taxonID	type	description	language	source
20298794FF91FFAAFE0E70A16B4D9024.taxon	description	We see that, although the Godart's description of P. temenes is brief, two of its details agree better with H. aristodemus than with the broad-banded subspecies of H. ponceana from Cuba: crisscrossing bands and blue flexuous band. In the broad-banded subspecies, the outer band is more parallel to the inner band and does not give an impression of crossing it. And the blue spots on the hindwing underside look more like a row of lunules than an irregular blue band. In H. aristodemus, forewing bands indeed give an impression of crossing bands, and the blue spots on the hindwing below look like an irregular blue band. Furthermore, an extended description of P. temenes on page 63 states that the forewing bands are narrow and macular (" étroites, maculaires ") (Godart 1819), instead of being broad and continuous. Besides this additional detail, the extended description reiterates other points of the short description. We note that some H. aristodemus females may have broader and more continuous yellow bands that are more similar to those in H. ponceana (Fig. 2 e), but the P. temenes description does not mention this possibility, simplifying the application of the name. Next, we inspected all potential syntypes of P. temenes, two specimens in Paris, France (Fig. 2 ab) and one (only photograph inspected) in Edinburg, UK (Bland 2019). These 3 specimens closely agree with the original description of P. temenes, carry historical labels and labels indicating their type status (" type ", " co-type ", or "? co-type ") and therefore are likely to be true syntypes of this taxon. These specimens phenotypically are H. aristodemus and not H. ponceana, differing from the broad-banded subspecies from Cuba. Furthermore, we sequenced two syntypes in Paris (one labeled " TYPE ", the other labeled " CO-TYPE ") and they are H. aristodemus by genomic DNA (Fig. 1 blue), in agreement with their wing patterns. In conclusion, our analysis of the original description and the likely syntypes leaves little doubt about the identity of P. temenes as H. aristodemus, which is a species different from the broad-banded H. ponceana " temenes " found on Cuba today (Fig. 1 red). Due to misapplication of the name temenes to a taxon different from that in the original description and for the future stability of the name, we designate the syntype in the Muséum National d'Histoire Naturelle, Paris, France (MNHP) shown in Fig. 2 a and possessing all the characters stated in the original description, with the following 4 rectangular white (some faded to brownish) labels: printed red || TYPE ||; framed, lined and printed with green, first line handwritten in black || Anc. Collection | MUSÉUM DE PARIS ||; printed, with a square barcode on the right side || MNHN, Paris | EL 63126 ||; printed || DNA sample ID: | NVG- 18079 F 07 | c / o Nick V. Grishin ||, the lectotype of Papilio temenes Godart, 1819. The red, rectangular, printed label || LECTOTYPE ♂ | Papilio temenes | Godart, 1819 | designated by Grishin || will be added to this specimen. This specimen was chosen as the lectotype because it is labeled " type " rather than " co-type ", and it yielded genomic dataset of a good quality for a specimen that old. It appears that Oberthür (1897) was the first to incorrectly apply the name P. temenes to the broad-banded subspecies of H. ponceana from Cuba, inconsistently with the original description and now with the identity of the lectotype of P. temenes. Oberthür illustrated one such specimen. While we have not investigated the reasons behind Oberthür's mistake, we note that it has been followed in subsequent literature. Interestingly, we found 3 century-old H. aristodemus (i. e. true P. temenes) specimens labeled " Cuba ", in ZMHB and FMNH (Fig. 2 c – e). Further studies may answer the question whether both species (H. aristodemus and H. ponceana) co-occurred in Cuba, or the old records from Cuba were mislabeled. In summary, we conclude that Papilio temenes Godart, 1819, syn. n., is a junior subjective synonym of Heraclides aristodemus (Esper, 1794). The type locality of temenes should remain as stated on page 63 (Godart 1819): " Antilles & dans l'Amérique septentrionale ", i. e., " West Indies and North America ", which is not necessarily Cuba. It remains to be investigated whether H. aristodemus has been found or still occurs in Cuba. In any case, as detailed above, the broad-banded subspecies of H. ponceana from Cuba does not have a name, and it is described here as new.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Opler, Paul A., Grishin, Nick V. (2020): Genomic evidence suggests further changes of butterfly names. The Taxonomic Report of the International Lepidoptera Survey 8 (7): 1-41
20298794FF9FFFABFED373476D2991F2.taxon	description	Definition. This taxon differs from H. aristodemus in that the outer band of yellow spots on the forewing is more parallel to the inner band (and the outer margin) rather than approaching the inner band at an angle and giving an appearance of crossing the inner band; on the hindwing below there are more prominent red spots and more crescent-shaped blue spots that are better separated from each other, rather than forming a continuous band. This subspecies differs from all other H. ponceana subspecies by broader yellow central bands on both wings, less extensive brown coloration on the forewings below, a paler basal area and the lack of red spotting in the postdiscal area on hindwing above.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Opler, Paul A., Grishin, Nick V. (2020): Genomic evidence suggests further changes of butterfly names. The Taxonomic Report of the International Lepidoptera Survey 8 (7): 1-41
20298794FF9FFFABFED373476D2991F2.taxon	materials_examined	Type locality. Cuba: Guantánamo province, Rio Seco, San Carlos Estate.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Opler, Paul A., Grishin, Nick V. (2020): Genomic evidence suggests further changes of butterfly names. The Taxonomic Report of the International Lepidoptera Survey 8 (7): 1-41
20298794FF9FFFABFED373476D2991F2.taxon	distribution	Distribution. Known only from Cuba.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Opler, Paul A., Grishin, Nick V. (2020): Genomic evidence suggests further changes of butterfly names. The Taxonomic Report of the International Lepidoptera Survey 8 (7): 1-41
20298794FF9FFFABFED373476D2991F2.taxon	etymology	Etymology. The broad yellow bands are the most distinctive feature of this subspecies. The name is formed from the Latin words latus (wide, broad) and fascia (band, stripe). The name is an adjective.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Opler, Paul A., Grishin, Nick V. (2020): Genomic evidence suggests further changes of butterfly names. The Taxonomic Report of the International Lepidoptera Survey 8 (7): 1-41
