taxonID	type	description	language	source
7464474AF211ED700EF646A8FB140A6F.taxon	description	Thirty branches of Glyptostrobus pensilis and thirty plants each of Coffea arabica and Passiflora edulis, all with two to five feeding holes in the stems, were harvested in Ea Ho ward, Krong Nang district and Ea Ral ward, Ea H’Leo district, Dak Lak province in February 2024. Stems with holes were cut into 0.8 m lengths, placed inside cardboard boxes, and transported to the Forest Protection Research Centre (FPRC) in Hanoi, Vietnam where the stems were cut open and the Zeuzera larvae removed. The larvae were reared in a laboratory (28.0 oC ± 0.2; 75.0 % ± 0.3 RH) and fed with compound diets comprising food plant material until pupation. To prepare the food material, stems (2 – 3 cm diameter, 50 cm length) of 3 - year-old G. pensilis, C. arabica and P. edulis plants were collected from Dak Lak province and the fresh stems were ground (Makita LS 1030 N) into powders. The diet composition was modified from diets developed by Wu et al. (2017) and Pham et al. (2023). Each kg of the 3 artificial diets contained 241.6 g plant powder, 48.4 g agar, 64.4 g glucose, 16.2 g cellulose, 40.2 g yeast extract, 96.6 g rye flour, 6.4 g sodium benzoate, 3.2 g sorbic acid, and 483 ml distilled water. The mixtures were placed in 1.5 L pots, mixed with a magnetic stirrer on a hot plate for 3 minutes, and partitioned into 50 ml round-bottomed polypropylene bottles, which were capped with silicon stoppers. Ten holes (0.5 mm in diameter) were made in the cap surface to allow the exchange of air during laboratory rearing. The containers were autoclaved at 121 oC, 15 PSI for 20 minutes and allowed to cool before use. One larva was added to each bottle. Identification Characterization and identification of 30 adult specimens was based on keys in Arora (1976) and Yakovlev (2014), and the specimens were deposited in the insect collection of the FPRC, Hanoi, Vietnam. To confirm the identification, the mitochondrial cytochrome oxidase 1 gene region was sequenced using mtDNA extracted from the legs of three adult specimens FPRC 151 (from G. pensilis), FPRC 154 (from C. arabica), and FPRC 155 (from P. edulis) collected in Dak Lak province. The primers COI-LEP-F (ATTCAACCAATCATAAAGATATTGG) and COI-LEP-R (TAAACTTCTGGATGTCCAAAAAATCA) (Hajibabaei et al. 2006) were used. Protocols were performed as described by Zahiri et al. (2010), Sutrisno (2015) and Yakovlev et al. (2020). A phylogram was obtained using the Maximum Likelihood method (Kumar et al. 2016).	en	Thanh, Giang Thi, Trung, Luu The, Cam, Ngo Van, Kien, Nguyen Duc, Chi, Nguyen Minh (2024): Zeuzera multistrigata Moore (Lepidoptera: Cossidae) damaging three new host plants in Vietnam. Ecologica Montenegrina 77: 200-210, DOI: 10.37828/em.2024.77.20, URL: https://doi.org/10.37828/em.2024.77.20
7464474AF213ED7B0EF64369FC93097E.taxon	description	Zeuzera multistrigata damage in C. arabica and P. edulis was similar to G. pensilis. The attacked plants were in decline and had broken stems (Figs. 4 a, b). Many frasses were readily visible at the base of affected plants (Fig. 4 e). The holes (Figs. 4 c, d), and larval tunnels (Figs. 4 c, f) were similar to those described earlier in G. pensilis. The damage incidence (P %) and the average damage index (DI) of Z. multistrigata in C. arabica and P. edulis are given in Table 2. Mostly 1 - year-old C. arabica and P. edulis stands were attacked, and the damage incidence was low, only 13.8 % and 14.5 %, respectively. In C. arabica, P % declined from 13.8 % in 1 - year-old stands to 3.1 % in 6 - year-old stands.	en	Thanh, Giang Thi, Trung, Luu The, Cam, Ngo Van, Kien, Nguyen Duc, Chi, Nguyen Minh (2024): Zeuzera multistrigata Moore (Lepidoptera: Cossidae) damaging three new host plants in Vietnam. Ecologica Montenegrina 77: 200-210, DOI: 10.37828/em.2024.77.20, URL: https://doi.org/10.37828/em.2024.77.20
