identifier	taxonID	type	CVterm	format	language	title	description	additionalInformationURL	UsageTerms	rights	Owner	contributor	creator	bibliographicCitation
421169606031B338FF7B27455AE4BB17.text	421169606031B338FF7B27455AE4BB17.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Chlosyne palla subsp. sterope (W. H. Edwards 1870)	<div><p>Chlosyne palla sterope (W. H. Edwards, 1870) and Chlosyne flavula blackmorei Pelham, 2008: illustrations of selected sequenced specimens</p><p>Here, we compile photographs of several specimens of both sexes that were included in the phylogenetic tree published as fig. 2 in Zhang et al. (2025a) to illustrate phenotypic variation and interspecies differences in the northernmost populations of the two species: Chlosyne palla (Boisduval, 1852) (type locality in USA: California, Plumas Co.) and Chlosyne flavula (W. Barnes &amp; McDunnough, 1918) (type locality USA: Colorado, Garfield Co., Glenwood Springs) (Zhang et al. 2023c, 2025a), specifically, Chlosyne palla sterope (W. H. Edwards, 1870) (type locality in USA: Oregon, Wasco Co.) and Chlosyne flavula blackmorei Pelham, 2008 (type locality Canada: British Columbia, Lytton) (Fig. 1). The two species are best differentiated by females: C. palla sterope is typically darker with cream-colored to nearly white spots and bands and usually a more elongated forewing apex; and C. flavula blackmorei has orange and orange-yellow spots and bands and a rounder forewing apex.</p><p>We were not able to find consistent wing pattern differences between the northern populations of C. palla sterope (Canada: British Columbia, Osoyoos and USA: Washington, Okanogan Co.) and its more southern populations (USA: Washington, Adams Co. and Oregon, Wasco Co.), with some specimens being rather similar (e.g., compare Fig. 1d with Fig. 1l or Fig. 1m for males, and Fig. 1g with Fig. 1q for females). Females are particularly alike. However, males from the northern populations are more variable, with some being more extensively orange (e.g., Fig. 1j) than typical C. palla sterope, or exhibiting cream-colored (rather than orange-yellow) discal bands (Fig. 1o). Genetically, all these specimens cluster together, forming a nuclear genome clade that also includes the lectotype of C. palla sterope (sequenced as NVG-21011C11 and used to assign this name to the clade), but partition into the northern and southern subclades; see fig. 2 in Zhang et al. (2025a).</p></div>	https://treatment.plazi.org/id/421169606031B338FF7B27455AE4BB17	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
421169606031B338FF2522865BDDB944.text	421169606031B338FF2522865BDDB944.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Locris Grishin 2025	<div><p>Lochris Grishin, nom. nov. is a new substitute name to replace Locris Grishin, 2025</p><p>http://zoobank.org/ B13E52B7-663E-4C16-9ADD-D57302A19744</p><p>A subgenus of Lasaia H. Bates, 1868, Locris Grishin, 2025 (type species Lasaia oileus Godman, 1903) is a junior homonym of Locris Stål, 1866 (type species Cercopis rubra Fabricius, 1794), currently a valid genus of froghoppers ( Hemiptera: Cercopidae) (Stål 1866). Here, according to Article 60.3 of the International Code of Zoological Nomenclature (1999), Lochris Grishin is proposed as a new substitute name that replaces Locris Grishin, 2025 . According to the ICZN Code Article 67.8, the type species of Lochris Grishin, nom. nov. is Lasaia oileus Godman, 1903 .</p></div>	https://treatment.plazi.org/id/421169606031B338FF2522865BDDB944	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
421169606031B33DFE2E203C5BB9BE10.text	421169606031B33DFE2E203C5BB9BE10.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Emesis (Mandania) mandarina Zhang & Cong & Shen & Song & Grishin 2025	<div><p>Emesis (Mandania) mandarina Grishin, new species</p><p>http://zoobank.org/ 98452F55-3EB2-4B5A-84B1-4D1C8FF074BE</p><p>(Figs. 2 part, 3)</p><p>Definition and diagnosis. Genomic analysis reveals that several specimens from Santa Catarina, Brazil, initially identified as Emesis (Mandania) mandana (Cramer, 1780) (type locality in Suriname) are genetically differentiated from it at the species level (Fig. 2); e.g., their COI barcodes differ by 0.9% (6 bp, barcodes do not differ strongly in this species group (Zhang et al. 2024, 2025b)), and, therefore, they represent a new species. This new species is similar to its sister E. mandana in having redder colors of the dorsal side in males, but differs from it by a more uniformly colored orange ventral side of the wings without more prominent redder and broader margins and the lack of a defined ventral hindwing spot at the tornus. Males (Fig. 3a, c) have smaller and more weakly expressed submarginal dark dots, betterseparated dark markings in the postdiscal row on the ventral side, and typically darker (maroon-toned) background color of the dorsal side. Females (Fig. 3b) may have a rounder forewing with a more convex outer margin and a less prominently concave hindwing outer margin at the vein M 2, narrower dashes and crescents in the discal band on the dorsal side with a dash in cell M 2 -M 3 being more strongly offset distad and aligned with the dash in cell M 3 -CuA 1, and paler marginal areas on the ventral side. Due to its cryptic nature and unexplored individual variation, this species is best identified by DNA, with diagnostic base pairs in the nuclear genome: cne4739.1.2:C183T, cne339.14.2:A330T, cne339.14.2:C435T, cne37103.1.5: T462A, cne37103.1.5:T468C; and the COI barcode: T367C, A379C, T578C, T610C.</p><p>Barcode sequence of the holotype. Sample NVG-18044E12, GenBank PV892283, 658 base pairs: AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACTTCACTAAGATTATTAATTCGAATAGAATTAGGAACTTCAGGATCATTAATTGGTGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATACTAGGAGCCCCAGATATAGCTTTTCCACGAA TAAATAATATAAGATTTTGACTTTTACCTCCATCTTTAATTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCTTCTAATATTGC TCACGGAGGTTCTTCCGTAGATTTAGCTATTTTTTCTTTACATTTAGCAGGAATTTCCTCAATTTTAGGTGCAATTAACTTTATTACTACTATTATTAATATACGAATTAATAATATATCA TTTGATCAAATACCTTTATTTGTTTGATCTGTAGGAATTACAGCTCTTCTATTATTATTATCTTTACCTGTTTTAGCTGGAGCTATTACTATACTATTAACAGATCGAAATTTAAATACAT CATTCTTTGATCCTGCTGGTGGTGGTGATCCTATTTTATATCAACATTTATTT</p><p>Type material. Holotype: ♂ deposited in the National Museum of Natural History, Washington, DC, USA (USNM), illustrated in Fig. 3a, bears the following eight rectangular labels (1 st handprinted, others printed with handwritten text shown in italics; 4 th blue, 5 th yellow, the last red, others white): [ Joinville | 18·IX·1982], [StaCatharina | Brazil], [Presented by | Robert E. Aronheim], [JHALL | -00 05], [LEGS AWAY | FOR DNA], [DNA sample ID: | NVG-18044E12 | c/o Nick V. Grishin], [USNMENT | {QR Code} | 01466379], and [HOLOTYPE ♂ | Emesis (Mandania) | mandarina Grishin]. Paratypes: 1♂ and 2♀♀ from Brazil, Santa Catarina (last one likely mislabeled): 1♂ NVG-25013H04 Joinville, 4-Mar-1985, H. Miers leg. [MGCL] (Fig. 3c); 1♀ NVG-24032A05 Blumenau, old, coll. Staudinger [MFNB] (Fig. 3b); and 1♀ NVG-24032A12 “ Colombia | R. Magdalena s”, old, ex coll. H. Stichel, number 3280 [MFNB] .</p><p>Type locality. Brazil: Santa Catarina, Joinville .</p><p>Etymology. The name is a fusion given to this relative of mand [ana from Santa Cat] arina, and is treated as a noun in apposition.</p><p>Distribution. Currently known only from Santa Catarina in Brazil.</p></div>	https://treatment.plazi.org/id/421169606031B33DFE2E203C5BB9BE10	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
421169606035B33CFE1326015DF4B91A.text	421169606035B33CFE1326015DF4B91A.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Emesis (Mandania) mandela Grishin	<div><p>Emesis (Mandania) mandela Grishin, new species</p><p>http://zoobank.org/ E971DCB7-6DA1-48D6-BF19-C1E866DE2226 (Figs. 2 part, 4a)</p><p>Definition and diagnosis. Genomic analysis reveals that a specimen from Venezuela (Fig. 4a) is sister to Emesis (Mandania) mantunga Grishin, 2025 (type locality in Ecuador: Tungurahua) (Fig. 4b), but is genetically differentiated at the species level (Fig. 2); e.g., their COI barcodes differ by 1.7% (11 bp, which is large for this species group (Zhang et al. 2024, 2025b)), and, therefore, it represents a new species. This new species differs from its relatives by males with paler wing color, which is rich, reddishorange, similar in tone to burnt orange or rust. The ventral side of wings is yellower with a narrower and more weakly expressed postdiscal band of crescents but a crisper discal band; and the hindwing is more elongated towards the tornus, with a straighter outer margin. Due to its cryptic nature and unexplored individual variation, this species is best identified by DNA, with diagnostic base pairs in the nuclear genome: cne670.2.5:C84T, cne670.2.5:A102T, cne7425.1.3:A90G, cne7425.1.3:C111T, cne5229.9.3:T279A, cne22806.1.1:C183C (not T), cne22806.1.1:G184G (not A), cne22806.1.1:A198A (not T), cne5064.6.3:C75C (not T), cne5064.6.3:T80T (not A); and the COI barcode: T367C, T400C, A412G, T532C.</p><p>Barcode sequence of the holotype. Sample NVG-24033B06, GenBank PV892284, 658 base pairs: AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACTTCACTAAGATTATTAATTCGAATAGAATTAGGAACTTCAGGATCATTAATTGGTGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATACTAGGAGCTCCAGATATAGCTTTTCCACGAA TAAATAATATAAGATTTTGACTTTTACCTCCATCTTTAATTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCTTCTAATATTGC TCACGGAGGTTCTTCCGTAGATTTAGCTATTTTTTCCTTACATTTAGCGGGAATTTCCTCAATTTTAGGTGCAATTAACTTTATTACTACTATTATTAATATACGAATTAATAATATATCA TTTGATCAAATACCTTTATTTGTTTGATCTGTAGGAATTACAGCTCTCCTATTATTATTATCTTTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACAT CATTCTTTGATCCTGCTGGTGGTGGTGATCCTATTTTATATCAACATTTATTT</p><p>Type material. Holotype: ♂ deposited in the Museum für Naturkunde, Berlin, Germany (MFNB), illustrated in Fig. 4a, bears the following five printed rectangular labels (text in italics handwritten), four white: [Pto Cabello | Hahnel], [Coll. | Staudinger], [DNA sample ID: | NVG-24033B06 | c/o Nick V. Grishin], [{QR Code} MfN URI | http://coll.mfn- | berlin.de/u/ | 09f2f9], and one red [HOLOTYPE ♂ | Emesis (Mandania) | mandela Grishin].</p><p>Type locality. Venezuela: Carabobo, Puerto Cabello.</p><p>Etymology. The name is a fusion given to this relative of mand [ana from Venezu] ela, and is treated as a noun in apposition.</p><p>Distribution. Currently known only from the holotype collected in coastal Venezuela.</p><p>Comment. This new species is the third Emesis (Mandania) species we recorded in Venezuela, in addition to Emesis (Mandania) mandana (Cramer, 1780) (type locality in Suriname) and Emesis (Mandania) mandora Grishin, 2024 (type locality in Ecuador: Santo Domingo) (Fig. 2 yellow highlight).</p><p>Additional records of Emesis (Mandania) mantunga Grishin, 2025</p><p>Through expanded genomic sequencing (Fig. 2), we found three more specimens of Emesis (Mandania) mantunga Grishin, 2025 (type locality Ecuador: Tungurahua Province, Topo; originally described from five males), including the first confirmed female (NVG-25013E02, Ecuador: Napo Province, Puerto Misahuallí, 6-Nov-1983, D. &amp; J. Jenkins [MGCL], Fig. 4c), an additional male from eastern Ecuador (NVG-24033A11, Pastaza Province, Sarayacu, old, R. Haensch S., Stichel collection number 3282 [MFNB]), and extend the distribution of this species to the eastern slopes of the Andes in northern Peru (♂ NVG-24033A10, San Martín Department, Tarapoto, old, Stichel collection number 4338 [MFNB]).</p></div>	https://treatment.plazi.org/id/421169606035B33CFE1326015DF4B91A	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
