identifier	taxonID	type	CVterm	format	language	title	description	additionalInformationURL	UsageTerms	rights	Owner	contributor	creator	bibliographicCitation
7464474AF211ED700EF646A8FB140A6F.text	7464474AF211ED700EF646A8FB140A6F.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Zeuzera Latreille 1804	<html xmlns:mods="http://www.loc.gov/mods/v3">
    <body>
        <div>
            <p> Collection of  Zeuzera larvae from the field and laboratory rearing </p>
            <p> Thirty branches of  Glyptostrobus pensilis and thirty plants each of  Coffea arabica and  Passiflora edulis , all with two to five feeding holes in the stems, were harvested in Ea Ho ward, Krong Nang district and Ea Ral ward, Ea H’Leo district, Dak Lak province in February 2024. Stems with holes were cut into 0.8 m lengths, placed inside cardboard boxes, and transported to the Forest Protection Research Centre (FPRC) in Hanoi, Vietnam where the stems were cut open and the  Zeuzera larvae removed. The larvae were reared in a laboratory (28.0 oC ± 0.2; 75.0% ± 0.3 RH) and fed with compound diets comprising food plant material until pupation. </p>
            <p> To prepare the food material, stems (2–3 cm diameter, 50 cm length) of 3-year-old  G. pensilis ,  C. arabica and  P. edulis plants were collected from Dak Lak province and the fresh stems were ground (Makita LS1030N) into powders. The diet composition was modified from diets developed by Wu et al. (2017) and Pham et al. (2023). Each kg of the 3 artificial diets contained 241.6 g plant powder, 48.4 g agar, 64.4 g glucose, 16.2 g cellulose, 40.2 g yeast extract, 96.6 g rye flour, 6.4 g sodium benzoate, 3.2 g sorbic acid, and 483 ml distilled water. The mixtures were placed in 1.5 L pots, mixed with a magnetic stirrer on a hot plate for 3 minutes, and partitioned into 50 ml round-bottomed polypropylene bottles, which were capped with silicon stoppers. Ten holes (0.5 mm in diameter) were made in the cap surface to allow the exchange of air during laboratory rearing. The containers were autoclaved at 121 oC, 15 PSI for 20 minutes and allowed to cool before use. One larva was added to each bottle. </p>
            <p>Identification</p>
            <p>Characterization and identification of 30 adult specimens was based on keys in Arora (1976) and Yakovlev (2014), and the specimens were deposited in the insect collection of the FPRC, Hanoi, Vietnam.</p>
            <p> To confirm the identification, the mitochondrial cytochrome oxidase 1 gene region was sequenced using mtDNA extracted from the legs of three adult specimens FPRC151 (from  G. pensilis ), FPRC154 (from  C. arabica ), and FPRC155 (from  P. edulis ) collected in Dak Lak province. The primers COI-LEP-F (ATTCAACCAATCATAAAGATATTGG) and COI-LEP-R (TAAACTTCTGGATGTCCAAAAAATCA) (Hajibabaei et al. 2006) were used. Protocols were performed as described by Zahiri et al. (2010), Sutrisno (2015) and Yakovlev et al. (2020). A phylogram was obtained using the Maximum Likelihood method (Kumar et al. 2016). </p>
        </div>
    </body>
</html>
	https://treatment.plazi.org/id/7464474AF211ED700EF646A8FB140A6F	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Thanh, Giang Thi;Trung, Luu The;Cam, Ngo Van;Kien, Nguyen Duc;Chi, Nguyen Minh	Thanh, Giang Thi, Trung, Luu The, Cam, Ngo Van, Kien, Nguyen Duc, Chi, Nguyen Minh (2024): Zeuzera multistrigata Moore (Lepidoptera: Cossidae) damaging three new host plants in Vietnam. Ecologica Montenegrina 77: 200-210, DOI: 10.37828/em.2024.77.20, URL: https://doi.org/10.37828/em.2024.77.20
