2 ♀; <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=126.28847&amp;materialsCitation.latitude=33.32369" title="Search Plazi for locations around (long 126.28847/lat 33.32369)">Hangyeong-myeon</a>, Jeju-si, Jeju-do, Korea; 33°19'25.28"N, 126°17'18.48"E; 1‒16.VII.2019; Moo-Sung Kim (Korea National Arboretum) leg.; Host insect: M. alternatus .</p><p>Diagnosis.</p><p>Samartsev (2016) transferred Bracon chasanicus Tobias, 2000 to Doggerella Quicke, Mahmood &amp; Papp, 2011, establishing the subgenus Lelejobracon and recognizing D. (L.) chasanica as the only Doggerella (Lelejobracon) species recorded from Russia. Later, Samartsev (2019) synonymized Bracon planitibiae Yang, Cao &amp; Gould, 2019 and B. bitumor Papp, 2018 with D. (L.) chasanica . Regarding the subgenus, as discussed in detail by Samartsev (2016), Lelejobracon is easily distinguished from Doggerella s. str., which is restricted to the Afrotropical region, by its smooth and polished metasoma (Fig. 4 C).</p><p>Molecular data.</p><p>The first COI DNA barcodes for Doggerella (Lelejobracon) chasanica were successfully obtained from specimens collected in Korea. The COI barcodes from two individuals were identical.</p><p>Consensus COI sequence (658 bp; GenBank accession numbers: PV 169210, PV 169211);</p><p>TATATTATATTTTTTTTTTGGTATTTGATCAGGAATTTTAGGTTTATCTATAAGAATAATTATTC GATTAGAATTAGGAATACCAGGAAGTTTATTAGGTAATGATCAAATTTATAATAGTATAGTAACTG CTCACGCATTTGTAATAATTTTTTTTATAGTTATACCAGTAATATTAGGTGGGTTTGGAAATTGAT TAATTCCTTTAATATTAGGGGCTCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTCTGAT TACTTATTCCTTCATTAATTTTATTAATTTTAAGAAGAATTTTAAATGTTGGTGTTGGAACTGGAT GAACAGTTTATCCTCCATTATCTTCTTCTTTAGGCCATAGAGGTATATCTGTTGATATAGCTATTT TTTCTTTACATTTAGCTGGAGCTTCATCAATTATAGGTTCAATTAATTTTATTACTACTATTTTTA ATATAAAATTAAATATTTTAAAATTAGATCAAATATCTTTGTTTATTTGATCAATTTTAATTACAA CAATTTTATTACTTTTATCTTTACCGGTATTAGCTGGTGCTATTACTATATTATTAACAGATCGAA ATTTTAATACATCATTTTTTGATTTTGCTGGTGGAGGAGATCCTGTTTTATTTCAACATTTATTT</p><p>Redescription.</p><p>The species was well-described by Samartsev (2016) and Samartsev et al. (2024). Most characters observed in the current study align with those described by Samartsev (2016) and Samartsev et al. (2024). However, we provide this redescription to include additional characters not mentioned in the previous studies and to provide a description with terminology that readers familiar with terminology used by Sharkey and Wharton (1997), particularly regarding wing vein terminology.</p><p>Body length 2.6 mm. Antenna length: 2.1 mm. Fore wing length 2.8 mm. Hind wing length 2.2 mm.</p><p>Head. Antenna with 24‒27 segments. 1 st flagellomere as long as 2 nd flagellomere (Fig. 4 A, E). Vertex smooth and polished, sparsely setaceous (Fig. 4 B). Frons entirely variolate. Face mostly variolate, width 1.5 × longer than its height (0.59: 0.39). Anterior ocellus 0.7 × longer than distance between posterior ocelli (0.04: 0.06). Eye sparsely setose; median width of eye 0.7 × longer than its height (0.24: 0.35) in lateral view and 1.7 × longer than median width of gena in lateral view (0.24: 0.14). Distance between anterior tentorial pits 0.15 mm. Hypoclypeal depression deep, 1.4 × longer than wide. Malar space 0.5 × longer than basal width of mandible (0.05: 0.11) and 1 / 6 of eye height in anterior view (0.05: 0.31).</p><p>Mesosoma. Mesosoma 1.5 × longer than maximum height in lateral view (1.08: 0.7) (Fig. 4 F). Mesoscutum entirely polished with long setae, basally punctate (Fig. 4 B). Notauli weakly present, not meeting posteriorly (Fig. 4 B). Scutellar sulcus straight, short, and finely crenulate. Scutellum entirely polished with long setae. Pronotum polished. Mesopleuron mostly smooth and polished; relatively bare medially (Fig. 4 F). Metapleuron entirely with long setae (Fig. 4 F). Propodeum entirely smooth and polished, anteriorly setose, 0.8 × longer than its maximum width (0.31: 0.39).</p><p>Legs. Fore femur 0.7 × longer than fore tibia (0.34: 0.48). Basal spur on fore tibia 0.5 × longer than fore basitarsus. Fore basitarsus 0.8 × longer than combined length of second to fourth tarsomeres (0.17: 0.22). Mid tibia as long as mid femur (0.41: 0.41). Basal spur on mid tibia 0.4 × longer than mid basitarsus (0.09: 0.23). Mid basitarsus as long as combined length of second to fourth tarsomeres (0.23: 0.24). Hind femur 0.8 × longer than fore tibia (0.6: 0.8) Basal spur on hind tibia 0.4 × longer than hind basitarsus (0.11: 0.3). Hind basitarsus 0.9 × longer than combined length of second to fourth tarsomeres (0.3: 0.34).