taxonID	type	description	language	source
03F1878BFF8AFFA02507FAE2FCF4F097.taxon	description	http: // zoobank. org / 72 E 085 A 2 - EA 04 - 4 D 25 - 8124 - 04 A 86 D 17 F 26 B	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF8AFFA02507FAE2FCF4F097.taxon	type_taxon	Type genus. Meandrusa F. Moore, 1888. Definition. Meandrusa (type species Papilio evan E. Doubleday, 1845 currently treated as a subspecies of Papilio payeni Boisduval, 1836) was placed in the subtribe Teinopalpini Grote, 1899, but our genomic trees show that it is not monophyletic with Teinopalpus Hope, 1843 (type species Teinopalpus imperialis Hope, 1843) and instead is sister to Papilionini Latreille, [1802] with 100 % support (Fig. 1). Genetic differentiation of Meandrusa from Papilionini is approximately the same as of Battus Scopoli, 1777 (type species Papilio polydamas Linnaeus, 1758) from other Troidini Talbot, 1939 (comparable distance from the root, Fig. 1). Therefore, we consider that Meandrusa belongs to the tribe Papilionini. However, the tree shows that Meandrusa is prominently separated from the rest of Papilionini and, therefore, belongs to a distinct subtribe analogously to Battus. This subtribe does not have a name and is proposed as new. As detailed by Miller (1987) for Meandrusa, the new subtribe is characterized by bifid tarsal claws and differs from the rest of Papilionini by strongly incurved middle discocellular vein on the forewing, shorter forewing discal cell (less than half of the wing), and scaled tibiae and tarsi, and from Teinopalpini by scaled antennae and prodiscrimen (equivalent to the prosternum of other insects) with a spine. Visually, species in the new subtribe are recognized by the distinct shape of curved forewings (especially in males) with produced and somewhat hooked apex narrowing to a point (less prominently in Meandrusa sciron (Leech, 1890 )). A combination of the following nuclear genomic base pairs is diagnostic: pgl 2854.3.1: A 400 G, pgl 827.10.7: G 122 A, pgl 827.10.7: G 138 A, pgl 1898.30.3: G 202 A, pgl 1397.11.1: G 1138 A. Genera included. Only the type genus.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF8AFFA02507FAE2FCF4F097.taxon	description	Parent Taxon. Tribe Papilionini Latreille, [1802].	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF89FFAE255DFB38FC03F1A2.taxon	type_taxon	Type species. Terias lirina H. Bates, 1861. Definition. Our genomic tree reveals that the T. lirina (type locality in Brazil: Pará) lineage is monophyletic with neither Abaeis Hübner, [1819] (type species Papilio nicippe Cramer, 1779) nor Eurema Hübner, [1819] (type species Papilio delia Cramer, 1780, a junior homonym, valid name for this species is Pieris daira Godart, 1819), and instead is a confident sister to all other Pyrisitia A. Butler, 1870 (type species Papilio proterpia Fabricius, 1775), but is genetically differentiated from them at the level of a subgenus (Fig. 2). Therefore, we transfer T. lirina to Pyrisitia forming a new combination Pyrisitia lirina (H. Bates, 1861) and propose that its lineage represents a distinct subgenus of Pyrisitia. This new subgenus differs from its relatives by the characters given and illustrated for Eurema furtadoi Casagrande & O. Mielke, 1979 in its original description (Casagrade and Mielke 1979). In brief, wings rounded, mostly white with black forewing apex, reminiscent of Abaeis albula (Cramer, 1775) (type locality in Suriname), with which it was lumped in the past (Klots 1929), but with very different genitalia: in males, uncus broader, with two shot side processes (absent in A. albula); saccus shorter, about the same length as tegumen with uncus; aedeagus bow-shaped, broader and shorter, twice as long as saccus; valva shaped as a half-circle, harpe with robust ventral tooth and much smaller vestigial dorsal tooth; in females, corpus bursae smaller with much smaller signum and a small bubble-shaped appendix (instead of the appendix as long as corpus). A combination of the following nuclear genomic base pairs is diagnostic: pse 1181.9.1: G 68 A, pse 988.17.1: A 57 G, pse 6193.9.1: G 135 T, pse 5030.21.1: A 392 T, pse 5030.21.1: T 376 G, pse 907.3.2: A 270 C, pse 1899.1.7: G 805 A, pse 1899.1.7: T 806 C, pse 2087.5.1: C 260 T, pse 102.3.4: C 1026 G. Species included. Only the type species.