7464474AF213ED7B0EF64369FC93097E.text	7464474AF213ED7B0EF64369FC93097E.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Zeuzera multistrigata Moore 1881	<html xmlns:mods="http://www.loc.gov/mods/v3">
    <body>
        <div>
            <p> Zeuzera multistrigata damage in  Glyptostrobus pensilis ,  Coffea arabica and  Passiflora edulis</p>
            <p> In  G. pensilis plantations, stem borer attacks were more prevalent in 9-year-old than 2-year-old trees resulting in damage incidences of 94.1% and 44.1%, respectively (Table 2). In general, all trees attacked by  Z. multistrigata were declining in health and vigor, and many had broken stems (Fig. 3). The bore holes were circular with a dimeter of 0.6‒0.9 cm (Fig. 3f), and were located 0.6‒5.0 m above the ground. The larval tunnels were circular in cross-section, 0.7‒0.9 cm in diameter (Figs. 3c, f), 25‒45 cm in length (Figs. 3d, f), and they extended throughout the wood. Before pupation, the larvae often excavated long tunnels that circled the trunk, and consequently damaged trees were easily broken during strong winds (Figs. 3a, b, e). </p>
            <p> Zeuzera multistrigata damage in  C. arabica and  P. edulis was similar to  G. pensilis . The attacked plants were in decline and had broken stems (Figs. 4a, b). Many frasses were readily visible at the base of affected plants (Fig. 4e). The holes (Figs. 4c, d), and larval tunnels (Figs. 4c, f) were similar to those described earlier in  G. pensilis . </p>
            <p> The damage incidence (P%) and the average damage index (DI) of  Z. multistrigata in  C. arabica and  P. edulis are given in Table 2. Mostly 1-year-old  C. arabica and  P. edulis stands were attacked, and the damage incidence was low, only 13.8% and 14.5%, respectively. In  C. arabica , P% declined from 13.8% in 1-year-old stands to 3.1% in 6-year-old stands. </p>
            <p>Note: NA. Not available.</p>
            <p>Discussion</p>
            <p> This is the first report of  Zeuzera multistrigata (Moore, 1881) damage in  Glyptostrobus pensilis ,  Coffea arabica and  Passiflora edulis , of which  G. pensilis plantations were the most seriously affected.  Zeuzera multistrigata is a widespread insect, being recorded in Bangladesh, China, India, Myanmar, Nepal, Pakistan, Sri Lanka, Taiwan, Thailand and Vietnam (Arora 1976; Yakovlev 2012; Ahmad et al. 2023). The morphological characteristics of the adult males and females in this study are in agreement with previous descriptions by Bhardwaj (1982), Jinshui et al. (1988), Baruah and Saikia (2020) and Chi et al. (2022a) for  Z. multistrigata . With the three new host plants recorded in this study combined with previous studies, it is evident that  Z. multistrigata is a polyphagous pest (Arora 1976; Ulenberg et al. 1986; Robinson et al. 2001; Yakovlev 2012). The number of hosts was 13 in 2012 (Yakovlev 2012) and this has increased to 28 in recent studies (Table 3). It has been recorded as a serious pest of  Prunus spp. (Bhardwaj 1982),  Casuarina equisetifilia (Jinshui et al. 1988) ,  Persea bombycina ,  Litsaea polyantha (Baruah and Saikia 2020) , and  Eucalyptus spp. (Chi et al. 2022a). Eggs of  Z. multistrigata in this study (0.6‒0.8 mm long) are smaller than that in  Eucalyptus plantations (1.1‒1.3 mm) in Northern Vietnam (Chi et al. 2022a). The larvae of  Z. multistrigata in  Eucalyptus is yellow (Chi et al. 2022a), but in this study they are pink. Whether the host diet affects larval pigmentation remains to be determined. </p>