20298794FF9FFFABFED373476D2991F2.taxon	materials_examined	Type material. Holotype male (Fig. 2 g), deposited in the American Museum of Natural History, New York, NY, USA (AMNH), with the following 4 rectangular white (some faded to brownish) labels: printed, the date crossed out || San Carlos Est. | Guantanamo | Cuba. 4 - 8 X ' 13 ||; handwritten || May 1 ' 00 ||; printed with the numbers handwritten || Am. Mus. Nat. Hist. | Dept. Invert. Zool. | No. 20976 ||; printed || DNA sample ID: | NVG- 14101 H 09 | c / o Nick V. Grishin ||. The red, rectangular, printed label || HOLOTYPE ♂ | Heraclides ponceana | latefasciatus Grishin || will be added to this specimen. Ten paratypes (when known, localities are given in parenthesis after specimen numbers): 5 males (NVG- 14101 H 10 in AMNH and NVG- 14106 A 11 (Matanzas), NVG- 14106 A 12 (Santiago), NVG- 14106 B 01 (Guantanamo) & NVG- 14106 B 02 in USNM) and 5 females (NVG- 14114 B 09 & NVG- 14114 B 10 in LACM and NVG- 14106 B 03 & NVG- 15104 A 01 (both from Santiago) & NVG- 15104 A 02 in USNM). Barcode sequence of the holotype. AACATTATATTTTATTTTTGGTGTTTGAGCAAGAATATTAGGAACTTCTCTTAGTTTATTA ATTCGAACTGAATTAGGAACTCCAGGTTCTTTAATTGGAGATGATCAAATTTATAATACCATTGTTACAGCTCATGCTTTTATTATAATTTTTT TTATGGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCATTAATATTAGGAGCCCCTGATATAGCTTTCCCTCGAATAAATAA TATAAGATTTTGACTTTTACCTCCTTCTTTAACTCTTTTAATTTCAAGTATAATTGTCGAAAATGGAGCTGGAACTGGATGAACTGTTTATCCT CCCCTTTCTTCTAATATTGCTCATGGAAGAAGTTCAGTAGATTTAGTTATTTTTTCTCTTCATTTAGCGGGTATTTCTTCAATTTTAGGAGCAA TTAATTTTATTACTACTATTATTAACATGCGAATTAATAGAATATCCTTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCTTT ATTATTACTCTTATCCTTACCCGTTTTAGCTGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTTCATTCTTTGATCCTGCAGGA GGAGGAGATCCTATTCTATACCAACACTTATTT Instead of proposing a new name for the Cuban broad-banded subspecies of H. ponceana, we entertained a possibility to request ICZN to designate one such specimen as the neotype of P. temenes, consistent with the current usage of this name, but contrary to the original description and the identity of three extant syntypes. However, we decided against this route for the following reasons. First, the name H. a. temenes is not in very wide use being applied to an uncommon endemic of a single island to warrant a special consideration by ICZN. Second, it seems most fair to respect original research that lead to creation of this name, and the original identity of this species that is quite clear even from its description alone (see above). Third, it is conceivable that the true P. temenes occurred (or even still occurs) in Cuba, and further research may show that it is not a synonym, but a valid subspecies of H. aristodemus, in which case it will be without a name if the neotype is designated to preserve the current usage of " temenes " as a subspecies of H. ponceana. It would create a nuisance situation when the original P. temenes would need a new name. Finally, a valid name that is suggestive of a diagnostic character (latefasciatus) has an advantage of being easier to attribute to the taxon (compared to temenes) and thus may be easier to remember.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Opler, Paul A., Grishin, Nick V. (2020): Genomic evidence suggests further changes of butterfly names. The Taxonomic Report of the International Lepidoptera Survey 8 (7): 1-41
20298794FF9EFFA8FDBB73576DE39024.taxon	description	The genomic tree of representative species of Anthocharis Boisduval, Rambur, [Duménil] & Graslin, [1833] (type species Papilio cardamines Linnaeus, 1758) including all type species of available genus-group names considered subgenera or junior subjective synonyms of Anthocharis revealed an unexpected but highly confident clade consisting of Anthocharis cethura C. & R. Felder, 1865 (type locality USA: California, Los Angeles Co.), Anthocharis midea (Hübner, [1809]) (type locality USA: Georgia, Wilmington Island) and Anthocharis limonea (A. Butler, 1871) (type locality Mexico) (Fig. 4 red). The clade is unexpected, because currently A. cethura is placed in the subgenus Anthocharis, while the Fig. 4. Subgenera Anthocharis (blue), Tetracharis (red) other two species are placed in the subgenus and Paramidea (green) with Euchloe as outgroups. Paramidea Kuznetsov, 1929 (type species: Anthocharis scolymus Butler, 1866). Curiously, neither of these species in the red clade are monophyletic with the type species of subgenera they are currently assigned to: A. (Anthocharis) cardamines is in the blue clade (Fig. 4) and A. (Paramidea) scolymus is in the green clade. Therefore, the current classification is incorrect. Out of genus-group names that are available for the red clade, Tetracharis Grote, 1898 (type species Anthocharis cethura C. & R. Felder, 1865) is older than Falcapica Klots, 1930 (type species Papilio genutia Fabricius, 1793, which is a junior homonym of Papilio genutia Cramer, 1779, the oldest available name for this species is Mancipium midea Hübner, [1809]). As a result, we treat Tetracharis as a valid subgenus, new status, that includes three species: A. cethura, A. midea, and A. limonea, making Falcapica its junior subjective synonym.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Opler, Paul A., Grishin, Nick V. (2020): Genomic evidence suggests further changes of butterfly names. The Taxonomic Report of the International Lepidoptera Survey 8 (7): 1-41
20298794FF9DFFAEFF6D75E06BE39621.taxon	description	The opposite extreme would be to find a meaningful level closest to the leaves of the tree that defines genera. Ideally, there would be situations in the tree where many lineages diverge at about the same level (i. e. at the same distance from the root, meaning at about the same time in the past) and then stay as single lineages for some time (i. e. form longer branches). This rapid diversification immediately followed by a relative lack of further diversification creates a level in the classification, i. e. the tree looks more like a bush or a comb than a bifurcating tree at that point. Taking the (largely) Nearctic group (Fig. 5 red), we see exactly this situation: at its base, this group diversifies into five prominent clades, and then two of these clades diversify further, also at approximately the same time point in the past. These five clades form a level in the tree and can be used as genera, offering the splitting solution. Notably, every one of these clades already has a genus-group name (Pelham 2008), including Palearctic Hyrcanana Bethune-Baker, 1914 (type species Polyommatus caspius Lederer, 1870). Apparently, these clades were also obvious from phenotypes: that is how they were defined and named to begin with (Scudder 1876; Klots 1936; Miller and Brown 1979). This level of classification can be propagated to other parts of the tree, although they are currently poorly covered by species. It is a meaningful level that can be chosen to define genera, but a significant number of such genera will be monotypic (e. g. two out of five in the Nearctic clade), and excepting knowledgeable aficionados of this group, such genera carry little information about their interrelationships. Hence, we looked for a compromise between the splitting and lumping solutions. Inspection of the tree reveals a rapid diversification point between its root and the diversification of the red clade (Fig. 5): i. e. orange-brown, cyan, magenta, blue and red + green clades diverged at approximately the same time in the past. This divergence