421169606035B331FE9920855CACBB60.text	421169606035B331FE9920855CACBB60.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus (Rhabdoides) alector subsp. obscuratus Zhang & Cong & Shen & Song & Grishin 2025	<div><p>Telegonus (Rhabdoides) alector obscuratus Grishin, new subspecies</p><p>http://zoobank.org/ C615B4FA-4DD4-491D-B7EB-0C54C481D1DF (Figs. 5 part, 6a)</p><p>Definition and diagnosis. Genomic analysis reveals that a male from Costa Rica initially identified as Telegonus (Rhabdoides) gilberti (Freeman, 1969) (type locality in Mexico: San Luis Potosí) is genetically differentiated from it at the species level (Fig. 5); e.g., their COI barcodes differ by 3.3% (22 bp). Instead, according to genomic trees, this male is most closely related to Telegonus (Rhabdoides) alector (C. Felder &amp; R. Felder, 1867) (type locality in Colombia: Bogotá) while phenotypically differing from it by the lack of a white smudge on the dorsal forewing and smaller size (Fig. 6a). This male is not prominently different genetically from the nominate subspecies of T. alector (Fig. 6b). Therefore, due to phenotypic differences from it and Telegonus (Rhabdoides) alector ecuadoricus Grishin, 2025 (type locality in Ecuador: Esmeraldas) (Fig. 6c), this male represents a new subspecies. This new subspecies keys (incompletely) to “ Astraptes alector alector ” C.14.26(b) in Evans (1952), having blue rather than green wing bases, but males lack the white smudge in the discal area of the dorsal forewing. The new subspecies differs from other relatives by the following combination of characters in males: the dorsal side of wings is dark-brown with brilliant-blue (not green) bases and only a very weak trace (absent in T. gilberti) of the discal forewing pale smudge in the cell CuA 1 -CuA 2; the ventral side of the wings is brown; the ventral forewing has a discal white band from within the discal cell widening to the vein 1A+2A and ending in a smudge near the tornus, and a prominent white costal area from the base to about a quarter of the wing length, somewhat overscaled orange-yellow at the very base; the ventral hindwing has a white triangular area by the costal margin (reaching to about its third) at the base, slightly overscaled with brown at the distal angle, but otherwise with a straight and sharply defined posterior edge; and orange-yellow body beneath. Due to its cryptic nature and unexplored individual variation, this subspecies is best identified by DNA, with diagnostic base pairs in the nuclear genome: aly259.26.2:A1801C, aly2250.22.2:A36C, aly1084. 16.5:C126T, aly 2370.12.8:T36C, aly1531.17.2:A310C, aly 1158.5.1:A351A (not G), aly1315.19.5:G78G (not C), aly1315.19.5:G81G (not C), aly1315.19.5:A90A (not C), aly322.10.7:T48T (not C). In the COI barcode, the new subspecies is not confidently different from the nominate subspecies.</p><p>Barcode sequence of the holotype. Sample NVG-24073H04, GenBank PV892285, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGTACTTCTTTAAGATTACTTATTCGAACTGAATTAGGAACTCCTGGATCTTTAATTGGAGATGATCAAATTTACAATACT ATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAATTCCATTAATAATAGGAGCCCCTGATATAGCTTTCCCCCGAA TAAATAATATAAGATTTTGACTTTTACCCCCATCATTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCTGGAACAGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGC CCATCAAGGAGCATCAGTTGACTTAGCAATTTTCTCTTTACATTTAGCTGGTATTTCTTCTATTCTTGGAGCTATTAATTTTATCACAACAATTATTAATATACGAATTAATAGCCTATCT TTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATCACAGCATTATTATTATTACTTTCTTTACCAGTTTTAGCAGGAGCCATTACTATATTATTAACTGATCGAAATTTAAATACTT CATTTTTTGATCCAGCTGGAGGAGGAGATCCAATTTTATATCAACACTTATTT</p><p>Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 6a, bears the following four rectangular labels (1 st handwritten, others printed with handwritten text shown in italics), three white: [ C. RICA: PUNTARENAS | Corcovado; 20.ix.1976 | P. DeVries], [Allyn Museum | Acc. 19 78-20], [DNA sample ID: | NVG-24073H04 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Telegonus (Rhabdoides) alector | obscuratus Grishin] .</p><p>Type locality. Costa Rica: Puntarenas Province, Corcovado National Park .</p><p>Etymology. In Latin, obscuratus means darkened, made dark, or having become dark, and is given for the lack of the white smudge in the middle of the forewing in males characteristic of other T. alector subspecies. The name is a perfect passive participle.</p><p>Distribution. Currently known only from the holotype collected in southern Costa Rica.</p></div>	https://treatment.plazi.org/id/421169606035B331FE9920855CACBB60	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
421169606038B330FF56222D5AD0BCA2.text	421169606038B330FF56222D5AD0BCA2.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus (Rhabdoides) missionus Grishin 2025	<div><p>Additional specimens of Telegonus (Rhabdoides) missionus Grishin, 2025 confirm it as a species-level taxon</p><p>Genomic sequencing of additional specimens of Telegonus Hübner, [1819] (type species Papilio talus Cramer, 1777) reveals that Telegonus (Rhabdoides) missionus Grishin, 2025 (type locality USA: Texas, Hidalgo Co., Mission, holotype sequenced as NVG-14111E04) is a species widely distributed in eastern Mexico, recorded from the states of Tamaulipas, Nuevo Leon, and Veracruz (Fig. 5 red), thus confirming it as a species-level taxon, and not an unusual single specimen. This recently described species (Zhang et al. 2025a) is sympatric with Telegonus (Rhabdoides) gilberti H. Freeman, 1969 (type locality in Mexico, San Luis Potosí, holotype sequenced as NVG-15104B08) over its range, with sequenced specimens of the latter species from the same three Mexican states shown in the trees (Fig. 5 blue). Both species ( T. missionus and T. gilberti) have been recorded from Hidalgo County in Texas, USA (Fig. 5 highlighted yellow). In the nuclear genome trees, T. missionus is sister to Telegonus (Rhabdoides) hopfferi (Plötz, 1881) (type locality in Mexico, probably Oaxaca), a southern Mexico species, and specimens of both species were sequenced from Veracruz, (Fig. 5a, b).</p><p>As in our previous study (Zhang et al. 2025a), we observe confidently supported incongruence between the three phylogenetic trees of the T. alector species group (Fig. 5). In the Z chromosome tree (Fig 5b) and the mitochondrial genome tree (Fig 5c), the T. alector group partitions into two prominently separated clades with T. gilberti being in the second clade, thus more strongly differentiated genetically from the three species in the first clade: Telegonus (Rhabdoides) alector (C. Felder &amp; R. Felder, 1867) (type locality in Colombia), T. hopfferi, and T. missionus; while in the tree constructed from protein-coding regions of autosomes (Fig 5a), all four species belong to the same clade, with T. gilberti being sister to the other three species. In addition to males, genomic sequencing also reveals females of T. missionus, and one is illustrated here for the first time (Fig. 7). Females are similar to males in their darker appearance compared to females of related species (but paler than a typical T. missionus male), with a reduced white band on the ventral forewing, which has a beige (i.e., white scales sprinkled over brown) costal area from the base to about a third of the forewing length; a white triangle partly overscaled with brown at the base of the ventral hindwing; weakly expressed but noticeable pale overscaling in the discal area of the dorsal forewing corresponding to the white ventral band; and darker (not prominently orange-yellow) ventral side of the body.</p></div>	https://treatment.plazi.org/id/421169606038B330FF56222D5AD0BCA2	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
421169606039B336FECA226A5B75BC4D.text	421169606039B336FECA226A5B75BC4D.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus (Rhabdoides) flavifimbro Zhang & Cong & Shen & Song & Grishin 2025	<div><p>Telegonus (Rhabdoides) flavifimbro Grishin, new species</p><p>http://zoobank.org/ 16CBDDCE-329A-402A-9C25-25D6790F53EC (Figs. 8 part, 9b–c)</p><p>Definition and diagnosis. Genomic analysis reveals that two females from Colombia, initially identified as Telegonus (Rhabdoides) chiriquensis Staudinger, 1875 (type locality in Panama: Chiriquí) are genetically differentiated from it at the species level (Fig. 8); e.g., their COI barcodes differ by 4.1% (27 bp). Instead, these females form a nuclear genome clade sister to Telegonus (Rhabdoides) flavimargo Grishin, 2025 (type locality in Costa Rica), also differing from it at the species level, e.g., COI barcodes of the holotypes differ by 4.0% (26 bp), and, therefore, they represent a new species. This new species keys to “ Astraptes chiriquensis chiriquensis ” C.14.30(a) in Evans (1952), but differs from it and other relatives by the following combination of characters in females: an iridescent area at the base of the dorsal forewing is similar to or more developed than in T. chiriquensis but less extensive and greener than in T. flavimargo; the tornal area of the ventral forewing is even darker than in T. flavimargo; a yellow submarginal region on the ventral hindwing is the broadest close to the middle of the wing and narrowing towards the tornus, slightly broader than in T. flavimargo; a dark postdiscal band on the ventral forewing that is equidistant from the apical and discal bands (not closer to the apical band); more strongly expressed dark bands on the dorsal forewing; and more saturated in color and brighter orange-yellow fringes on the hindwing. Due to its cryptic nature and unexplored individual variation, this species is best C52T, aly275209.7.3:G198A, aly3614.1.6:C40T, aly393.1.23:C57G. In the COI barcode, this new species may not differ from others due to mitochondrial introgression among its relatives.</p><p>Barcode sequence of the holotype. Sample NVG-24028C10, GenBank PV892286, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATCGGAACTTCTTTAAGATTACTTATTCGAACTGAATTAGGAACCCCAGGATCTTTAATTGGAGACGATCAAATTTATAACACT ATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTCCCATTAATAATAGGAGCTCCTGATATAGCTTTTCCTCGTA TAAATAATATAAGATTTTGACTTCTACCCCCATCATTAACTTTATTAATTTCAAGAAGAATTGTTGAAAATGGTGCTGGAACAGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGC CCACCAAGGAGCATCAGTTGATTTAGCTATTTTTTCCCTACATTTAGCTGGTATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAACATAAAAATTAATAATTTATCT TTTGATCAAATACCTTTATTTGTATGAGCTGTTGGAATTACAGCATTATTATTATTACTTTCATTACCAGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTT CATTTTTTGATCCAGCAGGAGGAGGAGACCCAATTTTATACCAACATTTATTT</p><p>Type material. Holotype: ♀ deposited in the Museum für Naturkunde, Berlin, Germany (MFNB), illustrated in Fig. 9b, bears the following seven rectangular labels (first four handwritten, others printed), six white: [Columbia | 86 Klbr.], [201.], [ T. chiriquensis | ♀ var.], [chiriquensis | var.], [{QR Code} MfN URI | http://coll.mfn- | berlin.de/u/ | 09ec52], [DNA sample ID: | NVG-24028C10 | c/o Nick V. Grishin], and one red [HOLOTYPE ♀ | Telegonus (Rhabdoides) | flavifimbro Grishin] . Paratype: 1♀: NVG-24039F01 Colombia, Boyacá, Muzo, Mar-1918, W. Gerstner leg. [SMNS] (Fig. 9c) .</p><p>Type locality. Colombia, possibly in the eastern Andes .</p><p>Etymology. Formed similarly to flavimargo, the name is given for the orange-yellow fringes (fimbia in Latin), particularly noticeable in the holotype of this species. The name is also longer to indicate a more southern distribution of this species and is treated as a noun in apposition.</p><p>Distribution. Currently known only from Colombia.</p></div>	https://treatment.plazi.org/id/421169606039B336FECA226A5B75BC4D	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