            <p> The primer pair COI-LEP-F/COI-LEP-R has been used for identification of some  Zeuzera species (Sutrisno 2015; Yakovlev et al. 2020). The ten species of  Zeuzera that have been analyzed with the mitochondrial cytochrome oxidase 1 gene region fall into five clades, of which  Polyphagozerra coffeae (=  Z. coffeae ) (Nietner, 1861) and  Zeuzera queita (Turner, 1932) belong to a separate clade (Sutrisno 2015). In our study, FRPC151 (PP893044) collected from  G. pensilis, FRPC 154 (PP893045) collected from  C. arabica and FRPC155 (PP893046) collected from  P. edulis clustered into one sub-group with 99.98‒100% similarity. The separation from MF491642 highlights the need in future studies to use more specimens from across the geographic region to determine species boundaries. </p>
            <p> Polyphagozerra coffeae is a pest of robusta coffee plantations (Lan and Wintgens 2009; Van et al. 2015), but there is no previous record of  Zeuzera stem borer on  C. arabica . Because  G. pensilis is very susceptible to damage from  Zeuzera stem borers, the pest may have spread from plantations to adjacent  C. arabica and  P. edulis farms. This finding showed that  G. pensili s may be a preferred host plant of  Z. multistrigata , similar to a  Eucalyptus hybrid (clone DH32-29) in Northern Vietnam (Chi et al. 2022a). As there were incomplete age cohorts for 2 to 9-year-old stands in  G. pensilis plantations across different locations, the survey results were insufficient to determine whether tree tolerance alters with age. However, the older  C. robusta stands were less susceptible to this stem borer than young stands. Thangavelu and Isa (1992) and Chi et al. (2022a) also found  Z. multistrigata prefers young trees. Whether older trees are more resilient to attack than younger trees remains to be determined. </p>
            <p> multistrigata in  C. equisetifolia trees, respectively. In addition, spraying  B. bassiana or  Metarhizium anisopliae into  N. conferta borer holes in  Melaleuca leucadendra was partly successful (59.6‒63.3% mortality) in Vietnam (Chi et al. 2022b). The integrated pest management protocols developed for  Hypsipyla robusta in  C. tabularis plantations (Chi et al. 2023a) and  P. coffeae (=  Z. coffeae ) in walnut trees (Ahmad 2017) provide a basis for exploring management options for  Z. multistrigata for these three new hosts. </p>
            <p>Acknowledgements</p>
            <p>This work was supported by the Vietnam Ministry of Sciences and Technology, for financial support of this study, under grant NVQG-2021/ĐT.12. The authors would like to thank Professor Roman Yakovlev for his confirmation of the pest, and Professor Bernard Dell for discussion and English language editing.</p>
            <p>Conflict of interest On behalf of the authors, there are no conflicts of interest.</p>
            <p>References</p>
            <p>Ahmad, I. (2017) Integrated pest management of Zeuzera coffeae Nietner: An efficient approach to reduce the infestation of walnut trees. Pakistan Journal of Zoology, 49 (2), 693‒698.</p>
            <p>https://doi.org/10.17582/journal.pjz/2017.49.2.693.698</p>
            <p>Ahmad, J., Joshi, R., Singh, N. (2023) An updated catalogue of Cossoidea (Lepidoptera) from India. Zootaxa, 5330 (3), 301‒348. https://doi.org/10.11646/zootaxa.5330.3.1</p>
            <p>Arora, G.S. (1976) A taxonomic revision of the Indian species of the family Cossidae (Lepidoptera). Records of the zoological Survey of India, 69, 1‒160.</p>