is followed by the lack of immediate further divergence, creating long and prominent branches in the tree and resulting in a meaningful level for classification. We have chosen to take this intermediate level to suggest division of Lycaeninae into genera. Most of these genera are unambiguously apparent from the tree: black, purple, orange-brown, cyan, magenta, blue and red clades stand for seven genera, all of which have previously proposed names. Two instances require further elaboration. First, Heliophorus sena (Kollar, [1844]) stands out from the rest in the genus (Fig. 5 orange). The type species of subgenus Nesa Zhdanko, 1995, it may be a genus-level taxon. However, it is monophyletic with Heliophorus and we leave it there as a subgenus to emphasize this relationship, awaiting further studies. Second, Iophanus (Fig. 5 green) is at about the same divergence from the rest of Nearctic species (Fig. 5 red) as H. sena from other Heliophorus. For now, we decided to keep this monotypic genus, because it is currently treated as such, and because its earlier divergence time sets it apart from the rapid diversification of the red clade. The name for the red clade is Tharsalea Scudder, 1876 (type species Polyommatus arota Boisduval, 1852), as chosen by Klots (1936), probably because this name was proposed before others in the paper (Scudder 1876). In summary, we refrain from partitioning Lycaeninae into tribes and revise the status of the following names treating them as genera: Tharsalea Scudder, 1876, Helleia Verity, 1943 (type species Papilio helle Denis & Schiffermüller, 1775), Apangea Zhdanko, 1995 (type species Chrysophanus pang Oberthür, 1886) and Boldenaria Zhdanko, 1995. Furthermore, in agreement with previous studies (Sibatani 1974; van Dorp 2004; de Jong and van Dorp 2006), we conclude that the endemic South African species currently placed in Lycaena represent the 9 th genus of Lycaeninae that is named next. We are looking forward to testing this hypothesis with genomic data.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Opler, Paul A., Grishin, Nick V. (2020): Genomic evidence suggests further changes of butterfly names. The Taxonomic Report of the International Lepidoptera Survey 8 (7): 1-41
20298794FF9BFFAFFDE9756B6C7D965D.taxon	type_taxon	Type species. Papilio orus Stoll, [1780]. Definition. In male genitalia (Fig. 2 in de Jong and van Dorp 2006), differs from others in the subfamily Lycaeninae, except Melanolycaena, by a saccus-like pouch on juxta (Sibatani 1974); separated from Melanolycaena (Fig. 4 in Sibatani 1974) by juxta connected to valva at its more ventral part, as in other Lycaena. In wing patterns and shape, resembles a sympatric hairstreak Chrysoritis lycegenes (Trimen, 1874) (possible mimicry), i. e. wings are more rounded than most Lycaena and forewing black spots are closer to the margin, hindwing without tails and patterned more similar to Polyommatinae than to most Lycaena: pale-brown with darker marginal lunules and with paler spots usually darker in the middle.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Opler, Paul A., Grishin, Nick V. (2020): Genomic evidence suggests further changes of butterfly names. The Taxonomic Report of the International Lepidoptera Survey 8 (7): 1-41
20298794FF9BFFAFFDE9756B6C7D965D.taxon	etymology	Etymology. The name is a masculine noun in the nominative singular, formed as L [ycaen] a + [A] fr [ica] + on to indicate African origin of the genus and reach gender agreement with the type species name. Species included. The type species and Lycaena clarki Dickson, 1971, both from South Africa. Parent taxon. Subfamily Lycaeninae [Leach], [1815].	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Opler, Paul A., Grishin, Nick V. (2020): Genomic evidence suggests further changes of butterfly names. The Taxonomic Report of the International Lepidoptera Survey 8 (7): 1-41
20298794FF9BFFAFFDE9756B6C7D965D.taxon	description	Lycaeninae genera, subgenera and their available synonyms Here, we update the Appendix of Sibatani (1974) and suggest the following treatment of Lycaeninae grouped into nine genera. Placements of Lafron Grishin, gen. n. and Phoenicurusia Verity, 1943 are provisional due to the lack of both genomic data and unambiguous phenotypic evidence, and follow published works based on morphology and limited DNA analysis (Klots 1936; Sibatani 1974; van Dorp 2004; de Jong and van Dorp 2006). The list is preliminary and further changes are expected in groups poorly covered by our genome-based phylogeny. Junior subjective synonyms are preceded by " = ". Unavailable names are not listed. Type species are given in parenthesis with their original genus name. Genus Lafron Grishin, gen. n. (Papilio orus Stoll, [1780]) Genus Lycaena [Fabricius], 1807 (Papilio phlaeas Linnaeus, 1760) Subgenus Lycaena [Fabricius], 1807 (Papilio phlaeas Linnaeus, 1760) Subgenus Thersamolycaena Verity, 1957 (Papilio dispar Haworth, 1802) Subgenus Heodes Dalman, 1816 (Papilio virgaureae Linnaeus, 1758) = Loweia Tutt, 1906 (Papilio dorilis Hufnagel, 1766) = Thersamonia Verity, 1919 (Papilio thersamon Esper, 1784) = Palaeochrysophanus Verity, 1943 (Papilio hippothoe Linnaeus, 1760) = Alciphronia Koçak, 1992 (Papilio alciphron Rottemburg, 1775) = Mirzakhania Koçak, 1996 (Chrysophanus kasyapa F. Moore, 1865) Genus Helleia Verity, 1943 (Papilio helle Denis & Schiffermüller, 1775)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Opler, Paul A., Grishin, Nick V. (2020): Genomic evidence suggests further changes of butterfly names. The Taxonomic Report of the International Lepidoptera Survey 8 (7): 1-41
20298794FF9BFFAFFDE9756B6C7D965D.taxon	description	Subgenus Hyrcanana Bethune-Baker, 1914 (Polyommatus caspius Lederer, 1870) = Sarthusia Verity, 1943 (Polyommatus sarthus Staudinger, 1866) Subgenus Phoenicurusia Verity, 1943 (Polyommatus phoenicurus var. margelanica Staudinger, 1881) = Athamanthia Zhdanko, 1983; (Polyommatus athamantis Eversmann, 1854) Genus Iophanus Draudt, 1920 (Chrysophanus (?) pyrrhias Godman & Salvin, 1887) Genus Heliophorus Geyer, [1832] (= H. belenus Geyer, [1832], which is Polyommatus epicles Godart, [1824]) Subgenus Heliophorus Geyer, [1832] (= H. belenus Geyer, [1832], which is Polyommatus epicles Godart, [1824]) = Ilerda E. Doubleday, 1847 (Polyommatus epicles Godart, [1824]) = Kulua Zhdanko, 1995 (Polyommatus tamu Kollar, 1844) Subgenus Nesa Zhdanko, 1995 (Polyommatus sena Kollar, 1844) [not a homonym! Nesa Leach, 1818 is a misspelling] Genus Apangea Zhdanko, 1995 (Chrysophanus pang Oberthür, 1886)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Opler, Paul A., Grishin, Nick V. (2020): Genomic evidence suggests further changes of butterfly names. The Taxonomic Report of the International Lepidoptera Survey 8 (7): 1-41