7464474AF213ED7B0EF64369FC93097E.taxon	discussion	Discussion This is the first report of Zeuzera multistrigata (Moore, 1881) damage in Glyptostrobus pensilis, Coffea arabica and Passiflora edulis, of which G. pensilis plantations were the most seriously affected. Zeuzera multistrigata is a widespread insect, being recorded in Bangladesh, China, India, Myanmar, Nepal, Pakistan, Sri Lanka, Taiwan, Thailand and Vietnam (Arora 1976; Yakovlev 2012; Ahmad et al. 2023). The morphological characteristics of the adult males and females in this study are in agreement with previous descriptions by Bhardwaj (1982), Jinshui et al. (1988), Baruah and Saikia (2020) and Chi et al. (2022 a) for Z. multistrigata. With the three new host plants recorded in this study combined with previous studies, it is evident that Z. multistrigata is a polyphagous pest (Arora 1976; Ulenberg et al. 1986; Robinson et al. 2001; Yakovlev 2012). The number of hosts was 13 in 2012 (Yakovlev 2012) and this has increased to 28 in recent studies (Table 3). It has been recorded as a serious pest of Prunus spp. (Bhardwaj 1982), Casuarina equisetifilia (Jinshui et al. 1988), Persea bombycina, Litsaea polyantha (Baruah and Saikia 2020), and Eucalyptus spp. (Chi et al. 2022 a). Eggs of Z. multistrigata in this study (0.6 ‒ 0.8 mm long) are smaller than that in Eucalyptus plantations (1.1 ‒ 1.3 mm) in Northern Vietnam (Chi et al. 2022 a). The larvae of Z. multistrigata in Eucalyptus is yellow (Chi et al. 2022 a), but in this study they are pink. Whether the host diet affects larval pigmentation remains to be determined. The primer pair COI-LEP-F / COI-LEP-R has been used for identification of some Zeuzera species (Sutrisno 2015; Yakovlev et al. 2020). The ten species of Zeuzera that have been analyzed with the mitochondrial cytochrome oxidase 1 gene region fall into five clades, of which Polyphagozerra coffeae (= Z. coffeae) (Nietner, 1861) and Zeuzera queita (Turner, 1932) belong to a separate clade (Sutrisno 2015). In our study, FRPC 151 (PP 893044) collected from G. pensilis, FRPC 154 (PP 893045) collected from C. arabica and FRPC 155 (PP 893046) collected from P. edulis clustered into one sub-group with 99.98 ‒ 100 % similarity. The separation from MF 491642 highlights the need in future studies to use more specimens from across the geographic region to determine species boundaries. Polyphagozerra coffeae is a pest of robusta coffee plantations (Lan and Wintgens 2009; Van et al. 2015), but there is no previous record of Zeuzera stem borer on C. arabica. Because G. pensilis is very susceptible to damage from Zeuzera stem borers, the pest may have spread from plantations to adjacent C. arabica and P. edulis farms. This finding showed that G. pensili s may be a preferred host plant of Z. multistrigata, similar to a Eucalyptus hybrid (clone DH 32 - 29) in Northern Vietnam (Chi et al. 2022 a). As there were incomplete age cohorts for 2 to 9 - year-old stands in G. pensilis plantations across different locations, the survey results were insufficient to determine whether tree tolerance alters with age. However, the older C. robusta stands were less susceptible to this stem borer than young stands. Thangavelu and Isa (1992) and Chi et al. (2022 a) also found Z. multistrigata prefers young trees. Whether older trees are more resilient to attack than younger trees remains to be determined. multistrigata in C. equisetifolia trees, respectively. In addition, spraying B. bassiana or Metarhizium anisopliae into N. conferta borer holes in Melaleuca leucadendra was partly successful (59.6 ‒ 63.3 % mortality) in Vietnam (Chi et al. 2022 b). The integrated pest management protocols developed for Hypsipyla robusta in C. tabularis plantations (Chi et al. 2023 a) and P. coffeae (= Z. coffeae) in walnut trees (Ahmad 2017) provide a basis for exploring management options for Z. multistrigata for these three new hosts. Acknowledgements This work was supported by the Vietnam Ministry of Sciences and Technology, for financial support of this study, under grant NVQG- 2021 / ĐT. 12. The authors would like to thank Professor Roman Yakovlev for his confirmation of the pest, and Professor Bernard Dell for discussion and English language editing. Conflict of interest On behalf of the authors, there are no conflicts of interest.	en	Thanh, Giang Thi, Trung, Luu The, Cam, Ngo Van, Kien, Nguyen Duc, Chi, Nguyen Minh (2024): Zeuzera multistrigata Moore (Lepidoptera: Cossidae) damaging three new host plants in Vietnam. Ecologica Montenegrina 77: 200-210, DOI: 10.37828/em.2024.77.20, URL: https://doi.org/10.37828/em.2024.77.20