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF89FFAE255DFB38FC03F1A2.taxon	description	Parent taxon. Genus Pyrisitia A. Butler, 1870. are species-level taxa As we previously concluded, Pyrisitia westwoodii (Boisduval, 1836) (type locality in Mexico) is a distinct species, not a subspecies of Pyrisitia dina (Poey, 1832) (type locality in Cuba) (Zhang et al. 2021). Sequencing of additional specimens that included the nominal P. dina (Fig. 3 blue) confirms this conclusion, also confirming Pyrisitia parvumbra (Kaye, 1925) (type locality in Jamaica) (Fig. 3 magenta) as a distinct species (Turner and Turland 2017): Fst / Gmin between P. parvumbra and P. dina dina of 0.59 / 0.002 and the COI barcode difference of 2.7 % (18 bp). Furthermore, we find prominent genetic differentiation between P. dina and the taxon originally proposed as Eurema helios mayobanex M. Bates, 1939 (type locality in Haiti): Fst / Gmin of 0.39 / 0.00, COI difference of 1.8 % (12 bp). Therefore, we propose that Pyrisitia mayobanex (M. Bates, 1939), stat. nov. is a species-level taxon. Inspecting the genomic trees, we see that Terias memulus Butler, 1871 (type locality in Haiti), currently regarded as a subspecies of Pyrisitia leuce (Boisduval, 1836) (type locality in Brazil: Rio Grande do Sul), is most strongly differentiated from it genetically: Fst / Gmin 0.60 / 0.00 and the COI barcode difference of 7.3 % (48 bp) (Fig. 3 orange), while other P. leuce subspecies cluster closely together in the tree (Fig. 3 violet). Therefore, we reinstate Pyrisitia memulus (A. Butler, 1871), stat. rest. as a species.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF86FFAC26A8FDFFFA32F562.taxon	description	The phylogenetic tree of the tribe Euremini Grote, 1898 (type genus Eurema Hübner, [1819]) inferred from protein-coding regions in the nuclear genome (autosomes only) reveals strong statistical support (100 % for most branches) and noticeable tree levels (resulting from coinciding diversifications in different clades at about the same distance from the root) to aid its higher classification (Fig. 2). The level closest to the origin of the tribe consists of three prominent clades that we treat as subtribes: Nathalina Bálint, 2022, stat. nov. (type genus Nathalis Boisduval, 1836), Kricogonina Bálint, 2022, stat. nov. (type genus Kricogonia Reakirt, 1864) and the nominotypical, Euremina. The former two were originally proposed as tribes, but the early split of the subfamily Coliadinae Swainson, 1821 (type genus Colias [Fabricius], 1807) into two prominent clades argues for treating these clades as tribes (Euremini and Coliadini) rather than dividing them further. Therefore, further divisions would correspond to the subtribal level. The monotypic genus Prestonia Schaus, 1920 (type species Prestonia clarki Schaus, 1920) placed in Euremini by Zhang et al. (2021) is sister to Kricogonia and diverged from it approximately 27 million years ago (Mya), as estimated in Kawahara et al. (2023), which is close to the split of the subtribe Euremina into two clades (25 Mya). Due to this similar level of genetic differentiation between Kricogonia and Prestonia and between the two first clades of Euremina, Prestonia is placed in the subtribe Kricogonina rather than in a subtribe of its own. Such classification emphasizes the sister relationship of the two genera (Kricogonia and Prestonia) rather than the distinction between them. While there is little doubt that the five known species in Nathalina and Kricogonina are best classified into the three genera corresponding to the most prominent clades in the tree (Fig. 2), the taxonomy of the subtribe Euremina is more complex. Traditionally, the entire subtribe has been treated as a single genus Eurema Hübner, [1819] (type species Papilio delia Cramer, 1780, a junior homonym, valid name for this species is Pieris daira Godart, 1819) (Klots 1933). However, early DNA work suggested strong genetic differentiation within the subtribe (Pollock et al. 1998), formalized by Opler and Warren (2002), who partitioned the US species into three genera: Eurema, Pyrisitia A. Butler, 1870 (type species Papilio proterpia Fabricius, 1775), and Abaeis Hübner, [1819] (type species Papilio nicippe Cramer, 1779). This split has been largely followed (Lamas 2004; Pelham 2008), although some species have been reassigned between these genera (Zhang et al. 2019 b). Our work (Zhang et al. 2019 c; Zhang et al. 2019 b) and more recent publications (Kawahara et al. 2023) support the notion of strong genetic differentiation within Euremina and date its diversification to approximately 25 Mya (Fig. 2). This level of differentiation and age are too large for placing all Euremina in the single genus Eurema. The subtribe Euremina splits into two prominent clades at approximately 25 Mya, as estimated by Kawahara et al. (2023). These two clades can be taken to represent genera, and the subtribe can be divided into two genera: Eurema and Abaeis. However, even this level of genetic differentiation and age would be larger than for most genera of butterflies (Talavera et al. 2012; Li et al. 2019; Zhang et al. 2019 a, c), and the ages between 15 and 20 Mya would be more consistent with the genus level. Even if absolute values of age estimates are not particularly accurate due to various errors, their relative values validity of such comparisons of estimated ages between nodes. For these reasons, we regard the two clades of Euremina as “ sections ”: the Eurema section and the Abaeis section, and take the next level in the tree to define genera. The next tree level, dating to approximately 20 Mya, consists of five clades, one