20298794FF9AFFACFF3F75A66DC19555.taxon	description	Next, when a genomic dataset of an Old World species Favonius quercus (Linnaeus, 1758) was included in the Theclinae tree, it clustered closely with Hypaurotis (Fig. 6 top). The COI barcodes of H. crysalus and F. quercus differ by 4.7 % (31 bp). Because we lack genomic data for other genus-group names from the Thecla section of Eliot (Eliot 1973), we downloaded available COI barcode data from GenBank (Sayers et al. 2020). We find that while for most species pairs, e. g., H. crysalus and Favonius orientalis (Murray, 1875), the barcodes are more similar (6 %), for others, e. g., H. crysalus and Thecla betulae (Linnaeus, 1758) (the type species of Thecla Fabricius, 1807) the difference is larger (8.2 %). The COI barcode distance dendrogram computed using BioNJ (Gascuel 1997) as implemented by the phylogeny. fr server (Dereeper et al. 2008) reveals close clustering of species we propose to place in Hypaurotis (Fig. 6 bottom, red) and separation of T. betulae (green) from this cluster. In the absence of genomic data, this COI barcode analysis of their type species suggest that in addition to Habrodais Scudder, 1876 and Quercusia Verity, 1943 (type species Papilio quercus Linnaeus, 1758), the following four genus-group names Sibataniozephyrus Inomata, 1986 (type species Zephyrus fujisanus Matsumura, 1910), Neozephyrus Sibatani & Ito, 1942 (type species given as Thecla taxila Bremer, 1861, which was, however, a misidentified Dipsas japonica Murray, 1875; according to the Art 70.3.2. of the ICZN Code the actual taxonomic identity of this species is chosen and japonica is fixed as type species), Chrysozephyrus Shirôzu & Yamamoto, 1956 (type species Thecla smaragdina Bremer, 1861) and Favonius Sibatani & Ito, 1942 (type species Dipsas orientalis Murray, 1875) are junior subjective synonyms of Hypaurotis Scudder, 1876, which is a genus distinct from Thecla Fabricius, 1807. In accord with genetic similarities, all these species are similar in appearance (Eliot 1973). We expect that future studies will reveal additional synonyms and possibly a subgeneric structure of Hypaurotis. Finally, even from a practical standpoint of American butterfly knowledge, it seems more instructive to treat H. crysalus and H. grunus as congeneric emphasizing on their close kinship (despite apparent phenotypic dissimilarity), instead of placing them in two monotypic (or nearly monotypic) genera that accentuate their tenuous (but superficial) uniqueness. Finding their close relatives in the Old World places Hypaurotis among other Holarctic Theclinae genera such as Callophrys and Satyrium and emphasizes somewhat unusual but recurrent pattern revealing the connection between the Old and the New Worlds.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Opler, Paul A., Grishin, Nick V. (2020): Genomic evidence suggests further changes of butterfly names. The Taxonomic Report of the International Lepidoptera Survey 8 (7): 1-41
20298794FF99FFB2FE4176F86DB0907F.taxon	description	We think this find is particularly interesting for several reasons. First, it extends the range of Apodemia, previously not recorded from South America, to Peru, with all evolutionary and biogeographical implications of this fact. Second, it underscores the importance of a more comprehensive phylogenetic analysis before proposing new genus-group names to avoid creation of unnecessary synonyms (Trujano-Ortega et al. 2018; Trujano-Ortega et al. 2020). Third, it reiterates the power of genomic approaches and the value of the type concept, both in species and genus-group names. Sequencing of the syntype of the type species of the genus-group name Roeberella solidifies our conclusions, eliminating a possibility of misidentification or incorrect inference from a non-type species.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Opler, Paul A., Grishin, Nick V. (2020): Genomic evidence suggests further changes of butterfly names. The Taxonomic Report of the International Lepidoptera Survey 8 (7): 1-41
20298794FF86FFB1FDBE70676C15957A.taxon	description	Although the irene group is not strongly different from the hesperis group in Z chromosome, it is placed differently in the autosome tree: as sister to both hesperis and atlantis groups, rendering the species A. hesperis that includes irene paraphyletic. While a species paraphyletic in a tree built from concatenated genomic alignments is not inconceivable due to the possibility of extensive introgression from some other species in a part of the species range, such a situation calls for further investigation. Analysis of the trees built from various segments of the nuclear genome revealed that some segments in the hesperis group are similar to the atlantis group, while other segments are similar to the irene group. Hence, we hypothesize that A. hesperis is a hybrid species of A. irene and A. atlantis, because it shares 20 % and 67 % of its autosome-linked genome, and 71 % and 20 % of its Z-linked genome with the latter two species respectively, while it possesses only 0.17 % of unique polymorphisms, compared to 0.5 % and 0.28 % unique polymorphisms in A. irene and A. atlantis, respectively. We see that a significant fraction of the A. hesperis genome is shared with either A. irene or A. atlantis, and the number of unique mutations in the A. hesperis lineage is smaller than that compared to either of its putative parental species, suggesting a hybrid origin of A. hesperis. Consequently, we consider A. irene (consisting of four westernmost subspecies presently associated with A. hesperis, Fig. 11) to be a species-level taxon, and the Z chromosome similarity with A. hesperis is therefore explained by the hybrid origin of A. hesperis, which inherited larger segments of this chromosome from A. irene. This scenario of species originating by hybridization is not covered by the Fst / Gmin Z chromosome test for species distinction (Cong et al. 2019 b). The COI barcodes of A. irene are closer to A. atlantis (2.5 %, 17 bp difference) than to A. hesperis (5 %, 33 bp difference), probably because A. hesperis possesses mitogenomes introgressed from A. nausicaa and does not reveal differences in the barcodes with the latter species. As a side note, the earliernamed species A. hesperis is likely to a be a hybrid species with one of the parental species being a named later (A. irene), illustrating that biological reality has little to do with the order species were named in. Finally, we find (Fig. 11) that the holotype of Speyeria hydaspe conquista dos Passos & Grey, 1945 (type locality USA: New Mexico, Santa Fe Co., presumed to be in error), presently placed as a synonym of Argynnis hydaspe rhodope W. H. Edwards, 1874, clusters closely with the holotype of Argynnis hesperis tetonia (dos Passos & Grey, 1945) (type locality USA: Wyoming, Teton Co.) and is therefore placed as a synonym of tetonia, new placement. In summary, genomic data suggest that the atlantis - hesperis complex consists of four species: A. atlantis, A. hesperis, and two others with reinstated status: A. irene and A. nausicaa. The following subspecies are assigned to A. irene to form new combinations: Argynnis irene dodgei Gunder, 1931, Argynnis irene cottlei J. A. Comstock, 1925, and Argynnis irene hanseni (J. Emmel, T. Emmel & Mattoon, 1998). The following subspecies are assigned to A. nausicaa to form new combinations: Argynnis nausicaa elko (Austin, 1984), Argynnis nausicaa greyi (Moeck, 1950), Argynnis nausicaa viola (dos Passos & Grey, 1945), Argynnis nausicaa tetonia (dos Passos & Grey, 1945), Argynnis nausicaa chitone W. H. Edwards, 1879, Argynnis nausicaa schellbachi (Garth, 1949), Argynnis nausicaa electa W. H. Edwards, 1878, Argynnis nausicaa dorothea (Moeck, 1947), and Argynnis nausicaa capitanensis (R. Holland, 1988). The names for other taxa in this complex remain unchanged.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Opler, Paul A., Grishin, Nick V. (2020): Genomic evidence suggests further changes of butterfly names. The Taxonomic Report of the International Lepidoptera Survey 8 (7): 1-41