42116960603FB336FF002505590CBAB4.text	42116960603FB336FF002505590CBAB4.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus (Rhabdoides) adoba (Evans 1952) Zhang & Cong & Shen & Song & Grishin 2025	<div><p>Telegonus (Rhabdoides) adoba (Evans, 1952), stat. nov. is a species distinct from Telegonus (Rhabdoides) cretatus Hayward, 1939</p><p>Genomic analysis of over two dozen Telegonus (Rhabdoides) cretatus Hayward, 1939 (type locality in Ecuador: Napo) specimens from across the range reveals that they partition into two comb-like clades genetically differentiated at the species level (Fig. 10). The first clade includes specimens from French Guiana, Venezuela, Ecuador, Peru, Bolivia, and Amazonian Brazil and corresponds to the nominate subspecies. The second clade is composed of specimens from the Atlantic states of Brazil from Bahia to Santa Catarina and represents a taxon originally described as a subspecies Astraptes cretatus adoba Evans, 1952 (type locality in Brazil: Espírito Santo) and currently treated as such, but now placed in Telegonus (Rhabdoides) . Although it differs by only 0.6% (4 bp) from the nominate subspecies, this difference is consistent throughout the range, and the nuclear genome clades suggest a species-level distinction. Phenotypically, the Atlantic taxon is darker than the Amazonian (e.g., nearly lacking the ventral forewing green/white area by the costal margin at the base) and has a typically less robust serrated dorsal ridge of the harpe with a more rounded ventrocaudal angle. Therefore, we propose Telegonus (Rhabdoides) adoba (Evans, 1952), stat. nov. is a species distinct from Telegonus (Rhabdoides) cretatus Hayward, 1939 .</p></div>	https://treatment.plazi.org/id/42116960603FB336FF002505590CBAB4	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
42116960603FB335FF25207A5CD4B9E6.text	42116960603FB335FF25207A5CD4B9E6.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus (Rhabdoides) flavimargo Grishin 2025	<div><p>Telegonus (Rhabdoides) flavimargo Grishin, 2025, Telegonus (Rhabdoides) panamus Grishin, 2025, and Telegonus (Rhabdoides) tatus Grishin, 2025 are confirmed as species-level taxa by sequencing of additional specimens</p><p>Genomic analysis enables us to confidently propose new species from a single specimen of either sex that is genetically differentiated from others at the species level (Zhang et al. 2025a). However, even fortified with the whole genome shotgun dataset, this single-specimen approach carries a risk of describing a hybrid or a contaminated dataset as a “species,” despite all the precautions and careful analysis we undertake. Therefore, we strive to find and sequence additional specimens of the newly proposed species and investigate them further. Here, we confirm the species-level status of Telegonus (Rhabdoides) flavimargo Grishin, 2025 (type locality in Costa Rica: Limón, 2 additional specimens) (Fig. 8 green) and Telegonus (Rhabdoides) tatus Grishin, 2005 (type locality in Panama: Panamá, 6 additional specimens) (Fig. 10 maroon) proposed from a single specimen and Telegonus (Rhabdoides) panamus Grishin, 2025 (type locality in Panama: Barro Colorado Island, 4 additional specimens) originally described from the holotype and the paratype (Fig. 10 purple). For all these species, additional specimens group closely with the holotypes in the genomic trees, resulting in comb-like clades characteristic of conspecific specimens. Although for T. flavimargo all three known specimens are from the same locality (Costa Rica: Limón Province, Guapiles), we are able to extend the known distribution for the other two species: T. panamus has been recorded from both central (around the Panama Canal) and eastern Panama (Darien) (Fig. 10 purple); and two specimens from northern Ecuador fall in the same clade among T. tatus specimens from central Panama and therefore, we identify them as this species (Fig. 10 maroon).</p></div>	https://treatment.plazi.org/id/42116960603FB335FF25207A5CD4B9E6	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
42116960603CB334FF0C20D459DABDB1.text	42116960603CB334FF0C20D459DABDB1.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus Hubner 1819	<div><p>A modified preliminary taxonomic list of Telegonus (Rhabdoides Scudder, 1889) species from the clade analyzed in Zhang et al. (2025) and this work</p><p>Additional genomic sequencing and analyses suggest several revisions to our preliminary taxonomic list of species from the subgenus Rhabdoides Scudder, 1889 (only from the clade we have analyzed). The list from Zhang et al. (2025a) is updated below, using the same rationale and format. We introduced a new species and a new subspecies and revised the status of one subspecies to species. Furthermore, tweaks to the order were made. For instance, Telegonus chuchuvianus Grishin, 2025 was moved next to its most likely sister group of two species: Telegonus meretrix (Hewitson, 1876) and Telegonus fulvimargo Grishin, 2025, as evidenced by strong statistical support in both the Z chromosome and the mitochondrial genome trees (Fig. 10). The former species was placed before the latter two, because it lacks the yellower ventral hindwing margin characteristic of the latter, and the next species group in the list (the latimargo species group) starts with pale-margined species.</p><p>In the following arrangement from Zhang et al. (2025a), refined below, species of Rhabdoides excluding the clades with Telegonus anaphus (Cramer, 1777) and Telegonus cellus (Boisduval &amp; Le Conte, [1837] are given. The list also includes species discovered by Steinhauser (1987) (“four new species will be added to the group”) that fall within these species groups but remain unpublished, shown in gray font. Type localities (general area only: state, region, department, or county) are in gray font. New taxa described in this study and the category of taxonomic change are in red font. Taxonomic treatment before this work (for valid names) and comments are given in smaller font following a vertical bar | after the type locality; an equal sign = precedes synonyms given in their original genus combination; and a double dagger ‡ marks unavailable names. The list covers 48 valid taxa and 4 yet undescribed species, comprising 46 species (1 newly proposed here and 1 formerly treated as a subspecies) and 6 additional subspecies (1 new).</p></div>	https://treatment.plazi.org/id/42116960603CB334FF0C20D459DABDB1	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
42116960603DB334FF2F255159E0BCEE.text	42116960603DB334FF2F255159E0BCEE.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	(Rhabdoides) Scudder 1889	<div><p>Subgenus Rhabdoides Scudder, 1889;</p><p>type species Eudamus cellus Boisduval &amp; Le Conte, [1837] alector species group</p></div>	https://treatment.plazi.org/id/42116960603DB334FF2F255159E0BCEE	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
42116960603DB334FF5F25B45CE8BC9D.text	42116960603DB334FF5F25B45CE8BC9D.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus alector subsp. alector (C. Felder & R. Felder 1867)	<div><p>Telegonus alector alector (C. Felder &amp; R. Felder, 1867);</p><p>Colombia: Bogotá</p></div>	https://treatment.plazi.org/id/42116960603DB334FF5F25B45CE8BC9D	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
42116960603DB334FF5F226F5C10BB46.text	42116960603DB334FF5F226F5C10BB46.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus alector subsp. ecuadoricus Grishin 2025	<div><p>Telegonus alector ecuadoricus Grishin, 2025;</p><p>Ecuador: Esmeraldas</p></div>	https://treatment.plazi.org/id/42116960603DB334FF5F226F5C10BB46	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
42116960603DB334FF5F25D15C3FBCB0.text	42116960603DB334FF5F25D15C3FBCB0.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus alector subsp. obscuratus Zhang & Cong & Shen & Song & Grishin 2025	<div><p>Telegonus alector obscuratus Grishin, ssp. n.;</p><p>Costa Rica: Puntarenas</p></div>	https://treatment.plazi.org/id/42116960603DB334FF5F25D15C3FBCB0	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
42116960603DB334FF0F23695BD0BA78.text	42116960603DB334FF0F23695BD0BA78.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus amazonicus Grishin 2025	<div><p>Telegonus amazonicus Grishin, 2025;</p><p>Brazil: Rondônia</p></div>	https://treatment.plazi.org/id/42116960603DB334FF0F23695BD0BA78	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
42116960603DB334FF0F23435BE1BAEB.text	42116960603DB334FF0F23435BE1BAEB.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus bifascia (Herrich-Schaffer 1869)	<div><p>Telegonus bifascia (Herrich-Schäffer, 1869)</p><p>Telegonus bifascia bifascia (Herrich-Schäffer, 1869); [likely Brazil]</p><p>Telegonus bifascia siges Mabille, 1903; Brazil [likely S]</p></div>	https://treatment.plazi.org/id/42116960603DB334FF0F23435BE1BAEB	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
42116960603DB334FF0F23A65C83B96B.text	42116960603DB334FF0F23A65C83B96B.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus crana (Evans 1952)	<div><p>Telegonus crana (Evans, 1952);</p><p>Guatemala: San Gerónimo</p><p>= Astraptes escalantei Freeman, 1967; Mexico: Chiapas | junior subjective synonym</p></div>	https://treatment.plazi.org/id/42116960603DB334FF0F23A65C83B96B	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
42116960603DB334FF0F20EE5C1AB98D.text	42116960603DB334FF0F20EE5C1AB98D.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus cyprus (Evans 1952)	<div><p>Telegonus cyprus (Evans, 1952)</p><p>Telegonus cyprus crilla (Evans, 1952); Ecuador: Zamora</p><p>Telegonus cyprus cyprus (Evans, 1952); Bolivia: Yungas &amp; La Paz</p></div>	https://treatment.plazi.org/id/42116960603DB334FF0F20EE5C1AB98D	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