of which is entirely from the Old Word, the only Old Word group in the entire tribe Euremina (Fig. 2 marked with red asterisk). We propose that these five clades represent genera in Euremina: Terias W. Swainson, 1821 (type species Papilio hecabe Linnaeus, 1758) and Eurema with its sister Pyrisitia A. Butler, 1870 (type species Papilio proterpia Fabricius, 1775) belong to the Eurema section, and Abaeis with Teriocolias Röber, 1909 (type species Terias atinas Hewitson, 1874, a junior subjective synonym of Terias zelia Lucas, 1852) belong to the Abaeis section. This partitioning into genera is biogeographically significant because it reflects the invasion of the only Euremini lineage from the New World, where the tribe likely originated, into the Old World, giving rise to the genus Terias, followed by its extensive diversification. Genera of Euremina defined this way are analogous to Codatractus Lindsey, 1921 vs. Lobocla Moore, 1884, Heliopetes Billberg, 1820 vs. Pyrgus Hübner, [1819], and Oarisma Scudder, 1872 vs. Thymelicus Hübner, [1819] (in the latter two, pairs some species from the Old World genus returned to the New World at a later time) and correspond to similar geological time-frame of the mid-Miocene climatic optimum characterized by elevated biotic movement from America to Asia (Jiang et al. 2019). The phylogenetic tree (Fig. 2) guides the assignment of species to genera, and we restore the monophyly by proposing new genus-species combinations: Pyrisitia amelia (Poey, [1852]), comb. nov., Pyrisitia lirina (H. Bates, 1861), comb. nov., Abaeis paulina (H. Bates, 1861), comb. nov., Abaeis xantochlora (Kollar, 1850), comb. nov., Abaeis fabiola (C. Felder & R. Felder, 1861), comb. nov., Abaeis tupuntenem (Lichy, 1976), comb. nov., Abaeis adamsi (Lathy, 1898), comb. nov., Abaeis brephos (Hübner, [1809]), comb. nov., and Abaeis elvina (Godart, 1819), comb. nov. The latter two combinations reflect our treatment of Leucidia E. Doubleday, 1847, stat. nov. (type species Pieris elvina Godart, 1819) as a subgenus of Abaeis despite its unique phenotype. Such treatment results in a more internally consistent classification because an Abaeis that includes Leucidia corresponds to a more prominent clade in the tree, and the Leucidia clade has split from the rest of Abaeis at the tree level corresponding to subgenera (Fig. 2). This level allows us to define five subgenera in Euremina in addition to the five genera (Fig. 2 and listed below). Finally, we note that Teriocolias doris (Röber, 1909), stat. rest. (type locality in Bolivia), currently regarded as a subspecies of Teriocolias deva (E. Doubleday, 1847) (type locality in French Guiana), is genetically very distant from it: e. g., COI barcodes differ by 7.6 % (50 bp) and is a distinct species. Below is a proposed classification of the tribe Euremini. Only available genus-group names are listed; subspecies names are not given and can be found on the Butterflies of America website (Warren et al. 2023), and the Old Word species are not provided (all belong to the genus Terias, which consists only of Old World species). Type genus (for family-group names) or type species (for genus-group names) names are given in parenthesis; synonyms are preceded by = and all but subjective synonyms also by ‡ with a valid name of this species following the colon. New taxa and status changes are shown in red font.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF85FFAB27F3F987FD0AF1F2.taxon	description	Subtribe Kricogonina Bálint, 2022, stat. nov. (Kricogonia Reakirt, 1864) Genus Kricogonia Reakirt, 1863 (Colias lyside Godart, 1819) Kricogonia lyside (Godart, 1819) Kricogonia cabrerai Ramsden, 1920 Genus Prestonia Schaus, 1920 (Prestonia clarki Schaus, 1920) Prestonia clarki Schaus, 1920 Eurema section Genus Terias W. Swainson, 1821 (Papilio hecabe Linnaeus, 1758) Consists of all Old World species of Euremini Subgenus Maiva Grose-Smith & W. F. Kirby, 1893 (= M. sulphurea Gr-Sm. & Kirby: Papilio brigitta Stoll, 1780) = Kibreeta F. Moore, 1906 (= ‡ Papilio libythea Fabricius, 1798: Terias brigitta rubella Wallace, 1867) = Nirmula F. Moore, 1906 (= Terias venata F. Moore, 1858: Terias laeta Boisduval, 1836) Subgenus Terias W. Swainson, 1821 (Papilio hecabe Linnaeus, 1758) Genus Eurema Hübner, [1819] (= ‡ Papilio delia Cramer, 1780: Pieris daira Godart, 1819) Eurema priddyi (Lathy, 1898) Eurema lucina (Poey, [1852]) Eurema daira (Godart, 1819) Eurema elathea (Cramer, 1777) Eurema nigrocincta Dognin, 1889 Eurema agave (Cramer, 1775) Eurema phiale (Cramer, 1775) Genus Pyrisitia A. Butler, 1870 (Papilio proterpia Fabricius, 1775) Subgenus Pyrisitia A. Butler, 1870 (Papilio proterpia Fabricius, 1775) Pyrisitia proterpia (Fabricius, 1775) Pyrisitia westwoodii (Boisduval, 1836) Pyrisitia dina (Poey, 1832) Pyrisitia mayobanex (M. Bates, 1939), stat. nov. Pyrisitia parvumbra (Kaye, 1925) Pyrisitia memulus (A. Butler, 1871), stat. rest. Pyrisitia leuce (Boisduval, 1836) Pyrisitia larae (Herrich-Schäffer, 1862) Pyrisitia venusta (Boisduval, 1836) Pyrisitia chamberlaini (A. Butler, 1898) Pyrisitia nise (Cramer, 1775) Pyrisitia lisa (Boisduval & Le Conte, [1830]) Pyrisitia euterpiformis (Munroe, 1947) Pyrisitia amelia (Poey, [1852]), comb. nov. Pyrisitia portoricensis (Dewitz, 1877) Pyrisitia pyro (Godart, 1819) Pyrisitia messalina (Fabricius, 1787) Subgenus Lirinia Grishin, subgen. n. Pyrisitia lirina (H. Bates, 1861), comb. nov. Abaeis section Genus Abaeis Hübner, [1819] (Papilio nicippe Cramer, 1779) Subgenus Leucidia E. Doubleday, 1847 (Pieris elvina Godart, 1819), stat. nov. Abaeis brephos (Hübner, [1809]), comb. nov. Abaeis elvina (Godart, 1819), comb. nov. Subgenus Lucidia Lacordaire, 1833 (Papilio albula Cramer, 1775) Abaeis albula (Cramer, 1775) Subgenus Sphaenogona Butler, 1870 (Terias bogotana C. & R. Felder, 1861: a ssp. of T. mexicana Boisduval) Abaeis paulina (H. Bates, 1861), comb. nov. Abaeis xantochlora (Kollar, 1850), comb. nov. Abaeis fabiola (C. Felder & R. Felder, 1861), comb. nov. Abaeis tupuntenem (Lichy, 1976), comb. nov. Abaeis salome (C. Felder & R. Felder, 1861) Abaeis mexicana (Boisduval, 1836) Abaeis boisduvaliana (C. Felder & R. Felder, 1865) Abaeis angulata (Wallengren, 1860), stat. rest. Abaeis gratiosa (E. Doubleday, 1847), stat. rest. Abaeis arbela (Geyer, 1832) Abaeis adamsi (Lathy, 1898), comb. nov. Subgenus Abaeis Hübner, [1819] (Papilio nicippe Cramer, 1779) Abaeis nicippe (Cramer, 1779) Abaeis nicippiformis (Munroe, 1947) Genus Teriocolias Röber, 1909 (= Terias atinas Hewitson, 1874: Terias zelia Lucas, 1852) Teriocolias deva (E. Doubleday, 1847) Teriocolias doris (Röber, 1909), stat. rest. Teriocolias zelia (Lucas, 1852) Teriocolias reticulata (A. Butler, 1871) The genomic tree reveals four prominent clades in the tribe Coliadini Swainson, 1821 that are at approximately the same distance from the root (Fig. 5). We propose treating these clades as subtribes. Three of these subtribes have names: the nominotypical one, Callidryina Kirby, 1896, stat. nov., and Gonepterygina Verity, 1920, stat. nov. The name Callidryina is formed from the genus Callidryas Boisduval & Le Conte, 1830 (type species Papilio eubule Linnaeus, 1767), which is currently treated as a junior subjective synonym of Phoebis Hübner, [1819] (type species Phoebis cypris Hübner, [1819], which is an unjustified emendation of Papilio cipris Cramer, 1777, which is a junior subjective synonym of Papilio argante Fabricius, 1775). Callidryina consists of two closely related genera, Phoebis (that includes Rhabdodryas Godman & Salvin, 1889) and Aphrissa Butler, 1873. In addition to the type genus Gonepteryx Leach, 1815, we place Dercas E. Doubleday, 1847 in Gonepterygina. The fourth subtribe does not have a name. It is described below. Gandacina Grishin, new subtribe http: // zoobank. org / EF 448 D 21 - E 251 - 4 ABA- 9 A 22 - 22 EBD 93 A 8303	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF85FFAB27F3F987FD0AF1F2.taxon	type_taxon	Type genus. Gandaca F. Moore, 1906. Definition. Gandaca (type species Terias harina Horsfield, 1829) is sister to Gonepterygina Verity, 1920, stat. nov. but is more distant from the members of this subtribe both genetically and phenotypically. Furthermore, the statistical support for Gonepterygina to include Gandaca is lower than for most other clades in the tree (88 %) (Fig. 5). Therefore, the clade with Gandaca is defined as a subtribe. This new subtribe is diagnosed by the following characters: in male genitalia, uncus pointed dorsad at the base, with dorsal margin strongly arched and finely serrated, uncus shorter than in relatives and broader towards its distal end in dorsal view; in female genitalia, corpus bursae nearly spherical with a ring-shaped signum at its base and an appendix that is larger than the corpus itself; in facies, is more similar to Eurema Hübner, [1819] and relatives (tribe Euremini Grote, 1898) than to Gonepterygina: lemon-yellow wings without central spots, hindwings plain or with dark margin by the apex and forewings with dark apex continuing into thin marginal border. See Kaur et al. (2022) for illustrations. A combination of the following nuclear genomic base pairs is diagnostic: pse 19182.2.2: A 3375 G, pse 1982.1.2: A 51 T, pse 200.39.1: T 1209 C, pse 1378. 26.1: G 839 A, pse 200.29.1: C 1534 G. Genera included. Only the type genus.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF85FFAB27F3F987FD0AF1F2.taxon	description	Parent Taxon. Tribe Coliadini Swainson, 1821.