            <p>https://doi.org/10.26515/rzsi/v69/i1-4/1971/161406</p>
            <p>Averyanov, L.V., Phan, K.L., Nguyen, T.H., Nguyen, S.K., Nguyen, T.V., Pham, T.D. (2009) Preliminary observation of native Glyptostrobus pensilis (Taxodiaceae) stands in Vietnam. Taiwania, 54 (3), 191‒212.</p>
            <p>Baruah, J.P., Saikia, J. (2020) Stem borer infestation on muga silkworm (Antheraea assamensis) host plants on som (Persea bombycina) and soalu (Litsea polyantha): A review. Indian Journal of Pure &amp; Applied Biosciences, 8 (5), 73‒77. https://doi.org/10.18782/2582-2845.8265</p>
            <p>Bhardwaj, S.P. (1982) Note on a new record of leopard moth, Zeuzera multistrigata Moore (Lepidoptera: Cossidae), on cherry. Indian Journal of Agricultural Sciences, 52 (12), 881‒882.</p>
            <p>Chi, N.M., Bao, H.Q., Pham, D.L., Loi, V.V., Yakovlev, R.V. (2022 a) The stem borer Zeuzera multistrigata Moore (Lepidoptera, Cossidae): a serious pest undermining Eucalyptus plantations in Northern Vietnam. Ecologica Montenegrina, 60, 4‒12.</p>
            <p>https://doi.org/10.37828/em.2022.60.2</p>
            <p>Chi, N.M., Huong, V.D., Pham, D.L., Binh, L.V., Luu, N.V., Ha, K.M., Loi, V.V., Yakovlev, R.V. (2022 b) Neurozerra conferta (Lepidoptera: Cossidae) damaging Melaleuca plantations in Vietnam and its biological control. Ecologica Montenegrina, 60, 13‒24.</p>
            <p>https://doi.org/10.37828/em.2022.60.3</p>
            <p>Chi, N.M., Pham, D.L., Nhung, N.P., Hoa, N.T.H.H., Do, T.T., Tra, T.T.L., Loi, V.V., Thuy, P.T.T., Hai, N.D., Tuan, D.X., Thu, P.Q., Dell, B. (2023 a) Integrated pest management of Hypsipyla robusta shoottip borer (Lepidoptera: Pyralidae) in Chukrasia tabularis (Sapindales: Meliaceae). Journal of Economic Entomology, 116 (2), 486‒495. https://doi.org/10.1093/jee/toad033</p>
            <p>Chi, N.M., Thanh, N.V., Quang, D.N., Thanh, L.B., Thao, D.V., Son, L.T., Hinh, T.X., Thu, P.Q., Dell, B. (2021) First report of Tapinolachnus lacordairei (Coleoptera: Cerambycidae) damage in Chukrasia tabularis. International Journal of Tropical Insect Science, 41 (1), 909‒914.</p>
            <p>https://doi.org/10.1007/s42690-020-00260-2</p>
            <p>Chi, N.M., Yakovlev, R.V., Huong, D.T., Pham, D.L., Tam, T.T.T., Long, B.D., Luc, N.N., Dell, B. (2023 b) Stem borer Orientozeuzera rhabdota (Lepidoptera, Cossidae) damaging Manglietia conifera and Michelia mediocris trees in Vietnam. Ecologica Montenegrina, 63, 86‒95.</p>
            <p>https://doi.org/10.37828/em.2023.63.8</p>
            <p>Duy, V.D., Xuan, B.T.T., Trang, H.T.T., Tam, N.M., Van, S.N. (2014) Conservation genetic of critically endangered conifer species (Glyptostrobus pensilis (Staun) K.Koch) in Vietnam. Vietnam Journal of Biotechnology, 12 (1), 63‒72.</p>
            <p>Fekrat, L., Farashi, A. (2022) Impacts of climatic changes on the worldwide potential geographical dispersal range of the leopard moth, Zeuzera pyrina (L.) (Lepidoptera: Cossidae). Global Ecology and Conservation, 34, e02050. https://doi.org/10.1016/j.gecco.2022.e02050</p>
            <p>Hajibabaei, M., Janzen, D.H., Burns, J.M., Hallwachs, W., Hebert, P.D.N. (2006) DNA barcodes distinguish species of tropical Lepidoptera. Proceedings of the National Academy of Sciences, 103 (4), 968‒971. https://doi.org/10.1073/pnas.0510466103</p>
            <p>Hegazi, E., Schlyter, F., Khafagi, W., Atwa, A., Agamy, E., Konstantopoulou, M. (2015) Population dynamics and economic losses caused by Zeuzera pyrina, a cryptic wood‐borer moth, in an olive orchard in Egypt. Agricultural Forest Entomology, 17 (1), 9‒19.</p>