42116960603DB334FF0F21E15C44B8C0.text	42116960603DB334FF0F21E15C44B8C0.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus elorianus Grishin 2025	<div><p>Telegonus elorianus Grishin, 2025;</p><p>unknown, likely SE or S Brazil</p></div>	https://treatment.plazi.org/id/42116960603DB334FF0F21E15C44B8C0	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
42116960603DB334FF0F209F5CA0B818.text	42116960603DB334FF0F209F5CA0B818.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus elorus (Hewitson 1867)	<div><p>Telegonus elorus (Hewitson, 1867);</p><p>no data [likely SE or S Brazil]</p><p>= Eudamus blasius Plötz, 1881; “ Cuba ” [likely SE or S Brazil] | junior subjective synonym</p><p>= Telegonus pheres Mabille, 1903; Brazil: Santa Catarina | junior subjective synonym</p><p>= Telegonus subblasius Strand, 1921; Argentina: Misiones | junior subjective synonym</p></div>	https://treatment.plazi.org/id/42116960603DB334FF0F209F5CA0B818	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
42116960603DB334FF0F22FF5B97BBD6.text	42116960603DB334FF0F22FF5B97BBD6.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus gilberti (Freeman 1969)	<div><p>Telegonus gilberti (Freeman, 1969);</p><p>Mexico: San Luis Potosí</p></div>	https://treatment.plazi.org/id/42116960603DB334FF0F22FF5B97BBD6	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
42116960603DB334FF0F22425B3FBB01.text	42116960603DB334FF0F22425B3FBB01.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus hopfferi (Plotz 1881)	<div><p>Telegonus hopfferi (Plötz, 1881);</p><p>Mexico [likely C or S Mexico]</p><p>= Thracides uridon Dyar, 1912; Mexico: Guerrero</p></div>	https://treatment.plazi.org/id/42116960603DB334FF0F22425B3FBB01	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
42116960603DB334FF0F22045B85BBED.text	42116960603DB334FF0F22045B85BBED.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus missionus Grishin 2025	<div><p>Telegonus missionus Grishin, 2025;</p><p>USA: Texas, Hidalgo Co.</p></div>	https://treatment.plazi.org/id/42116960603DB334FF0F22045B85BBED	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
42116960603DB334FF0F22B55B4FBB9C.text	42116960603DB334FF0F22B55B4FBB9C.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus pacificus Grishin 2025	<div><p>Telegonus pacificus Grishin, 2025;</p><p>Peru: Piura</p></div>	https://treatment.plazi.org/id/42116960603DB334FF0F22B55B4FBB9C	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
42116960603DB334FF0F207C5B1EB955.text	42116960603DB334FF0F207C5B1EB955.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus pallidus Grishin 2025	<div><p>Telegonus pallidus Grishin, 2025;</p><p>Panama: Darién</p></div>	https://treatment.plazi.org/id/42116960603DB334FF0F207C5B1EB955	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
42116960603DB334FF0F22D25B22BBB3.text	42116960603DB334FF0F22D25B22BBB3.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus panavenus Grishin 2025	<div><p>Telegonus panavenus Grishin, 2025;</p><p>Panama: Panamá</p></div>	https://treatment.plazi.org/id/42116960603DB334FF0F22D25B22BBB3	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
42116960603DB334FF0F200A5BF6B91B.text	42116960603DB334FF0F200A5BF6B91B.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus subfuscus Grishin 2025	<div><p>Telegonus subfuscus Grishin, 2025;</p><p>Brazil: Santa Catarina</p></div>	https://treatment.plazi.org/id/42116960603DB334FF0F200A5BF6B91B	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
421169606022B32BFF0F22435D3DBB22.text	421169606022B32BFF0F22435D3DBB22.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus adoba (Evans 1952) Zhang & Cong & Shen & Song & Grishin 2025	<div><p>Telegonus adoba (Evans, 1952), stat. nov.;</p><p>Brazil: Espírito Santo | was a subspecies of T. cretatus</p></div>	https://treatment.plazi.org/id/421169606022B32BFF0F22435D3DBB22	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
421169606022B32BFF0F20775BFEB95E.text	421169606022B32BFF0F20775BFEB95E.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus alardinus Grishin 2025	<div><p>Telegonus alardinus Grishin, 2025;</p><p>Brazil: Rio de Janeiro</p></div>	https://treatment.plazi.org/id/421169606022B32BFF0F20775BFEB95E	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
421169606022B32BFF0F23C65B2BB975.text	421169606022B32BFF0F23C65B2BB975.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus alardus (Stoll 1790)	<div><p>Telegonus alardus (Stoll, 1790)</p><p>Telegonus alardus latia (Evans, 1952); Costa Rica</p><p>Telegonus alardus alardus (Stoll, 1790); Suriname</p></div>	https://treatment.plazi.org/id/421169606022B32BFF0F23C65B2BB975	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
421169606022B32BFF0F21175B08B8FE.text	421169606022B32BFF0F21175B08B8FE.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus cassius (Evans 1952)	<div><p>Telegonus cassius (Evans, 1952);</p><p>Costa Rica: Irazú</p></div>	https://treatment.plazi.org/id/421169606022B32BFF0F21175B08B8FE	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
421169606022B32BFF0F27165B09BEFF.text	421169606022B32BFF0F27165B09BEFF.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus chiapus Grishin 2025	<div><p>Telegonus chiapus Grishin, 2025;</p><p>Mexico: Chiapas</p></div>	https://treatment.plazi.org/id/421169606022B32BFF0F27165B09BEFF	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
421169606022B32BFF0F27CA5CE2BE84.text	421169606022B32BFF0F27CA5CE2BE84.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus chiriquensis Staudinger 1875	<div><p>Telegonus chiriquensis Staudinger, 1875;</p><p>Panama: Chiriquí</p><p>= Aethilla weymeri Plötz, 1882;? [Panama: Chiriquí] | junior subjective synonym</p></div>	https://treatment.plazi.org/id/421169606022B32BFF0F27CA5CE2BE84	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
421169606022B32BFF0F22265B81BB0F.text	421169606022B32BFF0F22265B81BB0F.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus chuchuvianus Grishin 2025	<div><p>Telegonus chuchuvianus Grishin, 2025;</p><p>Ecuador: Esmeraldas</p></div>	https://treatment.plazi.org/id/421169606022B32BFF0F22265B81BB0F	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
421169606022B32BFF0F27805B0DBD61.text	421169606022B32BFF0F27805B0DBD61.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus colotrix Grishin 2025	<div><p>Telegonus colotrix Grishin, 2025;</p><p>Colombia: Cauca</p></div>	https://treatment.plazi.org/id/421169606022B32BFF0F27805B0DBD61	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
421169606022B32BFF0F25B75C82BB7B.text	421169606022B32BFF0F25B75C82BB7B.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus cretatus Hayward 1939	<div><p>Telegonus cretatus Hayward, 1939;</p><p>Ecuador: Napo</p><p>= Astraptes alfius alfius Evans, 1952; Brazil: Amazonas | junior subjective synonym</p></div>	https://treatment.plazi.org/id/421169606022B32BFF0F25B75C82BB7B	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
421169606022B32BFF0F24865AA7BC6F.text	421169606022B32BFF0F24865AA7BC6F.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus creteus (Cramer 1780)	<div><p>Telegonus creteus (Cramer, 1780);</p><p>Suriname</p></div>	https://treatment.plazi.org/id/421169606022B32BFF0F24865AA7BC6F	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
421169606022B32BFF0F245F5B22BD36.text	421169606022B32BFF0F245F5B22BD36.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus erana (Evans 1952)	<div><p>Telegonus erana (Evans, 1952);</p><p>Ecuador: Balzapamba</p></div>	https://treatment.plazi.org/id/421169606022B32BFF0F245F5B22BD36	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
421169606022B32BFF0F24C85C14BDD9.text	421169606022B32BFF0F24C85C14BDD9.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus flavifimbro Zhang & Cong & Shen & Song & Grishin 2025	<div><p>Telegonus flavifimbro Grishin, sp. n.;</p><p>Colombia [likely eastern Andes]</p></div>	https://treatment.plazi.org/id/421169606022B32BFF0F24C85C14BDD9	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
421169606022B32BFF0F24315BCABD10.text	421169606022B32BFF0F24315BCABD10.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus flavimargo Grishin 2025	<div><p>Telegonus flavimargo Grishin, 2025;</p><p>Costa Rica: Limón</p></div>	https://treatment.plazi.org/id/421169606022B32BFF0F24315BCABD10	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
421169606022B32BFF0F22FD5B18BBD4.text	421169606022B32BFF0F22FD5B18BBD4.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus fulvimargo Grishin 2025	<div><p>Telegonus fulvimargo Grishin, 2025;</p><p>Peru: Cuzco</p></div>	https://treatment.plazi.org/id/421169606022B32BFF0F22FD5B18BBD4	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
421169606022B32BFF0F21335B20B812.text	421169606022B32BFF0F21335B20B812.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus galesus Mabille 1888	<div><p>Telegonus galesus Mabille, 1888;</p><p>Peru: Chanchamayo</p></div>	https://treatment.plazi.org/id/421169606022B32BFF0F21335B20B812	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
421169606022B32BFF0F26AF5B30BF86.text	421169606022B32BFF0F26AF5B30BF86.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus grullus (Mabille 1888)	<div><p>Telegonus grullus (Mabille, 1888);</p><p>Panama: Chiriquí</p></div>	https://treatment.plazi.org/id/421169606022B32BFF0F26AF5B30BF86	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
421169606022B32BFF0F202A5AE1B93B.text	421169606022B32BFF0F202A5AE1B93B.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus habana (Lucas 1857)	<div><p>Telegonus habana (Lucas, 1857);</p><p>Cuba</p></div>	https://treatment.plazi.org/id/421169606022B32BFF0F202A5AE1B93B	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
421169606022B32BFF0F200D5DDBB9AD.text	421169606022B32BFF0F200D5DDBB9AD.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus heriul Mabille & Boullet 1912	<div><p>Telegonus heriul Mabille &amp; Boullet, 1912;</p><p>" Brazil " [Dominican Republic]</p><p>= Telegonus antiquus Skinner, 1920; Dominican Republic | junior subjective synonym</p><p>= Telegonus domingensis Joicey &amp; Talbot, 1924; Dominican Republic | junior subjective synonym</p></div>	https://treatment.plazi.org/id/421169606022B32BFF0F200D5DDBB9AD	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
421169606022B32BFF0F22985D78BAC4.text	421169606022B32BFF0F22985D78BAC4.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus latimargo (Herrich-Schaffer 1869)	<div><p>Telegonus latimargo (Herrich-Schäffer, 1869)</p><p>Telegonus latimargo aquila (Evans, 1952); Colombia: Cauca</p><p>Telegonus latimargo latimargo (Herrich-Schäffer, 1869);</p><p>Tropical America to USA</p><p>=‡ Telegonus cartomes Mabille &amp; Boullet, 1912; no data | nomen nudum (proposed in synonymy)</p><p>= Telegonus fabrici Ehrmann, 1918; Venezuela: Caura Valley | junior subjective synonym</p></div>	https://treatment.plazi.org/id/421169606022B32BFF0F22985D78BAC4	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