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF82FFAB27A9FD5BFCD3F5EB.taxon	description	Hebomoiina Grishin, new subtribe http: // zoobank. org / 71 C 79 ADE- 4 BBF- 4 CC 8 - 86 B 6 - 331 BCD 38863 B	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF82FFAB27A9FD5BFCD3F5EB.taxon	type_taxon	Type genus. Hebomoia Hübner, [1819]. Definition. Hebomoia (type species Papilio glaucippe Linnaeus, 1758) belongs to the tribe Anthocharidini Scudder, 1889, but is genetically differentiated from its other genera (Fig. 5). Phenotypically, species in this lineage are characterized by a more robust appearance that the rest of the tribe. Therefore, we propose that the clade with Hebomoia corresponds to a subtribe. This new subtribe is diagnosed by a bifurcate uncus and bifurcate valva, forewing with five radial veins, two of which and M 1 (not stalked with R) originate at the discal cell, larger size (forewing longer than 40 mm), and pointed broadly orange apex of the forewing. See Klots (1933) for additional discussion and illustrations of these characters given for Hebomoia. A combination of the following nuclear genomic base pairs is diagnostic: pse 123.37.1: A 2228 G, pse 123.37.1: T 1285 A, pse 9809.2.1: G 1812 A, pse 657.5.2: A 89 G, pse 5906.8.2: G 3017 A. Genera included. Only the type genus.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF82FFAB27A9FD5BFCD3F5EB.taxon	description	Parent Taxon. Tribe Anthocharidini Scudder, 1889.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF82FFA82689F971FD06F1C7.taxon	description	The subfamily Dismorphiinae Schatz, 1886 splits into two prominent clades that we propose to treat as tribes: the nominotypical and Leptidiini Grote, 1897, stat. rev., which is monotypic (Fig. 5). The two tribes are well-defined morphologically (Klots 1933) and biogeographically, with Leptidiini being the Old World tribe and Dismorphiini restricted to the New World. http: // zoobank. org / 25317 F 65 - DA 92 - 4 FD 1 - 88 BB-ED 275 C 6 B 46 A 1	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF82FFA82689F971FD06F1C7.taxon	type_taxon	Type genus. Pseudopieris Godman & Salvin, 1890. Definition. Pseudopieris (type species Pieris nehemia Boisduval, 1836) is sister to and is stronger differentiated genetically from the rest of Dismorphiini Schatz, 1886 (Fig. 5). Therefore, combined with phenotypic differences, we propose that the lineage with Pseudopieris corresponds to a subtribe. This new subtribe is distinguished from the rest of Dismorphiini (and Dismorphiinae, for that matter) by much broader wings that are more like in Pieris Schrank, 1801, rather than the elongated wings of Dismorphiinae, the last abdominal segment with rounded lobes and a cleft, and M 1 stalked with R stem on the forewing. See Klots (1933) for details and illustrations given for Pseudopieris. A combination of the following base pairs in the nuclear genome is diagnostic: pse 7986.9.2: A 4048 G, pse 19182.2.2: T 3830 C, pse 165.20.1: A 803 T, pse 578.3.2: C 31 A, pse 578.3.2: A 12 G. Genera included. Only the type genus.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF82FFA82689F971FD06F1C7.taxon	description	Parent Taxon. Tribe Dismorphiini Schatz, 1886.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF81FFB727D5FC88FB5DF6C4.taxon	description	The tribe Vagrantini Pinratana & Eliot, 1996 as currently defined is paraphyletic Currently, the tribe Vagrantini Pinratana & Eliot, 1996 consists of ten genera: Vagrans Hemming, 1934, Cupha Billberg, 1820, Phalanta Horsfield, 1829, Smerina Hewitson, 1874, Terinos Boisduval, 1836, Algia Herrich-Schäffer, 1864), Algiachroa Parsons, 1989, Cirrochroa E. Doubleday, 1847, Lachnoptera E. Doubleday, 1847, and Vindula Hemming, 1934 (Wahlberg 2019). However, our genomic tree reveals that Vagrantini, defined to include all ten genera, is paraphyletic with respect to Argynnini Swainson, 1833 with the highest support (Fig. 6). The first five genera listed above form a clade sister to Argynnini. This clade includes Vagrans, which is the type genus of Vagrantini. Therefore, to restore monophyly, we restrict Vagrantini to include only these five genera: Vagrans, Cupha, Phalanta, Smerina, and Terinos. The remaining five genera previously included in Vagrantini form a clade sister to both Vagrantini and Argynnini (Fig. 6) and, therefore, belong to other tribes. No published family-group names have been formed from any of these five genera; hence, these other tribes are new. They are described below. Vindulini Grishin, new tribe http: // zoobank. org / 151 AC 163 - E 036 - 49 BE-A 49 C- 48 D 7 B 9 F 0108 F	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF81FFB727D5FC88FB5DF6C4.taxon	type_taxon	Type genus. Vindula Hemming, 1934. Definition. Vindula (type species Papilio arsinoe Cramer, 1777) constitutes a lineage sister to four other genera that were previously included in Vagrantini Pinratana & Eliot, 1996 but did not belong to this tribe (see above). This lineage diverged from these other genera at about the same level as (if not earlier than) Vagrantini from Argynnini Swainson, 1833, and therefore corresponds to a tribe (Fig. 6). This new tribe is distinguished from its relatives by sclerotized subpapillary glands in females and forked humeral vein (Penz and Peggie 2003). A combination of the following nuclear genomic base pairs is diagnostic: hm 2013347 - RA. 4: T 162 C, hm 2013540 - RA. 5: G 265 A, hm 2015146 - RA. 7: G 80 A, hm 2015146 - RA. 7: G 79 A, hm 2013347 - RA. 4: A 220 C. Genera included. Only the type genus.