            <p>https://doi.org/10.1111/afe.12075</p>
            <p>Huang, J.S., Lin, Q.Y. (1990) Usb op a new paste preparation of Beauveria bassiana in the forest to control Zeuzera multistrigata [lep.: Cossidae]. Chinese Journal of Biological Control, 6 (3), 121‒123.</p>
            <p>Jinshui, H., Yuanhui, H., Yiliang, H. (1988) A study on the moth borer (Zeuzera multistrigata Moore) (Lepidoptera: Zeuzeridae). Forest Research, 1 (5), 516‒523.</p>
            <p>Kumar, A., Singh, C.P., Khulbe, P. (2009) Biology and morphometrics of Epilachna Vigintioctopunctata (Fabricius) on Withania somnifera L. Indian Journal of Entomology, 71 (1), 88‒103.</p>
            <p>Kumar, S., Stecher, G., Tamura, K. (2016) MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Molecular Biology and Evolution, 33 (7), 1870‒1874.</p>
            <p>https://doi.org/10.1093/molbev/msw054</p>
            <p>Kutinkova, H., Andreev, R., Arnaoudov, V. (2006) The leopard moth borer, Zeuzera pyrina L. (Lepidoptera: Cossidae) - important pest in Bulgaria. Journal of Plant Protection Research, 46 (2), 111‒115.</p>
            <p>Lan, C.C., Wintgens, J.N. (2009) Coffee: growing, processing, sustainable production. A guidebook for growers, processors, traders and researchers. In: Wintgens J.N. (ed) Major pests of coffee in the Asia-Pacific region. Wiley-VCH, Weinheim, Germanypp 463‒477.</p>
            <p>Li, F., Xia, N. (2004) The geographical distribution and cause of threat to Glyptostrobus pensilis (Taxodiaceae). Journal of Tropical Subtropical Botany, 12 (1), 13‒20.</p>
            <p>Mahendiran, G., Lal, S., Sharma, O.C. (2022) Pests and their management on temperate fruits. In: Mani M. (ed) Trends in horticultural entomology. Springer Nature Singapore, Singaporepp 891‒941.</p>
            <p>https://doi.org/10.1007/978-981-19-0343-4_36</p>
            <p>McPartland, J.M. (1996) Cannabis pests. Journal of the International Hemp Association, 3 (2), 49‒52.</p>
            <p>Pham, D.L., Chi, N.M., Van Loi, V., Danh, D.N., Vui, N.T.K., Hung, P.T., Ha, N.L., Vitali, F. (2023) Longhorn beetles as new pests for exotic plantations in Vietnam. Ecologica Montenegrina, 70, 188‒198. https://doi.org/0.37828/em.2023.70.20</p>
            <p>Robinson, G.S., Ackery, P.R., Kitching, I.J., Beccaloni, G.W., Hernández, L.M. (2001) Hostplants of the moth and butterfly caterpillars of the Oriental Region. Kuala-Lumpur. 744 p.</p>
            <p>Salari, E., Karimi, J., Fasihi Harandi, M., Sadeghi Nameghi, H. (2021) Comparative infectivity and biocontrol potential of Acrobeloides k29 and entomopathogenic nematodes on the leopard moth borer, Zeuzera pyrina. Biological Control, 155, 104526.</p>
            <p>https://doi.org/10.1016/j.biocontrol.2020.104526</p>
            <p>Sundararaj, R., Wilson, J.J., Vimala, D. (2019) Stem borers of Indian sandalwood (Santalum album Linn.) in Karnataka, India. Journal of the Indian Academy of Wood Science, 16 (1), 31‒35.</p>
            <p>https://doi.org/10.1007/s13196-019-00232-1</p>
            <p>Sutrisno, H. (2015) Molecular phylogeny of Indonesian Zeuzera (Lepidoptera: Cossidae) wood borer moths based on COI gene sequence. Journal of Species Research, 4 (1), 49‒56.</p>
            <p>https://doi.org/10.12651/JSR.2015.4.1.049</p>