20298794FF82FFB4FE4D73396DF89395.taxon	description	(Linnaeus, 1758) and N. cyanomelas (E. Doubleday, [1848]) (Fig. 13). In summary, in a move towards a more consistent classification, we suggest treating Aglais and Polygonia as subgenera of Nymphalis.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Opler, Paul A., Grishin, Nick V. (2020): Genomic evidence suggests further changes of butterfly names. The Taxonomic Report of the International Lepidoptera Survey 8 (7): 1-41
20298794FF81FFBAFEA075C36C979192.taxon	description	In the genomic tree (Fig. 18), Hyponephele Muschamp, 1915 (type species Papilio lycaon Rottemburg, 1775) is sister to Cercyonis Scudder, 1875 (type species Papilio alope Fabricius, 1793, placed as a subspecies of Papilio pegala Fabricius, 1775), in agreement with previous findings (Peña et al. 2006). The tree reveals that the genetic divergence between Hyponephele and Cercyonis is smaller than that within Erebia Dalman, 1816 (type species Papilio ligea Linnaeus, 1758). The COI barcodes of H. lycaon and C. pegala differ by 7.9 % (52 bp). We give Hyponephele a new status of a subgenus within Cercyonis. This change may not be welcomed by the Old World Lepidopterists who are used to the name Hyponephele applied to its many species, similar to how Argynnis is not welcomed in America to include Speyeria as its subgenus. However, this name change highlights the close relationship between the two subgenera (Hyponephele and Cercyonis) making Cercyonis a Holarctic genus, similar to Erebia Dalman, 1816 (type species Papilio ligea Linnaeus, 1758) in divergence and distribution. This is yet another step towards more internally consistent genus-level classification in butterflies.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Opler, Paul A., Grishin, Nick V. (2020): Genomic evidence suggests further changes of butterfly names. The Taxonomic Report of the International Lepidoptera Survey 8 (7): 1-41
20298794FF8EFFB9FF1574A06B519100.taxon	description	Danaus eresimus (Cramer, 1777) (type locality Suriname) looks superficially similar to Danaus gilippus (Cramer, 1775) (type locality Brazil: Rio de Janeiro) and at times it is a challenge to distinguish these two species. On the contrary, Danaus plexippus (Linnaeus, 1758) (type locality USA: New York, Orleans Co.) is superficially more different from either D. eresimus or D. gilippus (Warren et al. 2016). Due to these superficial similarities and differences, traditionally, only the former, as the type species, belonged to Danaus Kluk, 1780, and the latter two species were placed in Anosia Hübner, 1816 (type species Papilio gilippus Cramer, 1775) (Ackery and Vane-Wright 1984; Pelham 2008; Pelham 2020). However, among these three species, genomic data (both nuclear and mitochondrial genomes) place D. eresimus as a sister to D. plexippus with high confidence (Fig. 20), and D. gilippus is a sister to that clade of the two species, in agreement with previous DNA-based analyses (Zhan et al. 2014; Aardema and Andolfatto 2016). Therefore, we transfer Danaus eresimus (Cramer, 1777) from the subgenus Anosia where it does not belong, to the subgenus Danaus in accord with the phylogeny of these three species. This change has already been implemented by Pelham in the most recent version of the catalogue (2020) after the discussion of our genomic data and previous works with NVG. Here, we simply formalize this change in a publication.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Opler, Paul A., Grishin, Nick V. (2020): Genomic evidence suggests further changes of butterfly names. The Taxonomic Report of the International Lepidoptera Survey 8 (7): 1-41
20298794FF8EFFB9FF1574A06B519100.taxon	description	(Ménétriés, 1855) (type locality Nicaragua). While accepting subspecies-level treatment of chinatiensis, Pelham (2008) writes: " There is considerable reason to consider this a distinct species from theona. More investigation is required. " We carried out our genomic investigation by Fig. 22. Chlosyne chinatiensis (red) and theona (blue). sequencing of three chinatiensis specimens from the US and Mexico (Fig. 22) and found that their comparison with theona specimens from across the range (from Arizona, Texas and Costa Rica) results in the following Fst / Gmin statistics: 0.35 / 0.019, indicating genetic differentiation and low gene exchange consistent with chinatiensis being a species-level taxon. The COI barcodes of C. chinatiensis and C. theona thekla differ by 1.4 % (9 bp), but those of C. chinatiensis and C. theona bolli differ by 0.6 % (4 bp). Moreover, C. chinatiensis is sympatric with C. theona bolli in west Texas, e. g. in the Big Bend National Park. Given this evidence, we reinstate Chlosyne chinatiensis (Tinkham, 1944) as a species.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Opler, Paul A., Grishin, Nick V. (2020): Genomic evidence suggests further changes of butterfly names. The Taxonomic Report of the International Lepidoptera Survey 8 (7): 1-41
20298794FF8CFFB9FE5472C0692294B5.taxon	description	(Reakirt, [1867]) (type locality Mexico: Veracruz, Fig. 23 red). The other clade includes all other taxa of this species (Fig. 23 blue). Fst / Gmin statistics for the Z chromosome comparison of these two clades are 0.39 / 0.021, suggesting that they represent two distinct species. Moreover, COI barcodes of lilea from Mexico and polybius from Guyana show 3 % (20 bp) difference. Therefore, we conclude that Phocides lilea (Reakirt, [1867]) is a species-level taxon, reinstated status. Furthermore, we sequenced the only known syntype of an enigmatic taxon Erycides imbreus Plötz, 1879 from the ZMHB collection, illustrated in Warren et al. (2016). This specimen is a syntype because it is a uniquely patterned specimen that carries appropriate labels, agrees with the original description and looks similar to the unpublished Godman copy of the Plötz illustration (in BMNH, inspected by NVG) (Godman 1907). It is an unusual specimen lacking an orange bar in the forewing discal cell (usually extending to costa) typical for P. polybius. Evans (1952) treated this name as a distinct species Phocides imbreus Plötz, 1879 based on a rather poor illustration of this specimen in Draudt (1921) — it is unlikely that Evans saw the actual specimen. Mielke & Casagrande (2002) inspected the syntype and synonymized the name with P. polybius lilea due to general phenotypic similarity and the lack of orange coloring on the fringe around the hindwing tornus. According to our genomic results (Fig. 23), imbreus is confidently placed with Phocides polybius polybius, revised placement of a synonym, and is probably an aberrant specimen of polybius, not lilea, lacking any orange coloration on its wings, not just on the fringe, but also a forewing orange bar. However, the head of the syntype retains the usual orange patterns including orange palpi and cheeks. Our revised synonymy is further supported by the label data on the specimen stating " Am. m. ", which probably stands for America meridionalis (South America), where P. lilea is not known to occur.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Opler, Paul A., Grishin, Nick V. (2020): Genomic evidence suggests further changes of butterfly names. The Taxonomic Report of the International Lepidoptera Survey 8 (7): 1-41