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF81FFB727D5FC88FB5DF6C4.taxon	description	Parent Taxon. Subfamily Heliconiinae Swainson, 1822. http: // zoobank. org / AE 49 C 6 E 7 - 8 E 51 - 4 E 4 E- 9947 - 151 B 37 A 467 E 8	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF81FFB727D5FC88FB5DF6C4.taxon	type_taxon	Type genus. Algia Herrich-Schäffer, 1864. Definition. This tribe corresponds to the second major subclade in the clade that is sister to both Argynnini Swainson, 1833 and Vagrantini Pinratana & Eliot, 1996. This subclade is sister to Vindulini trib. n., diverging from it at about the same level as (if not earlier than) Argynnini from Vagrantini (Fig. 6). Due to this prominent genetic differentiation, it is defined as a tribe. This new tribe is distinguished from its relatives by unsclerotized subpapillary glands in females, forked humeral vein, and / or smooth eyes and undifferentiated androconial scales, or by an oval patch of androconial scales in males in the apical area of dorsal hindwing covering 1 / 7 – 1 / 6 of its surface (Penz and Peggie 2003). A combination of the following nuclear genomic base pairs is diagnostic: hm 2000037 - RA. 1: C 698 G, hm 2008858 - RA. 12: T 1021 C, hm 2008858 - RA. 12: C 1022 T, hm 2016824 - RA. 4: C 154 A, hm 2017493 - RA. 1: A 2480 G. Genera included. The type genus (i. e., Algia Herrich-Schäffer, 1864), Algiachroa Parsons, 1989, Cirrochroa E. Doubleday, 1847, and Lachnoptera E. Doubleday, 1847.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF81FFB727D5FC88FB5DF6C4.taxon	description	Parent Taxon. Subfamily Heliconiinae Swainson, 1822. Lachnopterina Grishin, new subtribe http: // zoobank. org / 8 BBABF 1 F- 145 B- 4 A 67 - 94 F 5 - F 498130 FB 857	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF81FFB727D5FC88FB5DF6C4.taxon	type_taxon	Type genus. Lachnoptera E. Doubleday, 1847. Definition. Lachnoptera (type species Papilio iole Fabricius, 1781) forms a lineage that splits from all other Algiini trib. n. at the tree level of subtribes (Fig. 6), therefore representing a subtribe. This new subtribe is distinguished from its relatives by unsclerotized subpapillary glands in females (Penz and Peggie 2003) and an oval patch of androconial scales in males in the apical area of dorsal hindwing covering 1 / 7 – 1 / 6 of its surface. A combination of the following nuclear genomic base pairs is diagnostic: hm 2008958 - RA. 5: T 118 G, hm 2008958 - RA. 5: G 119 T, hm 2006642 - RA. 2: A 2275 C, hm 2006706 - RA. 1: A 709 T, hm 2006706 - RA. 1: A 748 T, hm 2015589 - RA. 1: A 1852 A (not C), hm 2014529 - RA. 4: A 139 A (not G), hm 2012118 - RA. 6: A 79 A (not G), hm 2016492 - RA. 5: A 1813 A (not G), hm 2016492 - RA. 5: C 1831 C (not A). Genera included. Only the type genus.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF81FFB727D5FC88FB5DF6C4.taxon	description	Parent Taxon. Tribe Algiini Grishin, trib. n. Terinosina Grishin, new subtribe http: // zoobank. org / 31 DFAAA 5 - EA 63 - 431 B-AC 9 D-BF 686549 FEC 8	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF81FFB727D5FC88FB5DF6C4.taxon	type_taxon	Type genus. Terinos Boisduval, 1836. Definition. Terinos (type species Terinos clarissa Boisduval, 1836) forms a deep-diverging lineage in the tribe Vagrantini Pinratana & Eliot, 1996 at about the tree level corresponding to subtribes (Fig. 6) and, therefore, represents a subtribe. This new subtribe is distinguished from its relatives by a combination of the following characters: larval head with scoli, hindwing cell closed, a fold across the forewing between R and M veins, vein R 2 arising from discal cell, vein R 4 arising at about the end of R 2, humeral vein simple and straight, gnathos arms not ventrally fused, valva with a long (about 2 / 3 of valva length) projection off its base inside (Penz and Peggie 2003). A combination of the following base pairs in the nuclear genome is diagnostic: hm 2007153 - RA. 3: A 305 G, hm 2014625 - RA. 4: T 887 A, hm 2012596 - RA. 1: C 853 G, hm 2011273 - RA. 1: T 484 G, hm 2011273 - RA. 1: G 486 A. Genera included. Only the type genus.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF81FFB727D5FC88FB5DF6C4.taxon	description	Parent Taxon. Tribe Vagrantini Pinratana & Eliot, 1996. http: // zoobank. org / 06 DF 6620 - 9 B 17 - 4522 - 9 E 4 B-BD 5342 AC 8 DF 5	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF81FFB727D5FC88FB5DF6C4.taxon	type_taxon	Type genus. Smerina Hewitson, 1874. Definition. Smerina (type species Smerina vindonissa Hewitson, 1874) forms a deep-diverging lineage in the tribe Vagrantini Pinratana & Eliot, 1996 at about the tree level corresponding to subtribes (Fig. 6) and therefore represents a subtribe. This new subtribe is distinguished from its relatives by a combination of the following characters: papilla anales moderately retracted (not deeply) inside the body, aedeagus not broadened at the tip in ventral view, costa of valva with one spiny process (Penz and Peggie 2003), forewing apex more produced and hindwing margin evenly curved (not wavy, no tails). A combination of the following base pairs in the nuclear genome is diagnostic: hm 2015462 - RA. 1: T 360 C, hm 2015689 - RA. 5: T 57 C, hm 2009280 - RA. 3: T 94 G, hm 2010526 - RA. 2: A 67 G, hm 2017391 - RA. 1: A 139 C. Genera included. Only the type genus.