421169606022B32BFF0F22195B43BBE8.text	421169606022B32BFF0F22195B43BBE8.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus meretrix (Hewitson 1876)	<div><p>Telegonus meretrix (Hewitson, 1876);</p><p>Ecuador</p></div>	https://treatment.plazi.org/id/421169606022B32BFF0F22195B43BBE8	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
421169606022B32BFF0F25F95C45BCC8.text	421169606022B32BFF0F25F95C45BCC8.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus panamus Grishin 2025	<div><p>Telegonus panamus Grishin, 2025;</p><p>Panama: Barro Colorado Island</p></div>	https://treatment.plazi.org/id/421169606022B32BFF0F25F95C45BCC8	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
421169606022B32BFF0F25065B3FBCEF.text	421169606022B32BFF0F25065B3FBCEF.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus parmenides (Stoll 1781)	<div><p>Telegonus parmenides (Stoll, 1781);</p><p>likely Suriname</p></div>	https://treatment.plazi.org/id/421169606022B32BFF0F25065B3FBCEF	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
421169606022B32BFF0F27655BF5BE4C.text	421169606022B32BFF0F27655BF5BE4C.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus perumazon Grishin 2025	<div><p>Telegonus perumazon Grishin, 2025;</p><p>Peru: Madre de Dios</p></div>	https://treatment.plazi.org/id/421169606022B32BFF0F27655BF5BE4C	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
421169606022B32BFF0F257A5BC6BC4B.text	421169606022B32BFF0F257A5BC6BC4B.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus sobrasus Grishin 2025	<div><p>Telegonus sobrasus Grishin, 2025;</p><p>Brazil: Santa Catarina</p></div>	https://treatment.plazi.org/id/421169606022B32BFF0F257A5BC6BC4B	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
421169606022B32BFF0F27585DE3BE15.text	421169606022B32BFF0F27585DE3BE15.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus steinhauseri Grishin 2025	<div><p>Telegonus steinhauseri Grishin, 2025;</p><p>Mexico: Veracruz</p><p>=‡ Telegonus chiriquensis form godmani Williams, 1927; Mexico (Tab) and Nicaragua | infrasubspecific</p></div>	https://treatment.plazi.org/id/421169606022B32BFF0F27585DE3BE15	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
421169606022B32BFF0F21605DC2B82A.text	421169606022B32BFF0F21605DC2B82A.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus subflavus Grishin 2022	<div><p>Telegonus subflavus Grishin, 2022;</p><p>Ecuador: Chimborazo</p><p>=‡ Telegonus galesus form subflavus Williams, 1927; Ecuador: Chimborazo | infrasubspecific name</p></div>	https://treatment.plazi.org/id/421169606022B32BFF0F21605DC2B82A	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
421169606022B32BFF0F25DC5B73BCB5.text	421169606022B32BFF0F25DC5B73BCB5.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus tatus Grishin 2025	<div><p>Telegonus tatus Grishin, 2025;</p><p>Panama: Panamá</p></div>	https://treatment.plazi.org/id/421169606022B32BFF0F25DC5B73BCB5	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
421169606022B32BFF0F24A35AB7BD82.text	421169606022B32BFF0F24A35AB7BD82.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Telegonus tinda (Evans 1952)	<div><p>Telegonus tinda (Evans, 1952);</p><p>Brazil: Pará</p></div>	https://treatment.plazi.org/id/421169606022B32BFF0F24A35AB7BD82	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
421169606023B32AFF4726165A70BEBF.text	421169606023B32AFF4726165A70BEBF.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Urbanus (Urbanoides) elmina Evans 1952	<div><p>Urbanus (Urbanoides) elmina Evans, 1952 is confirmed from Colombia</p><p>In the original description of Urbanus (Urbanoides) elma Grishin, 2025 (type locality in Venezuela: Mérida) we provided a phylogenetic tree showing specimens of Urbanus (Urbanoides) elmina Evans, 1952 (type locality in Ecuador: Rio Pastaza) from Ecuador, Peru, and Argentina (Zhang et al. 2025a). The only specimen from Colombia (without further locality details) was the paratype of U. elma . To date, we have sequenced specimens of U. elmina from additional localities in Ecuador and also from western Colombia (Valle del Cauca and Cauca Departments), thus confirming this species from Colombia (Fig. 11). While we have not found more specimens of U. elma, we stumbled upon a specimen of a new species, which is described next.</p></div>	https://treatment.plazi.org/id/421169606023B32AFF4726165A70BEBF	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
421169606023B32FFE14208059D1BED8.text	421169606023B32FFE14208059D1BED8.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Urbanus (Urbanoides) dolus Zhang & Cong & Shen & Song & Grishin 2025	<div><p>Urbanus (Urbanoides) dolus Grishin, new species</p><p>http://zoobank.org/ 89F465B0-F9CE-4BB0-A902-257402570AD3</p><p>(Figs. 11 part, 12b, 13)</p><p>Definition and diagnosis. In an attempt to find additional specimens of the recently described Urbanus (Urbanoides) elma Grishin, 2025 (type locality in Venezuela: Mérida) (Fig. 12c), currently known only from the holotype (female) and the paratype (male), we have sequenced a female from Tolima, Colombia.</p><p>This specimen, identified and illustrated (genitalia only) by Steinhauser (1981) as Urbanus (Urbanoides) elmina Evans, 1952 (type locality in Ecuador: Rio Pastaza), is instead sister to Urbanus (Urbanoides) viridis Freeman, 1970 (type locality in Mexico: Veracruz, holotype sequenced as NVG-15104A04) in the nuclear genome tree ( Urbanus (Urbanoides) esta Evans, 1952 (type locality in Brazil: São Paulo) is sister to them both), but is genetically differentiated at the species level (Fig. 11). Therefore, this female represents a new species. Interestingly, COI barcodes do not differ among the three species: the new one, U. viridis, and U. esta, probably due to introgression. The new species keys to U. elmina in Evans (1952) (C.13.9) and Steinhauser (1981) and was included by them in that taxon, but differs from it and U. elma by the following combination of characters in females: the ventral hindwing with a narrower postdiscal brown band; four smaller, darker, and better separated from each other spots in the basal half; a stronger contrast between the marginal area of nearly ground color from the apex to the vein CuA 1 and the darker area from the vein CuA 1 through the tail; whiter (less yellow) semi-hyaline forewing spots; and a slightly rounder hindwing. The new species is more similar to its closer relatives U. viridis or U. esta in having a contrasting paler ventral hindwing margin from the apex to the vein CuA 1; better separated from each other four spots in the basal half of the ventral hindwing; whiter semi-hyaline forewing spots; and female genitalia with a moderately sclerotized lamella antevaginalis that has a well-developed central notch (Fig. 13); but differs from them by a more washed-out appearance of the ventral hindwing with paler bands and spots (but not as pale as in U. elmina and U. elma), the postdiscal band uniformly brown without paler veins crossing it, and smaller spots in the basal half. The lamella postvaginalis has a deeper, U-shaped central notch of more than a third of its length and its lobes have a convex distal margin on both sides. To facilitate comparison, we illustrate a female of its sister species, U. viridis (NVG-19013F10, Mexico: Tamaulipas, Sierra Cucharas, nr. rock quarry, eclosed on 3-Dec-1974, reared on Desmodium neomexicanum A. Gray, R. O. Kendall &amp; C. A. Kendall leg. [TAMU]) (Fig. 12a). Due to the cryptic nature of this species, unrecognized males, and unexplored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly330.11.2:G174A, aly330.11.2:G510C, aly 2828.8.1:T84C, aly 2828.8.1:A291T, aly1038. 10.3:C612T, aly2976.14.2:C150C (not T), aly6841.3.3:A116A (not G), aly6841.3.3:A499A (not G), aly6841. 3.3:A867A (not T), aly1651.36.1:A1324A (not G). In the COI barcode, this species does not differ from either U. viridis or U. esta .</p><p>Barcode sequence of the holotype. Sample NVG- 24111A06, GenBank PV892287, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAGTTGGTACTTCATTAAGATTAC TTATTCGAACTGAATTAGGAACCCCTGGATCTTTAATTGGAGATGATCAAATTTATAAT ACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAAT TGGAGGATTTGGTAATTGATTAGTTCCCCTAATAATAGGAGCCCCTGACATAGCTTTCC CCCGTATAAATAATATAAGATTTTGATTATTACCCCCTTCTTTAACTTTATTAATTTCA AGAAGAATCGTTGAAAATGGTGCTGGTACTGGATGAACAGTTTATCCCCCTCTTTCATC TAATATTGCCCATCAAGGAGCTTCTGTTGACTTAGCAATTTTTTCCCTACATCTTGCTG GTATTTCATCTATTCTTGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATT AATAATTTATCTTTTGATCAAATACCTTTATTTGTATGAGCTGTAGGAATTACAGCATT ATTATTATTATTATCTTTACCTGTTTTAGCGGGAGCTATCACTATATTATTAACTGATC GAAATTTAAATACCTCCTTTTTTGACCCAGCAGGAGGAGGAGATCCTATTTTATATCAA CATTTATTT</p><p>Type material. Holotype: ♀ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 12b (genitalia Fig. 13), bears the following five rectangular labels (2 nd handwritten, others printed with handwritten text shown in italics), four white: [COLOMBIA: TOLIMA | La Aurora, R. Cambrin | 1300 m.; 17.XI.1974 | S. &amp; L. Steinhauser], [GENIT. PREP. | SRS-406], [A. C. Allyn | Acc. 1975-17], [DNA sample ID: | NVG- 24111A06 | c/o Nick V. Grishin], and one red [HOLOTYPE ♀ | Urbanus (Urbanoides) dolus Grishin]. Genitalia of the holotype, misidentified as Urbanus elmina, were illustrated in fig. 58 by Steinhauser (1981).</p><p>Type locality. Colombia: Tolima, La Aurora, Río Cambrín, elevation 1300 m.</p><p>Etymology. In Greek, δόλος (dólos) means deceit, treachery, guile, or craftiness; the same meaning carries to Latin dolus . The name is given for the deceitful appearance of this species, which is sister to U. viridis, but in the ventral hindwing pattern looks more similar to U. elmina or U. elma and was identified as U. elmina by Steinhauser (1981). The name is an adjective.</p><p>Distribution. Currently known only from the holotype collected on the western slopes of the eastern Andes of Colombia.</p></div>	https://treatment.plazi.org/id/421169606023B32FFE14208059D1BED8	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