20298794FF8BFFBEFF5B70676D5E97AE.taxon	description	Cecropterus diversus (E. Bell, 1927) (type locality USA: California, Plumas Co.). While Cecropterus mexicana aemilea (Skinner, 1893) (type locality	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Opler, Paul A., Grishin, Nick V. (2020): Genomic evidence suggests further changes of butterfly names. The Taxonomic Report of the International Lepidoptera Survey 8 (7): 1-41
20298794FF8BFFBEFF5B70676D5E97AE.taxon	materials_examined	USA: Oregon, Klamath Co., male syntype sequenced), C. mexicana blanca (J. Scott, 1981) (type locality USA: California, Mono Co.) and C. mexicana nevada (Scudder, 1872) (type locality USA: California, Sierra Nevada) group closely together (all three unified under the name nevada below), C. mexicana dobra (Evans, 1952) (type locality USA: Arizona, Graham Co.) forms a clade distinct from them and C. mexicana. The Fst / Gmin statistics for these clades are: mexicana vs. dobra: 0.34 / 0.021, mexicana vs. nevada: 0.37 / 0.010, nevada vs. dobra: 0.30 / 0.055. We see that nevada and dobra exchange genes more frequently with each other than do each of them with mexicana. Differences between COI barcodes in pairs of these species are: mexicana and dobra: 1.8 % (12 bp), mexicana and nevada: 1.1 % (7 bp), nevada and dobra: 1.7 % (11 bp). For comparison, the COI barcodes of aemilea, blanca and nevada are 100 % identical. Curiously, in contrast to nuclear genomes (Fig. 24), mitochondrial genomes (as reflected by barcodes) place mexicana closer to nevada, and dobra farther away from them, which is yet another example of the peculiarity of mitochondrial evolution. Deriving further support from genitalic and wing pattern differences mentioned by Evans (1952), we suggest that Cecropterus nevada (Scudder, 1872), reinstated status, and Cecropterus dobra (Evans, 1952), new status, are species-level taxa, not subspecies of Cecropterus mexicana (Herrich-Schäffer, 1869). Then, we treat Cecropterus nevada aemilea (Skinner, 1893) and Cecropterus nevada blanca (J. Scott, 1981), new combinations, as subspecies of C. nevada.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Opler, Paul A., Grishin, Nick V. (2020): Genomic evidence suggests further changes of butterfly names. The Taxonomic Report of the International Lepidoptera Survey 8 (7): 1-41
20298794FF8AFFBCFE7D72196A0293CC.taxon	description	difference in COI barcode, which by itself is not large enough to draw definitive conclusions, but it prompted further investigation. The Fst / Gmin statistics computed on two pairs of specimens from distant localities (Fig. 27) were 0.27 / 0.05, suggesting that Nisoniades bromias (Godman & Salvin, 1894), reinstated status, is a distinct species.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Opler, Paul A., Grishin, Nick V. (2020): Genomic evidence suggests further changes of butterfly names. The Taxonomic Report of the International Lepidoptera Survey 8 (7): 1-41
20298794FF89FFBCFEC071376D399728.taxon	description	(type locality " Indiis ", likely eastern US) by Pelham (2020). As a part of on-going genomic sequencing inventory of the primary type specimens of Hesperiidae, we obtained and analyzed whole genome shotgun reads of the holotype and two paratypes of crestar. Surprisingly, their comparison with P. catullus populations from several distant localities revealed prominent genetic differentiation (Fig. 28). Moreover, one of the crestar paratypes (from CA: Mono Co., NVG- 17066 H 12, Fig. 28) apparently is P. catullus, not crestar. Fst / Gmin statistics for the crestar / catullus comparison are 0.34 / 0.014, suggesting distinctness of crestar as a species. Gene exchange between catullus and crestar (0.014) is very low (for conspecific populations it is typically above 0.1), strongly supporting reproductive isolation between these taxa. Peculiarities of COI barcode evolution in Pholisora have been reported previously by Pfeiler (2018) and COI barcodes of the crestar holotype and the catullus specimen from Texas (NVG- 3990) differ by 1.7 % (11 bp). Due to strong genetic differentiation, we suggest that Pholisora crestar J. Scott & Davenport, 2017, new status, is a species-level taxon.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Opler, Paul A., Grishin, Nick V. (2020): Genomic evidence suggests further changes of butterfly names. The Taxonomic Report of the International Lepidoptera Survey 8 (7): 1-41
20298794FF88FF86FE2C726E6D339101.taxon	description	Megathymus beulahae D. Stallings & J. Turner, 1958 (Fig. 31). The Fst / Gmin statistics for comparison of ursus and violae groups are 0.56 / 0.001 (note close to 0 gene exchange between these taxa). The COI barcodes of the M. ursus and M. violae holotypes differ by 1.8 % (12 bp). For these reasons, we reinstate Megathymus violae D. Stallings & Turner, 1956 as a species-level taxon.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Opler, Paul A., Grishin, Nick V. (2020): Genomic evidence suggests further changes of butterfly names. The Taxonomic Report of the International Lepidoptera Survey 8 (7): 1-41
20298794FF88FF86FE2C726E6D339101.taxon	discussion	Discussion: genomic trees, branch lengths and genera Near the end, coming back to the Introduction, we elaborate on and illustrate the reasons behind the classification decisions that we have chosen to make about genera. Traditionally, species were grouped into genera by phenotypic characters. For butterflies, these were mostly wing patterns and shapes, and genitalic morphology. When differences in these phenotypic aspects were deemed to be significant enough according to a subjective opinion of an individual researcher, they formed a basis for defining a genus. This system served its purpose until a consensus opinion was formed among taxonomists that each genus should be monophyletic. It is exceedingly difficult to predict monophyletic taxa from their phenotypes, and DNA-based phylogenetic trees provide the most reliable inference of monophyletic groups. Therefore, genera should be defined using phylogenetic trees constructed from DNA sequences. Each individual feature of an organism can experience rapid evolution and fool researchers into making incorrect classification decisions. Genitalia that are commonly used in Lepidoptera classification are prone to such rapid changes as well. For instance, Steinhauser (1989) proposed a genus Thessia on the basis of unique shape of genitalic valvae. However, even a very short, 654 base pair region of DNA, such as the COI barcode, reveals the paraphyly of Achalarus Scudder, 1872 (as it was circumscribed at that time) with respect to Thessia (Pfeiler et al. 2016), suggesting that the unique valva is a result of accelerated evolution within Achalarus rather than a character originated after Thessia and Achalarus have (supposedly) diverged from each other. Therefore, a decision to erect the genus Thessia was a mistake, because Thessia is a subclade within (as it was then defined) Achalarus. Nevertheless, the barcode DNA region itself is a single feature, and as any other such feature, can experience evolutionary irregularities. To reduce such mistakes, it is better to use information from as many features as feasible. Complete genomes offer the ultimate DNA dataset for classification decisions. Genomic analysis suggests that Achalarus itself is a junior subjective synonym of the subgenus Thorybes Scudder, 1872, and Thessia is actually a junior subjective synonym of the subgenus Murgaria E. Watson, 1893 (Li et al. 2019). Genomic trees summarize integral information about the entire organism, not just some of its features. For this reason, we use them to make decisions about classification of genera. Here, we explain how we arrive to these decisions using examples from this work and our previous publication (Zhang et al. 2019 c). A maximum likelihood tree constructed using IQ-TREE program (model GTR + I + G) (Minh et al. 2020) from concatenated protein-coding regions of nuclear genomes is shown in Fig. 32. To best follow our logic, a reader may close the tree on the right (Fig. 32 b, the final result) and look only at the tree on the left (Fig. 32 a), which is the same as the tree on the right, but without the final results being marked in order not to bias the reader. This tree was constructed without assuming a molecular clock and reveals differences in evolutionary rates between species: i. e., species names are placed at difference distance from the left side of the page (= from the root of the tree). We see that Emesis evolved the fastest (the farthest from the left), and Ephyriades Hübner, [1819] evolved the slowest (closest to the left). In a tree, only horizontal (left-to-right) distances matter. Vertical (top to bottom) distances are arbitrary and are set to place species names evenly along vertical dimension, so that the names do not overlap and are not too far away from each other to save space. Tree branches have different lengths. Again, only horizontal branches have evolutionary meaning, and vertical lines in the tree are set to avoid overlap of names and to connect branches to nodes. The length of a horizontal branch is proportional to the number of estimated changes in DNA (= fixed mutations) that happened along the branch. The tree has a scale bar near the bottom (Fig. 32). The length of that bar, as indicated, corresponds to 6 changes per 100 base pairs (= 0.06, or 6 %). Using this bar, we can measure evolutionary distances between taxa in DNA changes. Long branches correspond to many changes in genomic DNA. Short branches correspond to few changes in genomic DNA. Because larger number of DNA changes are expected to result in larger number of phenotypic changes, longer branches correspond to more phenotypic changes on average. These are integral changes and some of them may be in genitalia, others may be in caterpillar morphology. Regardless of where these changes are, longer branches are more important than shorter branches. In addition to larger number of changes, longer branches are also more reliable and support clades that are more likely to be correct. The statistical reliability of every clade is indicated by a number next to each node. This number is a fraction of trees (out of 100 trees constructed from various subsets of genomic segments) that contain this node, e. g. a genome was divided into 100 segments and each segment was used to generate a tree. If a particular node is present in all 100 trees, the number by that node is 1. Therefore, this number measures consistency between trees constructed from different partitions of the data. If every DNA segment supports a clade, it has a number 1 next to it. If 94 out of 100 segments support the clade, the number is 0.94. A genus should be a prominent, major clade in the tree that is above species level and below tribe and subtribe levels. Phenotypic features are difficult to quantify, and due to the possibly uneven speed of evolution, it is a challenge to determine which phenotypic changes correspond to major clades. Total genomic changes can be used as a yardstick to quantify each clade. The number of total genomic changes is proportional to branch lengths in genomic trees (Fig. 32 a). Therefore, the task of identifying genera may be viewed as a task of identifying prominent (i. e. supported by longer branches compared to surrounding branches) clades in genomic trees that on average correspond to how genera are defined currently (to avoid unnecessary taxonomic changes). Additionally, we believe that each genus should not be very different from another genus in terms of genetic differentiation of species placed in a genus, i. e. genera could be defined consistently, so that genera correspond to clades of approximately the same differentiation within. Defined consistently, the genus becomes a level (as meant by this word) of a classification instead of several varying levels, i. e., we can expect a genus to be a group of species bearing about the same relatedness among them as that in other genera. It would seem unnatural if one phylogenetic group is oversplit into genera, i. e. genera in that group correspond to very closely related species, but another group is undersplit, and genera in it correspond to species that are only distantly related. The measure of closeness as we use it, is overall genomic divergence. Looking at the clade of Hesperiidae at the top of the tree (Fig. 32 a) we see three major clades, not two and not four. The first clade is Ephyriades and is sister to all other taxa. Then all others split into two clades of similar genetic differentiation within each clade. We see that each of these clades resembles a tight bush or a comb, rather than an evenly bifurcating tree, i. e. the internal branches in either clade are much shorter than a branch that supports the entire clade. The clade with Gesta bifurcates into two subclades, one consists of Gesta sensu stricto (s. s.). Species from the other subclade were called " Erynnis " previously (and are called Erynnis in the tree to facilitate communication): it is a subgenus Erynnides Burns, 1964 (type species Nisoniades propertius Scudder & Burgess, 1870). If we consider these two subclades to be major clades, then the Hesperiidae tree would consist of four major clades (Ephyriades, Erynnis s. s., Erynnides and Gesta). However, the branches supporting the two subclades (Erynnides and Gesta) are nearly three times shorter than the branches supporting the clades Erynnis s. s. and a clade combining Erynnides with Gesta. Therefore, the Hesperiidae subtree should not be partitioned into four major clades, because two of these clades (Erynnides, Gesta) would be minor compared to the other two, and more importantly, compared to the clade combining Erynnides with Gesta. The remaining alternative to a three-clade partitioning