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF81FFB727D5FC88FB5DF6C4.taxon	description	Parent Taxon. Tribe Vagrantini Pinratana & Eliot, 1996. Lebadeini Grishin, new tribe http: // zoobank. org / F 26 F 931 E- 9141 - 4329 - 92 B 6 - 6 E 86 A 9 F 369 E 9	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF81FFB727D5FC88FB5DF6C4.taxon	type_taxon	Type genus. Lebadea C. Felder, 1861. Definition. Lebadea (type species Limenitis ismene E. Doubleday, 1848, which is a junior subjective synonym of Papilio martha Fabricius, 1787), currently in Neptini Newman, 1870 (Dhungel and Wahlberg 2018; Wahlberg 2019) is not monophyletic with it and instead is placed as sister to the clade of Chalingini Hemming, 1960 and Limenitidini Behr, 1864 but with weak support; therefore, it is distinct from them (Fig. 6). Thus, this lineage, currently consisting only of Lebadea, represents a tribe that does not have a name. This new tribe is diagnosed by a combination of the following characters: tegumen and uncus are smaller than typical for Limenitidini, uncus is more gracile, thus more similar to Neptis [Fabricius], 1807, and differs from Neptis in having a well-defined and projecting anteriad lobe (not just a hump) on the dorsal side of the segment A 2 in the pupa (Willmott 2003). A combination of the following nuclear genomic base pairs is diagnostic: hm 2005025 - RA. 3: C 373 A, hm 2006832 - RA. 2: C 97 A, hm 2004700 - RA. 1: C 590 A, hm 2004700 - RA. 1: G 351 T, hm 2005025 - RA. 3: G 319 A. Genera included. Only the type genus.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF81FFB727D5FC88FB5DF6C4.taxon	description	Parent Taxon. Subfamily Limenitidinae Behr, 1864.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF81FFB727D5FC88FB5DF6C4.taxon	discussion	Comment. Using morphological analysis, Willmott (2003) has placed Lebadea in the “ Limenitis group ” of genera away from Neptis, which seems to agree more with our genomic results.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF9EFFB526F0FA50FCA1F700.taxon	description	Currently, no subtribes are in use for Adoliadini (Wahlberg 2019). However, our genomic tree reveals five prominent clades in this tribe (Fig. 6), confirming the results reported by Dhungel and Wahlberg (2018). We propose to treat these clades as subtribes. This subtribal arrangement will bring additional order to the species-rich tribe Adoliadini. Three of these subtribes have names: the nominotypical one, Abrotina Hemming, 1960, stat. nov., and Bebeariina Hemming, 1960, stat. nov. (the last two were originally proposed as tribes), and two do not. They are described below. Evenaina Grishin, new subtribe http: // zoobank. org / AB 51 B 17 D- 4 CB 5 - 4909 - 8 C 7 C-C 76 C 81 E 84 C 4 B	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF9EFFB526F0FA50FCA1F700.taxon	type_taxon	Type genus. Evena Westwood, 1850. within Adoliadini Doubleday, 1845 on par with other subtribes (Fig. 6) and therefore represents a new subtribe. The new subtribe is diagnosed by genitalia and venation as described in detail and illustrated by Chermock (1950) for the genus Catuna W. F. Kirby, 1871 (a junior objective synonym of Evena). In brief, uniquely long and narrow saccus nearly as long as valva and R 1 vein arising before the end of the discal cell, then fusing with Sc for some distance and diverging to meet costal margin are diagnostic. Furthermore, the subtribe is recognized by the unique appearance of its species, somewhat resembling Heliconiinae Swainson, 1822: with elongated forewings and shorter, rounded hindwings, spider-web forewing pattern, and a pale frequently triangular area across the hindwing toward the apex, hidden from view when the butterfly is sitting. A combination of the following nuclear genomic base pairs is diagnostic: hm 2005164 - RA. 2: C 119 T, hm 2017194 - RA. 1: C 92 T, hm 2017194 - RA. 1: G 298 A, hm 2005515 - RA. 6: C 97 G, hm 2016751 - RA. 4: C 44 T, hm 2007706 - RA. 6: G 759 G (not T), hm 2009397 - RA. 1: A 367 A (not T), hm 2020285 - RA. 1: C 553 C (not A), hm 2020285 - RA. 1: A 554 A (not G), hm 2004293 - RA. 6: A 149 A (not G). Genera included. Only the type genus.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF9EFFB526F0FA50FCA1F700.taxon	description	Parent Taxon. Tribe Adoliadini Doubleday, 1845.