            <p>Tam, N.M., Duy, V.D., Xuan, B.T.T., Duc, N.M. (2013) Genetic variation and population structure in Chinese water pine (Glyptostrobus pensilis): A threatened species. Indian Journal of Biotechnology, 12, 499‒503.</p>
            <p>Thangavelu, K., Isa, M. (1992) Zeuzera multistrigata Moore, a pest of muga silkworm host trees. Indian Journal of Sericulture, 31, 157.</p>
            <p>Thu, P.Q., Griffiths, M.W., Pegg, G.S., McDonald, J., Wylie, F.R., King, J., Lawson, S.A. (2010) Healthy plantations. A field guide to pests and pathogens of Acacia, Eucalyptus and Pinus in Vietnam. Department of Employment, Economic Development and Innovation, Queensland, Australia.</p>
            <p>Thu, P.T.T. (2014) Wood anatomy of Glyptostrobus pensilis. Journal of Forestry Science and Technology, 4, 118‒120.</p>
            <p>Ulenberg, S.A., Burger, H.C., Frankenhuyzen, A.V., Goffau, L.J.W., Vierbergen, C. (1986) Entomologie - Inventarisaitie van insekten en mijten. Verslagen en mededelingen. Plantenziektenkundige Dienst Netherlands. p. 25–46.</p>
            <p>Van, N.V., Quy, T.D., Khanh, L.D., Khai, L.Q., Thuy, N.T., Toan, T.T. (2015) Underlying reasons causing degeneration and shortening the economic cycle of coffee plantations in the Central Highlands. Vietnam Journal of Science, Technology and Engineering, 57 (9), 10‒16.</p>
            <p>Varma, R.V., Sajeev, T.V., Sudheendrakumar, V.V. (2007) Pest susceptibility of Tectona grandis under intensive management practices in india. Journal of Tropical Forest Science, 19 (1), 46‒49.</p>
            <p>Wu, S., Xia, F., Zhang, F. (2017) An artificial feed for the young larvae of Monochamus altematus and preparation method. China Patent CN201710324582.2.</p>
            <p>Yakovlev, R.V. (2012) Trophic relations of old world carpenter-moths (Lepidoptera, Cossidae). Euroasian Entomological Journal, 11 (2), 189‒194.</p>
            <p>Yakovlev, R.V. (2014) Descriptions of three new species of Cossidae (Lepidoptera) from Vietnam, with an updated annotated checklist. Zootaxa, 3802 (2), 240‒256.</p>
            <p>https://doi.org/10.11646/zootaxa.3802.2.6</p>
            <p>Yakovlev, R.V., Shapoval, N.A., Ivonin, V.V., Knyazev, S.A., Kuftina, G.N., Masharskiy, A.E. (2020) A new species of carpenter moths (Lepidoptera, Cossidae) from Tarbagatai (NE Kazakhstan) and Altai (SW Siberia, Russia) Mountains. Zootaxa, 4896 (1), 85‒95.</p>
            <p>https://doi.org/10.11646/zootaxa.4896.1.3</p>
            <p>Yang, H.W., Zhang, S.G., Zhang, G.Y., Huang, J.S., Zheng, H.C. (1990) Control of leopard moth, Zeuzera multistrigata leuconota (Lep.: Cossidae) on casuarina trees by using sponge plugs carrying Steinernema feltiae. Chinese Journal of Biological Control, 6 (4), 157‒160.</p>
            <p>Zahiri, R., Kitching, I.J., Lafontaine, J.D., Mutanen, M., Kaila, L., Holloway, J.D., Wahlberg, N. (2010) A new molecular phylogeny offers hope for a stable family level classification of the Noctuoidea (Lepidoptera). Zoologica Scripta, 40 (2), 158‒173.</p>
            <p>https://doi.org/10.1111/j.1463-6409.2010.00459.x</p>
        </div>
    </body>
</html>
	https://treatment.plazi.org/id/7464474AF213ED7B0EF64369FC93097E	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Thanh, Giang Thi;Trung, Luu The;Cam, Ngo Van;Kien, Nguyen Duc;Chi, Nguyen Minh	Thanh, Giang Thi, Trung, Luu The, Cam, Ngo Van, Kien, Nguyen Duc, Chi, Nguyen Minh (2024): Zeuzera multistrigata Moore (Lepidoptera: Cossidae) damaging three new host plants in Vietnam. Ecologica Montenegrina 77: 200-210, DOI: 10.37828/em.2024.77.20, URL: https://doi.org/10.37828/em.2024.77.20