would be a two major clade partition, where Erynnis s. s., Erynnides and Gesta are all joined together into Erynnis sensu lato (s. l.) The branch supporting this clade is only slightly shorter than the branch supporting Erynnis s. s., and therefore this clade is rather prominent in the tree. We reject this solution for the two reasons. First, Erynnis s. l. is not a homogenous group of species, which we think a genus should be, i. e. the Erynnis s. l. clade does not look like a bush or a comb. Instead, it splits into two major clades: Erynnis s. s. and Erynnides + Gesta, (we call this clade Gesta s. l. from now on) each of which individually looks more like a comb than when they are combined. In other words, Erynnis s. l. itself is composed of two major clades, and does not represent a single group of species, but two major groups of species. The second reason stems from consistency between different genera, i. e. an idea that different genera should represent the same level in the classification (Fig. 33). Being a level, genera should be groups of species with comparable divergence within each genus. In this tree (Fig. 32 a), where all branches are to scale, we can compare divergence between Erynnis s. s. and Gesta s. l. to the divergence in Nymphalidae previously placed in genera Aglais, Polygonia, Nymphalis, and Vanessa. These two subtrees (Erynnis and Vanessa) are illustrated in Fig. 33. Genetic differentiation of a clade is proportional to the average distance (average sum of branch lengths) from the last common ancestor of the clade (= node that supports the entire clade) to the leaves (= species) in the clade. In other words, it is a linear distance (in horizontal dimension) from the base of the clade to the tips of the tree. On the one hand, we see that Polygonia divergence is rather small, perhaps comparable to the divergence of the Erynnides subclade with horatius and juvenalis, and definitely smaller than the divergence within either Erynnis s. s., or Gesta s. l. On the other hand, the divergence of Erynnis s. l. is larger than the divergence of Aglais, Polygonia, Nymphalis and Vanessa combined. Therefore, having Erynnis s. l. as a genus is inconsistent with having Polygonia as a genus: these two groups represent different levels in the classification. Coming back to Nymphalidae, we see that branches supporting Aglais, Polygonia and Nymphalis individually are much shorter than the branches supporting Erynnis s. s. or Gesta s. l. Only the branch supporting Vanessa is somewhat comparable, although shorter. However, the branch supporting the first three clades together (Nymphalis s. l.) is more prominent and is about the same as the branch supporting Vanessa. In summary, Erynnis s. l. is comparable to Vanessa s. l. (Nymphalis s. l. + Vanessa s. s.). A system of two genera (Erynnis s. s. and Gesta s. l.) is comparable to two genera Nymphalis s. l. and Vanessa s. s. We attempt to choose an internally consistent solution that agrees the most with how these species are assigned to genera in the current classification. Therefore, we choose the 2 - genus solution for both of these cases, as shown in Figs. 32 b (colored clades E: Erynnis, G: Gesta, N: Nymphalis and V: Vanessa) and 33 (shaded clades). These four genera represent a similar level in the classification and correlate with the current classification of these butterflies. The choice of Erynnis s. l. would correspond to a consistent choice of joining all four Nymphalidae genera in Vanessa, which may represent too much of a lump and more name changes (Fig. 33). Another point is that genetic differentiation can be used to estimate divergence times of these clades through the tree rescaling and calibration with fossils (primary calibration) (Chazot et al. 2019) or other time-calibrated trees (secondary calibration) (Zhang et al. 2019 a). As we have seen in Hesperiidae (Li et al. 2019), the genus level typically corresponds to divergence between 10 and 15 million years ago (Mya). Divergence of Erynnis s. l. was estimated to be about 27 Mya, which is larger than the divergence between Vanessa s. s. and Nymphalis s. l., at about 22 Mya (Zhang et al. 2019 d). However, divergences within Gesta s. l. (~ 16 Mya), Vanessa s. s. (~ 16 Mya) and Nymphalis s. l. (~ 14 Mya) (Zhang et al. 2019 d) are very much comparable to each other, and these genera represent groups of about the same level. It should be noted that the divergence times are only approximate, should be considered with caution, and may have errors of possibly up to 50 %, especially in groups with large differences in evolutionary rates. However, the relative comparison of divergence times estimated within the same tree using the same method is expected to be more accurate. Finally, a question arises about how these considerations of trees, branch lengths, divergence and geological times correlate with genera definition based on phenotypic characters. Because phenotypic characters are encoded by the genotype, longer branches in the tree that correspond to more changes in a genotype (these are integral genomic trees, not based on several gene markers) should translate to more changes in the phenotype. We advocate a method to delineate genera from genomic trees first, and then come back to phenotypic analysis to find the phenotypic characters that correspond to these genera. In the case of Erynnis and Gesta, the retrospective inspection of morphological characters yields substantial differences in male genitalia that have been noted and illustrated previously (Evans 1953; Burns 1964). The uncus is asymmetric, terminally broad in Gesta, but is symmetric, extending into a " beak " in Erynnis. The valvae are strongly asymmetric with at least one extended harpe in Gesta, but are more symmetric with shorter harpes in Erynnis. Other differences are stated in the diagnosis of Erynnides by Burns (1964). Comparing the clades of other groups in Fig. 32 a with Erynnis / Gesta and Nymphalis / Vanessa we see that divergence within Speyeria and Roeberella (a clade containing R. clavus and with Apodemia hypoglauca at its base), and divergence between Hypaurotis, Favonius and Habrodais is much smaller than that in the groups we define as genera. We also see that the colored clades (with letters denoting corresponding genera by each clade) in Fig. 32 b are more or less equivalent to each other in terms of genetic differentiation (distance from the base of the clade to its tips) and prominence (length of the branch supporting the clade). For these reasons, we suggest that these clades can be treated as genera: they are prominent, consistent, and reasonably well correspond to how genera have been defined previously. The changes we suggest combine some more compact in terms of genetic (and phenotypic) differentiation genera into more internally diverse genera that become more consistent with the differentiation within many classic genera such as Emesis, Ministrymon, Vanessa, and Boloria.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Opler, Paul A., Grishin, Nick V. (2020): Genomic evidence suggests further changes of butterfly names. The Taxonomic Report of the International Lepidoptera Survey 8 (7): 1-41