421169606026B32EFE01279B5D93BB41.text	421169606026B32EFE01279B5D93BB41.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Burnsius communis (Grote 1872)	<div><p>Subspecies of Burnsius communis (Grote, 1872)</p><p>Currently, Burnsius communis (Grote, 1872) (type locality in USA: central Alabama) is partitioned into two subspecies: the nominate, distributed throughout most of the range from Canada to Mexico; and Burnsius communis albescens (Plötz, 1884) (type locality in Mexico), known from the southern parts of the range (e.g., Oaxaca and Veracruz in Mexico). In line with this treatment, B. communis albescens is a confidently supported sister to all other populations (98% bootstrap value) in the nuclear genome tree constructed from more than 10 million positions in autosome protein-coding genes (Fig. 14a). However, due to their overall lack of prominent genetic differentiation and continuing gene flow within a species, subspecies do not always stand out as major clades in phylogenetic trees. Accordingly, the clade of B. communis albescens specimens, although supported with 100% ultra-fast bootstrap value (Minh et al. 2013), is found within the nominate clade in the Z chromosome tree (Fig. 14b), likely due to poor phylogenetic resolution (low support for most bifurcations) caused by DNA similarity and gene flow. We note that mitochondrial DNA does not consistently segregate several species of Burnsius Grishin, 2019 (type species Syricthus [sic] communis Grote, 1872), such as B. communis, B. albezens Grishin, 2022 (type locality in USA: AZ, Cochise Co.), and B. burnsi Grishin, 2022 (type locality in Mexico: Veracruz), and its utility is equally limited for subspecies delimitation.</p><p>Additional sequencing of B. communis specimens across the range revealed that specimens from Stanislaus National Forest in Tuolumne County, California, were partitioned between different clades (Fig. 14 yellow highlight). While several specimens were in a confidently supported (99%–100% bootstrap value) nuclear genome clade of specimens from the northwestern part of the range, one specimen was in a clade that included more western and southern specimens. This latter specimen was collected at the same locality and on the same day with one of the specimens from the northwestern clade (near Mill Creek Campground , elevation 6525’, GPS 38.312 6, −119.939 8, 21-Jul-2022, W. R. Dempwolf leg.). These specimens were different in size and wing pattern (Fig. 15h vs. Fig. 15l). Moreover, a similar scenario was later found for four specimens of the same size from south of Lake Tahoe, El Dorado County, California, with two being in the northwestern clade and two (collected several miles to the east) falling in the southeastern clade (Fig. 14 orange highlight; Fig. 15j, k, m, n).</p><p>Therefore, the northwestern and southeastern clades represent different taxa. Although it is possible that they are species-level taxa, it is also possible that they may be subspecies that intergrade at certain localities and elevations. Currently, several taxa with similar relationships are treated as subspecies (type localities in parentheses): Hesperia colorado sublima A. Warren &amp; Calhoun, 2015 (USA: Colorado, Clear Creek Co.) vs. Hesperia colorado colorado (Scudder, 1874) (USA: Colorado, Lake Co.) and Apodemia virgulti dialeucoides J. Emmel, T. Emmel &amp; Pratt, 1998 vs. Apodemia virgulti nigrescens J. Emmel &amp; T. Emmel, 1998 (both USA: California, San Bernardino Co.) (Pelham 2023). Hence, and due to the lack of prominent genetic differentiation characteristic of species, the new taxa of Burnsius are conservatively described here as subspecies of B. communis, pending more detailed analyses and further studies. Warren (2005) reviewed Oregon populations and also noted phenotypic differences among them.</p></div>	https://treatment.plazi.org/id/421169606026B32EFE01279B5D93BB41	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
421169606027B323FEC222095DD8BE68.text	421169606027B323FEC222095DD8BE68.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Burnsius communis subsp. tenebrunis Zhang & Cong & Shen & Song & Grishin 2025	<div><p>Burnsius communis tenebrunis Grishin, new subspecies</p><p>http://zoobank.org/ E738CD38-E871-4B6A-A77E-4C6C5ED5969E (Figs. 14 part, 15a–d, 16a–b)</p><p>Definition and diagnosis. Genomic analysis reveals that populations from the Pacific Northwest, currently identified as Burnsius communis communis (Grote, 1872) (type locality in USA: central Alabama), belong to a distinct and strongly supported (99%–100% ultra-fast bootstrap values) clade in the nuclear genome trees, genetically differentiated from others at the subspecies level (Fig. 14 green). Therefore, they represent a new subspecies that keys to “ Pyrgus communis communis ” (G.1.10(a)) in Evans (1953), but differs from it and other relatives by the following combination of characters: a costal fold in males; the harpe dorsally with two prongs (Fig. 16a), but the valva is typically narrower and with a less pronounced costal hump than in specimens from the rest of the range—see Burns (2000) for illustrations—and in these characters is intermediate towards Burnsius albezens Grishin, 2022 (type locality in USA: AZ, Cochise Co.); the wings are usually darker above (especially in females, Fig. 15b) with smaller white spots and areas, and with better-defined dark framing of ventral spots, bands, and veins; and a less olive, duller tone of the ventral bands. Due to significant and uncharacterized in many parts of the range individual variation, this subspecies is best identified by DNA, with diagnostic base pairs in the nuclear genome: aly18826.4.1:C138T, aly383.20.2:C864T, aly383.20.2:G1528T, aly383.20.2:C993T, aly1313.19.2:C189T, aly451.12.5:T86T (not G), aly276378.20.2:A24A (not G), aly276378.20.2:C57C (not T), aly276378.20.2:T60T (not C), aly 1656.6.2:C1106C (not G); but no COI barcode differences.</p><p>Barcode sequence of the holotype. Sample NVG-24064E07, GenBank PV892288, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACTTCTTTAAGTTTATTAATTCGAACTGAATTAGGAAATCCCGGCTCATTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCACATGCTTTCATTATAATTTTTTTTATAGTCATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATACTAGGAGCTCCAGATATAGCATTCCCCCGTA TAAATAACATAAGATTTTGATTATTACCCCCTTCATTAACATTACTTATTTCAAGAAGTATTGTAGAAAACGGTGCAGGAACTGGATGAACAGTTTACCCCCCATTATCAGCTAATATTGC TCATCAAGGTTCTTCTGTTGATTTAGCTATTTTTTCATTACATTTAGCAGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGTATTAGAAATTTATCA TTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGTATTACAGCTTTATTATTATTATTATCATTACCTGTTTTAGCAGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACAT CATTTTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT</p><p>Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 15a (genitalia Fig. 16a, b), bears the following four printed rectangular labels (handwritten text shown in italics), three white: [W. of Little Deschutes Riv. | near Crescent El. 4400' | Klamath Co, Oregon | August 21, 2004 | COLLECTORS JUNE | &amp; FLOYD PRESTON], [MGCL Accession | 2010-33 | J. &amp; F. Preston], [DNA sample ID: | NVG-24064E07 | c/o Nick V. Grishin], [genitalia: | NVG241111-10 | c/o Nick V. Grishin] and one red [HOLOTYPE ♂ | Burnsius communis | tenebrunis Grishin] .</p><p>Paratypes: 3♂♂ and 3♀♀: USA, J. &amp; F. Preston leg. [MGCL]: Oregon: 1♂ NVG-23058A02 Jackson Co., 3.2 mi S of OR-66 on Soda Mt. Rd., 5000’, 31-May-1996; Klamath Co., Deschutes National Forest, Little Deschutes River nr. Mowich, 4700 ’: 1♀ NVG-23058A06 29-Jun-2002 (Fig. 15b), 1♀ NVG-24064G09 27- Jun-2007, and 1♂ NVG-24064E08 29 -Jun-2008; and 1♂ NVG-23058A05 Lake Co., Warner Mts ., Fremont National Forest, FR3915 4.4 rd. mi S of Camas Creek, 6000’, 7-Jul-2008; and California : 1♀ NVG-23058A03 Del Norte Co., 2 rd. mi E of Rowdy Creek Rd. on Low Divide Rd., 1600’, 1-Sep-2001 .</p><p>Other specimens: Due to genetic similarity (Fig. 14), we currently attribute the following three sequenced specimens to this subspecies but exclude them from the type series, as they exhibit stronger phenotypic differences—being paler and larger—compared to the population at the type locality: British Columbia [CNC]: 1♂ NVG-24012E09, CNCLEP_00163304 Kaslo, 19-Jun-1900, J. W. Cockle (Fig. 15d) and 1♂ NVG-24012E08, CNCLEP_00163301 Fernie, 12-Jun-1934, H. B. Leech (Fig. 15c) and 1♀ NVG-23058A07 USA, Oregon, Wallowa Co., 12 road mi NE of Joseph, on road to Imnaha, 3700’, 26-Jul-2007, J. &amp; F. Preston leg. [MGCL].</p><p>Type locality. USA: Oregon, Klamath Co., Deschutes National Forest, west of Little Deschutes River, nr. Crescent, 4400’.</p><p>Etymology. In Latin, tenebrosus means dark, gloomy, or shadowy, and brunneus means brown. The name is formed as a fusion: tene [brosus] + brun [neus] + [commun] is, given for the darker and browner (not greener) aspect of this subspecies, and is treated as an adjective.</p><p>Distribution. From British Columbia (Canada), through Oregon to northwestern California (USA).</p></div>	https://treatment.plazi.org/id/421169606027B323FEC222095DD8BE68	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
42116960602AB323FE11272F5A50B8CB.text	42116960602AB323FE11272F5A50B8CB.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Burnsius communis subsp. altus Zhang & Cong & Shen & Song & Grishin 2025	<div><p>Burnsius communis altus Grishin, new subspecies</p><p>http://zoobank.org/ 5DF6A207-4270-414E-91DB-8104C19B2452 (Figs. 14 part, 15g –k, 16c–d)</p><p>Definition and diagnosis. Genomic analysis reveals that populations from the central Sierra Nevada, California, currently assigned to Burnsius communis communis (Grote, 1872) (type locality in USA: central Alabama), belong to a distinct and strongly supported (99%-100% ultra-fast bootstrap values) clade in the nuclear genome trees (together with the northwestern subspecies described above) genetically differentiated from others at the subspecies level (Fig. 14 magenta vs. green) and phenotypically different from them. Therefore, they represent a new subspecies that keys to “ Pyrgus communis communis ” (G.1.10(a)) in Evans (1953), but differs from it and other relatives by the following combination of characters: a costal fold in males; the harpe dorsally with two prongs (Fig. 16c) and the valva usually broader than in the northwestern new subspecies described above, with a pronounced costal hump typical of specimens from most of the range—see Burns (2000) for illustrations; the wings usually darker above with smaller white spots and areas (Fig. 15g –k), but paler than in the northwestern new subspecies (Fig. 15a–d), and with better-defined dark framing of ventral spots, bands, and veins; and a less olive, duller tone of the ventral bands. Due to significant and poorly characterized individual variation, this subspecies is best identified by DNA, with diagnostic base pairs in the nuclear genome: aly451.12.5:T86G, aly276378. 20.2:A24G, aly276378.20.2:C57T, aly276378.20.2:T60C, aly 1656.6.2:C1106G; but no barcode differences.</p><p>Barcode sequence of the holotype. Sample NVG-23057F09, GenBank PV892289, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACTTCTTTAAGTTTATTAATTCGAACTGAATTAGGAAATCCCGGCTCATTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCACATGCTTTCATTATAATTTTTTTTATAGTCATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATACTAGGAGCTCCAGATATAGCATTCCCCCGTA TAAATAACATAAGATTTTGATTATTACCCCCTTCATTAACATTACTTATTTCAAGAAGTATTGTAGAAAACGGTGCAGGAACTGGATGAACAGTTTACCCCCCATTATCAGCTAATATTGC TCATCAAGGTTCTTCTGTTGATTTAGCTATTTTTTCATTACATTTAGCAGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGTATTAGAAATTTATCA TTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGTATTACAGCTTTATTATTATTATTATCATTACCTGTTTTAGCAGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACAT CATTTTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT</p><p>Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 15g, (genitalia Fig. 16c, d), bears the following six printed rectangular labels, five white: [CALIF.: Tuolumne Co. | 4 mi. S of Mill Creek | at CA Hwy. 108, 6500 | ft.; 30.vi.1987 | L.D. &amp; J.Y. Miller | sta. no. 4], [Allyn Museum | Acc. 1987–8], [DNA sample ID: | NVG-23057F09 | c/o Nick V. Grishin], [DNA sample ID: | NVG-24067E03 | c/o Nick V. Grishin], [genitalia: | NVG241111-29 | c/o Nick V. Grishin] and one red [HOLOTYPE ♂ | Burnsius communis | altus Grishin]. The first DNA sample refers to the extraction from a leg (sequenced) and the second is from the abdomen (stored) prior to genitalia dissection . Paratypes: 3♂♂ and 3♀♀: USA, California: Placer Co., B. O’Hara leg. [MGCL]: 1♂ NVG-23058D09 Soda Springs Rd. 2.9- 4.1 mi S. of Donner Pass Rd., 27-Jul-1992 and 1♂ NVG-23058D08 Squaw Valley Ski Area, 8200-8500’, 6-Jun-1994; El Dorado Co. [CNC] : 1♂ NVG-24012E04, CNCLEP_00163011 Fallen Leaf, 13-Jul-1961, J. G. Chillcott leg. (Fig. 15j) and 1♀ NVG-24012E05, CNCLEP_00163017 Echo Lake, 13-Jul-1961, B. H. Poole leg (Fig. 15k); and Tuolumne Co., Stanislaus National Forest, 21-Jul-2022, W. R. Dempwolf leg. [WRD] : 1♀ NVG-23032C11, WRD 22431 near Niagara Campground, 6870’, 38.320 6, −119.911 4 (Fig. 15i) and 1♀ NVG-23032C12, WRD 22432 near Mill Creek Campground, 6525’, 38.312 6, −119.939 8 (Fig. 15h) .