</p><p>Wings. Fore wing length 2.7 × longer than its width (2.82: 1.05) (Fig. 4 D). Pterostigma 3.2 × longer than its width (0.58: 0.18). 1 RS as long as (RS + M) b vein. (RS + M) b vein present, 0.2 × longer than 2 RS (0.05: 0.28). r 0.6 × longer than 2 RS (0.16: 0.28). 3 RSa 1.8 × longer than r (0.29: 0.16). 3 RSb reaching wing margin as a tubular vein. r-m present as tubular vein medially. 2 nd submarginal cell trapezoid seemingly with two right angles apically (Fig. 4 D). 3 M reaching wing margin as a tubular vein. 3 CU reaching wing margin as a tubular vein. Apical angle between mc-u and 2 Cua approximately 120 ˚. Hind wing RS and M strongly developed, not reaching wing margin (Fig. 4 D). M + CU 0.5 × longer than 1 M (0.27: 0.58). m-cu crossvein absent. cu-a entirely developed. 1 A vein present not reaching wing margin.</p><p>Metasoma. Metasoma mostly polished and setose with long pale setae. Tergum 1 nearly rectangular (Fig. 4 B); Y-shaped suture on tergum 1 present and crenulate (Fig. 4 B); spiracle of tergum 1 located at basal third. Suture between tergum 2 and tergum 3 deep and finely granulose (Fig. 4 C). Tergum 2 1.6 × longer than tergum 3 medially (0.34: 0.22); spiracle of tergum 2 located at basal third. Setose part of ovipositor sheath as long as hind femur and 0.8 × longer than hind tibia (0.6: 0.8). Ovipositor slightly curved.</p><p>Color. Body mostly polished black. Setae on body whitish to ivory. Antenna mostly dark brown; annellus brown. Face dorsomedially bright brown to yellow. Malar space brown. Mandibles mostly yellow. Wings mostly slightly infuscate. Pterostigma entirely brown. Legs mostly brown. Fore tarsus bright brown. Trochantelli mostly yellow. Tibial spurs yellow. Mesosternum mostly ivory. Ovipositor yellow.</p><p>Host insects.</p><p>Anoplophora glabripennis (Motschulsky, 1853), Monochamus alternatus Hope, 1842 (new host record).</p><p>Distribution.</p><p>China, Korea (GG, GN, Jeju (new record)), Russia (Far East).</p></div>	https://treatment.plazi.org/id/F26F8B8D1E08506ABFD68CDD4185F396	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Kim, Moo-Sung;Kim, Il-Kwon;Sharkey, Michael;Kang, Ilgoo	Kim, Moo-Sung, Kim, Il-Kwon, Sharkey, Michael, Kang, Ilgoo (2025): New host record of Doggerella chasanica (Hymenoptera, Braconidae, Braconinae) as a larval parasitoid of the serious forest pest Monochamus alternatus (Coleoptera, Cerambycidae) in Korea. Journal of Hymenoptera Research 98: 545-558, DOI: 10.3897/jhr.98.151974
781AB29056555274A2DFE5A131CFA58F.text	781AB29056555274A2DFE5A131CFA58F.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Doggerella (Lelejobracon) Samartsev 2016	<div><p>Subgenus Lelejobracon Samartsev, 2016</p><p>Doggerella (Lelejobracon) chasanica in Samartsev, 2016: 124.</p><p>Type species.</p><p>Bracon chasanicus Tobias, 2000 .</p></div>	https://treatment.plazi.org/id/781AB29056555274A2DFE5A131CFA58F	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Kim, Moo-Sung;Kim, Il-Kwon;Sharkey, Michael;Kang, Ilgoo	Kim, Moo-Sung, Kim, Il-Kwon, Sharkey, Michael, Kang, Ilgoo (2025): New host record of Doggerella chasanica (Hymenoptera, Braconidae, Braconinae) as a larval parasitoid of the serious forest pest Monochamus alternatus (Coleoptera, Cerambycidae) in Korea. Journal of Hymenoptera Research 98: 545-558, DOI: 10.3897/jhr.98.151974
7FF57E8F807A5EEBAD19BC0602081913.text	7FF57E8F807A5EEBAD19BC0602081913.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Doggerella Quicke, Mahmood & Papp 2011	<div><p>Genus Doggerella Quicke, Mahmood &amp; Papp, 2011</p><p>Doggerella Quicke, Mahmood &amp; Papp, 2011: 2.</p><p>Type species.</p><p>Doggerella turneri Mahmood, Quicke &amp; Papp, 2011 .</p></div>	https://treatment.plazi.org/id/7FF57E8F807A5EEBAD19BC0602081913	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Kim, Moo-Sung;Kim, Il-Kwon;Sharkey, Michael;Kang, Ilgoo	Kim, Moo-Sung, Kim, Il-Kwon, Sharkey, Michael, Kang, Ilgoo (2025): New host record of Doggerella chasanica (Hymenoptera, Braconidae, Braconinae) as a larval parasitoid of the serious forest pest Monochamus alternatus (Coleoptera, Cerambycidae) in Korea. Journal of Hymenoptera Research 98: 545-558, DOI: 10.3897/jhr.98.151974