</p><p>Type locality. USA: California, Tuolumne Co., 4 mi south of Mill Creek at SR 108, elevation 6500 ft.</p><p>Etymology. In Latin, altus means high, deep, or tall, and is given for the typical habitat of this subspecies at higher elevations. The name is an adjective.</p><p>Distribution. Currently known from the central Sierra Nevada in California, USA (Placer, El Dorado, and Tuolumne Counties), where it comes close to and may overlap at times with the nominate subspecies, especially at lower elevations.</p></div>	https://treatment.plazi.org/id/42116960602AB323FE11272F5A50B8CB	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
42116960602BB322FEA326015C7DBDCF.text	42116960602BB322FEA326015C7DBDCF.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Heliopetes (Heliopetes) acuta Grishin 2024	<div><p>Additional specimens of Heliopetes (Heliopetes) acuta Grishin, 2024</p><p>confirm it as a species-level taxon</p><p>Genomic analysis of Heliopetes Billberg, 1820 (type species Papilio niveus Cramer, 1775, which is a junior subjective synonym of Papilio arsalte Linnaeus, 1758) reveals four additional specimens of Heliopetes (Heliopetes) acuta Grishin, 2024 (type locality Mexico, Oaxaca, Candelaria Loxicha), all from the type locality and collected by E. C. Welling (Fig. 17 red), thus confirming that it is a species-level taxon and not an unusual single specimen. In all three trees, H. acuta is sister to the clade consisting of three species: Heliopetes (Heliopetes) lana Grishin, 2023 (type locality in Guatemala), Heliopetes (Heliopetes) alana (Reakirt, 1868) (type locality in Colombia), and Heliopetes (Heliopetes) chimbo Evans, 1953 (type locality in Ecuador: Chimbo), and, therefore, is the most distinct species in this group. Here, we illustrate male genitalia of H. acuta (Fig. 18) and they differ from those of H. lana, a species closest in distribution or possibly even sympatric with it (see figs. 302–303 in Zhang et al. (2023a) for its genitalia photographs), by a terminally rounder and flatter (shell-shaped in the dorsal half) harpe, which is not prominently turning inward and bears coarser serrations mostly along its dorsoposterior margin; a more robust ampulla; and slightly narrower, more separated uncus arms.</p></div>	https://treatment.plazi.org/id/42116960602BB322FEA326015C7DBDCF	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
421169606028B326FE46261D592ABE9F.text	421169606028B326FE46261D592ABE9F.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Ochlodes (Ochluma) sylvanoides (Boisduval 1852)	<div><p>Ochlodes (Ochluma) sylvanoides group</p><p>Previously treated as a single species Ochlodes sylvanoides (Boisduval, 1852) (type locality in USA: California, Plumas Co.), this species group is currently placed in the subgenus Ochluma Grishin, 2025 (type species Hesperia yuma W. H. Edwards, 1873) and, as here defined, consists of three genetically differentiated species: Ochlodes (Ochluma) santacruza J. Scott, 1981 (type locality USA: California, Santa Barbara Co., Santa Cruz Island), O. sylvanoides, and Ochlodes (Ochluma) napa (W. H. Edwards, 1865) (type locality in USA: Colorado, Clear Creek Co.) (Zhang et al. 2023b). We expanded genomic sequencing of this group by sampling additional specimens across the range from southwestern Canada through all 13 western states of the USA to Baja California, Mexico (Fig. 19). The results confirm the phylogenetic separation of the group into three species and reveal additional insights, some of which are unexpected.</p><p>First, the nominate subspecies of O. napa (Fig. 19 yellow circles) is restricted to the mountainous region of Colorado and its immediate neighborhood in southeastern Wyoming, eastern Utah, and northern New Mexico. Second, Ochlodes (Ochluma) napa kaibab Grishin, 2023 (type locality in USA: Arizona, Coconino Co.) (Fig. 19, blue circles) has a much wider distribution than anticipated and spreads as a narrow strip north from the type locality through central Utah, reaching northwestern Wyoming. This subspecies of O. napa, genetically differentiated from the nominate, represents populations between it and neighboring O. sylvanoides while being phylogenetically associated with the former. It is also possible that the populations of O. napa in Wyoming, Utah, and</p><p>Arizona are best partitioned into several subspecies. They have different, albeit more closely related, mitogenome haplotypes (Fig. 20b) and show different levels of introgression with other taxa. For instance, specimens of O. napa kaibab from Emery County, Utah, introgress stronger with O. napa napa and thus are placed near the base of the nuclear genome tree (Fig. 20a) and possess mitochondrial genomes of O. napa napa . Nevertheless, specimens shown as blue circles in Fig. 19 are in the clade with O. napa kaibab, and we presently treat them as this subspecies. Furthermore, the populations of O. napa kaibab in Utah are coming close to and may even be sympatric with O. sylvanoides, a question to be addressed in future studies.</p><p>Third, paler-colored populations to the west of the main Rocky Mountains chain north of Central Wyoming (Fig. 19 magenta and violet squares) traditionally associated with O. napa do not belong to this species and are O. sylvanoides instead. Due to their wing pattern differences that resulted in this misidentification, these populations are described below as two new subspecies that are somewhat differentiated genetically from other O. sylvanoides populations. These populations of O. sylvanoides are geographically close to O. napa kaibab in northwestern Wyoming and south-central Montana, another region to study interactions between the two species O. napa and O. sylvanoides .</p><p>Fourth, phylogenetic analysis did not reveal prominent genetic differences of previously described O. sylvanoides subspecies: Ochlodes sylvanoides orecoasta J. Scott, 1981 (type locality in USA: Oregon, Clatsop Co.), Ochlodes sylvanoides bonnevilla J. Scott, 1981 (type locality in USA: Nevada, Elko Co.), and Ochlodes sylvanoides omnigena Austin, 1998 (type locality in USA: Nevada, Lander Co.). While we do not propose synonymizing these subspecies, studies of their distinction are beyond the scope of this work and will be addressed in future research. Here, all these populations combined are shown as green squares in Fig. 19.</p></div>	https://treatment.plazi.org/id/421169606028B326FE46261D592ABE9F	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
42116960602FB325FE9B245159E2BD29.text	42116960602FB325FE9B245159E2BD29.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Ochlodes (Ochluma) sylvanoides subsp. paranapa Zhang & Cong & Shen & Song & Grishin 2025	<div><p>Ochlodes (Ochluma) sylvanoides paranapa Grishin, new subspecies</p><p>http://zoobank.org/ ADC1FE05-7B71-4C9D-B788-64E7A2F82FE2 (Figs. 19 part, 20 part, 21b–d)</p><p>Definition and diagnosis. Genomic analysis reveals that populations from the northeastern part of the range, historically identified as Ochlodes napa (W. H. Edwards, 1865) (type locality in USA: Colorado, Clear Creek Co.), are not in the same clade with this species but instead belong to Ochlodes (Ochluma) sylvanoides (Boisduval, 1852) (type locality in USA: California, Plumas Co.), being genetically differentiated from others at the subspecies level (Fig. 20a magenta and violet). While their COI barcodes (or mitogenomes, Fig. 20b) do not consistently differ, these populations together form a distinct moderately supported (88% bootstrap value) clade in the nuclear genome tree (Fig. 20a) that partitions into two more strongly supported subclades: northeastern (Fig. 20a violet, 93% bootstrap) and southwestern (Fig. 20a magenta, 100% bootstrap). The southwestern clade is most strongly differentiated genetically (longer branch) and supported statistically (100%) encompassing specimens from a wide geographical area spanning three states (Montana, Wyoming, and South Dakota) (Fig. 19 magenta). In addition to differences in DNA, these specimens are characterized by phenotypic differences from the nominate subspecies (due to which they were misidentified as O. napa), and, therefore, represent a new subspecies of O. sylvanoides . This new subspecies keys to “ Ochlodes sylvanoides napa ” (M.19.2(c)) in Evans (1955), but differs from it and other relatives by the following combination of characters: paler below, with a weaker pattern (Fig. 21b–d) than typical for the nominate subspecies (Fig. 21a), i.e., brown borders above are narrower, paler, and more diffuse at the edges; the ventral side is yellower (instead of redder) and usually with a more weakly defined brownish or reddish pattern, but typically more prominent than in O. napa (Fig. 21g –j) postdiscal pale bands on both wings; dorsally slightly darker than O. napa, with a stronger contrast between brown and orange areas and broader dorsal hindwing brown margins with more strongly developed brown overscaling over the orange areas between inverted brown triangles. Due to extensive individual variation in wing patterns, this subspecies is best identified by DNA, with diagnostic base pairs in the nuclear genome: aly275184.2.3:C501T, aly275184.2.3:C885T, aly 2085.1.10: A675G, aly 2085.1.10:C678T, aly 1846.1.1:C185A; and the COI barcode does not distinguish this subspecies from others.</p><p>Barcode sequence of the holotype. Sample NVG-24126C06, GenBank PV892290, 658 base pairs: AACTTTATACTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGTTTATTAATTCGTACAGAATTAGGTAATCCAGGATCTTTAATTGGCGATGACCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCTCCTGATATAGCATTTCCTCGAA TAAATAATATAAGATTTTGAATATTACCTCCTTCATTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACTGGTTGAACAGTATATCCTCCTTTATCTTCTAATATTGC TCACCAAGGATCTTCTGTTGATTTAGCAATTTTTTCTCTTCATTTAGCTGGTATTTCATCTATTCTAGGAGCTATTAATTTTATTACAACAATTATCAATATACGAATTAAAAACTTATCA TTTGATCAAATACCCTTATTTGTATGATCAGTAGGTATTACAGCATTATTATTATTATTATCTTTACCTGTATTAGCAGGTGCTATTACAATATTACTTACTGATCGAAATTTAAATACTT CTTTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT</p><p>Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 21b, bears the following five printed (handwritten text in italics) rectangular labels, four white: [WY WASHAKIE Co. | T47N R86W S5 | Tensleep Reserve | 6400' 11-12.viii.98], [Allyn Museum | Acc. 1998-15], [ Ochlodes sylvanoides | (Boisduval, 1852) ♂ | Det. S.R. Steinhauser], [DNA sample ID: | NVG-24126C06 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Ochlodes sylvanoides | paranapa Grishin]. Paratypes: 4♂♂ and 1♀ from USA in MGCL: Montana, Big Horn Co .: 1♂ NVG-24126B10 foothills of Pryor Mts ., along Sage Creek, 5550’, 45.227 2, −108.585 6, 13-Aug-1997, Chuck &amp; Chris Harp leg. (Fig. 21c) and 1♀ NVG-24126B12 25 mi SW of Lodge Grass, 6-Sep-1971, Jack Harry leg.; 1♂ NVG-24126C01 Wyoming, Big Horn Co., Red Grade Spring, 5000’, 13-Aug-1954; and South Dakota : 1♂ NVG-24127A08 Butte Co., USH212 at mi 17, ca. 2 mi E of Belle Fourche, 3-Aug-1983, D. L. Eiler leg. (Fig. 21d) and 1♂ NVG-24127A07 Lawrence Co., no locality details, 27-Aug-1969, M. L. May .</p><p>Type locality. USA: Wyoming, Washakie Co., Bighorn Mountains, Tensleep Preserve, elevation 6400 ft.</p><p>Etymology. The name reflects a superficial resemblance between O. napa and this new subspecies of O. sylvanoides, as it parallels O. napa but occurs at more northern latitudes. The name is treated as a noun in apposition.</p><p>Distribution. Currently known from east of the main Rocky Mountain chain in Montana and Wyoming, and from South Dakota.</p></div>	https://treatment.plazi.org/id/42116960602FB325FE9B245159E2BD29	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
42116960602DB31BFEA2261D5A08BEBC.text	42116960602DB31BFEA2261D5A08BEBC.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Ochlodes (Ochluma) sylvanoides subsp. dempwolfi Zhang & Cong & Shen & Song & Grishin 2025	<div><p>Ochlodes (Ochluma) sylvanoides dempwolfi Grishin, new subspecies</p><p>http://zoobank.org/ F27AE8D7-F5DA-4B7F-B444-A3343470021A (Figs. 19 part, 20 part, 21e–f)</p><p>Definition and diagnosis. Genomic analysis reveals that populations from the northeastern part of the range, historically identified as Ochlodes napa (W. H. Edwards, 1865) (type locality in USA: Colorado, Clear Creek Co.), are not in the same clade with this species but instead belong to Ochlodes (Ochluma) sylvanoides (Boisduval, 1852) (type locality in USA: California, Plumas Co.), being genetically differentiated from others at the subspecies level (Fig. 20a violet and magenta). While their COI barcodes (or mitogenomes, Fig. 20b) do not consistently differ, these populations together form a distinct moderately supported (88% bootstrap value) clade in the nuclear genome tree (Fig. 20a) that partitions into two more strongly supported subclades: northeastern (Fig. 20a violet, 93% bootstrap) and southwestern (Fig. 20a magenta, 100% bootstrap). The southwestern clade represents a new subspecies described above. Its sister, the northeastern clade, includes specimens from a wider geographical area from southern Alberta and Saskatchewan in Canada, to North Dakota in the U.S. (Fig. 19 violet). These specimens are characterized by phenotypic and genetic differences from other subspecies of O. sylvanoides and, therefore, represent a new subspecies. This new subspecies keys to “ Ochlodes sylvanoides napa ” (M.19.2(c)) in Evans (1955), but differs from it and other relatives by being intermediate in appearance between the nominate and the new subspecies described above or O. napa: both sides of wings are paler than a typical nominate specimen (Fig. 21a), but the marginal brown areas above are also rather wide and more prominently scalloped, with sharply defined edges on the forewing and more diffuse on the hindwing; the ventral hindwing with muted reddish-brown ground color, which is less bright than in the nominate subspecies, but darker than in O. sylvanoides paranapa ssp. n. (Fig. 21b– d) and both darker and redder than in O. napa (Fig. 21g –j); and the dorsal pattern of orange bands of spots is unique in terms of each spot being slightly yellower in the middle and more orange around, instead of uniformly toned, as in other subspecies. Due to extensive individual variation in wing patterns, this subspecies is best identified by DNA, with diagnostic base pairs in the nuclear genome: aly848.2.60: G48A, aly25.8.2:C84T, aly25.8.2:C87T, aly935.4.26:G54A, aly935.4.26:C67T; and the COI barcode does not distinguish this subspecies from others.</p><p>Barcode sequence of the holotype. Sample NVG-23032D05, GenBank PV892291, 658 base pairs: AACTTTATACTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGTTTATTAATTCGTACAGAATTAGGTAATCCAGGATCTTTAATTGGCGATGACCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCTCCTGATATAGCATTTCCTCGAA TAAATAATATAAGATTTTGAATATTACCTCCTTCATTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACTGGTTGAACAGTATATCCTCCTTTATCTTCTAATATTGC TCACCAAGGATCTTCTGTTGATTTAGCAATTTTTTCTCTTCATTTAGCTGGTATTTCATCTATTCTAGGAGCTATTAATTTTATTACAACAATTATCAATATACGAATTAAAAACTTATCA TTTGATCAAATACCCTTATTTGTATGATCAGTAGGTATTACAGCATTATTATTATTATTATCTTTACCTGTATTAGCAGGTGCTATTACAATATTACTTACTGATCGAAATTTAAATACTT CTTTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT</p><p>Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 21e, bears the following five printed rectangular labels, four white: [ND: Slope Co. elev 2560' | East River Road, approximately | 1.75 miles from Burning Coal | Vein Campground 46° 35' 51.1" | N, 103° 27' 24.5" W August 23, | 2023 Leg: W. R. Dempwolf], [ Ochlodes sylvanoides | napa | ♂ | Coll of: W R Dempwolf], [DNA sample ID: | NVG-23032D05 | c/o Nick V. Grishin], [WRD 23,554], and one red [HOLOTYPE ♂ | Ochlodes sylvanoides | dempwolfi Grishin] . Paratypes: 1♂ and 3♀♀: from USA, North Dakota, Slope Co. data as the holotype except as indicated, [WRD]: 1♂ NVG-23032D06, WRD 23555 22-Aug-2023, 1♀ NVG-23032D02, WRD 23551; 1♀ NVG-23032D03; WRD 23552 (Fig. 21f); and 1♀ NVG-23032D04, WRD 23553 East River Road, ca. 18 mi south of Medora, 2647’, 46.698 861, −103.487 417, 22-Aug-2023 .</p><p>Other specimens: Due to genetic similarity (Fig. 20), we currently attribute the following three sequenced specimens from Canada in the CNC to this subspecies but exclude them from the type series because they exhibit some differences compared to the population at the type locality: Alberta: 1♂ NVG-24014A07, CNCLEP 00169968 Taber, 49.787 3, −112.149 0, 16-Aug-1996, T. Pike leg. and 1♀ NVG-24014A06, CNCLEP 00169953 Hwy 880 &amp; US border, 49.000 0, −111.266 7, 16-Aug-1998, R. A. Layberry leg. and 1♂ NVG-24014A05, CNCLEP 00169950 Saskatchewan, Val Marie, 49.246 4, −107.728 3, 10-Aug-1983, R. Hooper leg.</p><p>Type locality. USA: North Dakota, Slope Co., East River Road, ca. 1.75 mi from Burning Coal Vein Campground, elevation 2560’, GPS 46.597 5, −103.4568.</p><p>Etymology. The name, a noun in the genitive case, honors Bill Dempwolf, the collector of the type series and a friend of the author. An exceptional lepidopterist, Bill is recognized for meticulously curating and assembling one of the finest collections. His generosity has been instrumental in our genomic studies, manifested through both dedicated specimen collection for our lab research and open access to his entire collection for leg sampling and sequencing. His profound contributions to our projects are highly significant and greatly appreciated.</p><p>Distribution. Northeastern parts of the range, east of the Rockies from Alberta and Saskatchewan in Canada to North Dakota in the U.S.</p></div>	https://treatment.plazi.org/id/42116960602DB31BFEA2261D5A08BEBC	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
421169606012B31AFE50247C5D67BC8F.text	421169606012B31AFE50247C5D67BC8F.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Thespieus grandosul Zhang & Cong & Shen & Song & Grishin 2025	<div><p>Thespieus grandosul Grishin, new species</p><p>http://zoobank.org/ 8E47C852-82A8-4841-B2E0-85DE20E52512</p><p>(Figs. 22 part, 23)</p><p>Definition and diagnosis. Genomic analysis reveals that a specimen from Rio Grande do Sul, Brazil, is sister in the nuclear genome (autosomes) tree to the sympatric Thespieus ethemides (Burmeister, 1878) (type locality in Argentina: Corrientes), but is genetically differentiated from it at the species level (Fig. 22a); e.g., their COI barcodes differ by 3.8% (25 bp), and, therefore, represents a new species. In the Z chromosome and the mitochondrial genome trees (Fig. 22b, c), this new species is sister to Thespieus dalman (Latreille, [1824]) (type locality in Brazil) and is phenotypically more similar to it, thus keying to T. dalman (O.7.4) in Evans (1955), but differs from both T. dalman and T. ethemides by larger hyaline spots, e.g., on the hindwing, the spot in the cell CuA 1 -CuA 2 is longer than wide and starts from the base of the vein CuA 1, and the base of the cell CuA 1 -CuA 2 (basad of the spot) is paler brown, not nearly black as the rectangle distad of the spot. Due to its cryptic nature and unexplored individual variation, this species is best identified by DNA, with diagnostic base pairs in the nuclear genome: aly159.13.2:G66A, aly1019. 14.13:G165A, aly383.29.15:T210C, aly536.75.1:C2445T, aly3507.14.4:C1098T, aly3446.4.1:A21A (not T), aly638.29.3:G120G (not T), aly994.6.3:C132C (not T), aly 2275.10.7:T120T (not C), aly525.73.10: G153G (not A); and the COI barcode: T46T, C59C, T460T, T514C, A628G.</p><p>Barcode sequence of the holotype. Sample NVG-23109G03, GenBank PV892292, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCATTAAGATTACTAATTCGTACAGAATTAGGTAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTCGGAAATTGATTAATCCCATTAATATTAGGAGCCCCTGATATAGCTTTTCCTCGAA TAAATAATATAAGATTTTGAATATTACCCCCCTCTTTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACTGGATGAACAGTTTATCCACCTTTATCTTCTAATATTGC TCATCAAGGATCTTCAGTAGATTTAGCAATCTTTTCTCTTCATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAACATACGAATTAAAAATTTATCA TTTGATCAAATACCTTTATTTGTATGATCCGTAGGTATTACAGCATTATTATTACTTTTATCTTTACCTGTATTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTT CTTTTTTTGATCCTGCAGGAGGGGGAGATCCAATTTTATATCAACATTTATTT</p><p>Type material. Holotype: ♂ deposited in the Carnegie Museum of Natural History, Pittsburgh, PA, USA (CMNH), illustrated in Fig. 23, bears the following five printed rectangular labels, four white: [Rio Grande | do Sul], [692.], [Lindsay Collection | C. M. Acc. No. 8584], [DNA sample ID: | NVG-23109G03 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Thespieus | grandosul Grishin].</p><p>Type locality. Brazil: Rio Grande do Sul.</p><p>Etymology. The name is given for the type locality, [Rio] Gran [de] + do + Sul, and is treated as a noun in apposition.</p><p>Distribution. Currently known only from the holotype collected in Rio Grande do Sul, Brazil.</p></div>	https://treatment.plazi.org/id/421169606012B31AFE50247C5D67BC8F	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Update to: Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (6): 1-36, DOI: 10.5281/zenodo.16570612