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF9EFFB526F0FA50FCA1F700.taxon	discussion	Comment. The name for the subtribe is formed by taking the entire name of the type genus as a root to avoid homonymy with Evenina Faynel & Grishin, 2022 (type genus Evenus Hübner, [1819], in Eumaeini E. Doubleday, 1847). Pseudathymina Grishin, new subtribe http: // zoobank. org / 55581 E 3 A- 18 C 6 - 492 F-BD 1 A- 3 B 3 F 205896 AF	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF9EFFB526F0FA50FCA1F700.taxon	type_taxon	Type genus. Pseudathyma Staudinger, 1891. Definition. Pseudathyma (type species Pseudacraea sibyllina Staudinger, 1890) forms a prominent phylogenetic lineage within Adoliadini Doubleday, 1845 on par with other subtribes (Fig. 6) and, therefore, represents a new subtribe. This new subtribe is diagnosed by open discal cells of both wings, R 2 that originates slightly beyond, instead of before, the end of the discal cell, and the absence of the anal lobe on the hindwing, per Chermock (1950), who gave these characters for Pseudathyma. In wing patterns, members of this subtribe are more similar to Neptis [Fabricius], 1807 in having four generally pale areas on the forewing (by the middle of the inner margin, in the discal area distad of the discal cell, by the apex, and in the discal cell) than to most Adoliadini. A combination of the following nuclear genomic base pairs is diagnostic: hm 2007185 - RA. 1: A 1149 G, hm 2007185 - RA. 1: C 1150 T, hm 2017262 - RA. 1: A 935 G, hm 2018054 - RA. 1: T 155 C, hm 2017807 - RA. 2: A 68 T. Genera included. Only the type genus.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF9EFFB526F0FA50FCA1F700.taxon	description	Parent Taxon. Tribe Adoliadini Doubleday, 1845. Kumothalina Grishin, new subtribe http: // zoobank. org / 101 F 0041 - F 957 - 4 CD 5 - 92 F 7 - 079 A 780 A 043 D	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF9EFFB526F0FA50FCA1F700.taxon	type_taxon	Type genus. Kumothales Overlaet, 1940. Definition. Wahlberg et al. (2020) placed Kumothales (type species Kumothales inexpectata Overlaet, 1940) in the tribe Cymothoini Dhungel & Wahlberg, 2018. Our analysis confirms this conclusion and previously published phylogenies (Wahlberg et al. 2020; Kawahara et al. 2023) and places the Kumothales lineage as sister to all other Cymothoini that diverged from them before the divergence of Adoliadini Doubleday, 1845 into subtribes (Fig. 6). This substantial genetic differentiation of Kumothales is also the reason for the difficulty in finding the place for this genus in taxonomic hierarchy without DNA analysis. Therefore, this lineage represents a subtribe. This new subtribe is distinguished from its relatives by the details of wing venation as described for Kumothales by Overlaet (1940) and a wavy, wings without bands, with a unique submarginal wavy pattern consisting of dark inverted deep U with a sharp tooth (narrow V) inserted into it in every cell. A combination of the following nuclear genomic base pairs is diagnostic: hm 2008200 - RA. 1: A 517 C, hm 2006358 - RA. 1: C 1151 A, hm 2009464 - RA. 1: C 128 T, hm 2010867 - RA. 7: G 38 C, hm 2012380 - RA. 2: A 48 G, hm 2012713 - RA. 1: T 428 T (not C), hm 2012713 - RA. 1: G 946 G (not A), hm 2007718 - RA. 2: C 205 C (not A), hm 2006845 - RA. 2: T 1311 T (not A), hm 2006845 - RA. 2: A 1314 A (not G). Genera included. Only the type genus.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF9EFFB526F0FA50FCA1F700.taxon	description	Parent Taxon. Tribe Cymothoini Dhungel & Wahlberg, 2018. Amnosiini Grishin, new tribe http: // zoobank. org / AD 32 BD 0 A- 6755 - 4650 - AB 24 - 3 FD 7 A 43 DFA 06	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF9EFFB526F0FA50FCA1F700.taxon	type_taxon	Type genus. Amnosia E. Doubleday, 1849. Definition. Amnosia (type species Amnosia decora E. Doubleday, 1849) belongs to the subfamily Pseudergolinae Jordan, 1898, but is more distant from and sister to the rest of the subfamily (Fig. 6). Genetic differentiation of the Amnosia lineage from other Pseudergolinae is at the level of a tribe. Therefore, we propose that the Amnosia lineage corresponds to a tribe. This new tribe is diagnosed by a combination of the following characters: wings mostly dark in males, forewing with a pale stripe from mid-costa to tornus, and hindwing with two pairs of larger submarginal eyespots beneath that are better defined than in other Pseudergolinae. A combination of the following nuclear genomic base pairs is diagnostic: hm 2002290 - RA. 3: A 49 G, hm 2013678 - RA. 4: A 234 C, hm 2013678 - RA. 4: G 246 A, hm 2013678 - RA. 4: T 294 C, hm 2006306 - RA. 3: G 107 C, hm 2013835 - RA. 2: G 178 G (not A), hm 2014102 - RA. 2: C 115 C (not T), hm 2014102 - RA. 2: A 117 A (not T), hm 2009568 - RA. 1: T 184 T (not A), hm 2009568 - RA. 1: C 185 C (not A). Genera included. Only the type genus.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF9EFFB526F0FA50FCA1F700.taxon	description	Parent Taxon. Subfamily Pseudergolinae Jordan, 1898.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF9CFFB02512FB1CFB45F27E.taxon	type_taxon	Type species. Vanessa dione Latreille, [1813]. Definition. The genus Hypanartia Hübner, [1821] (type species Hypanartia demonica Hübner, [1821], which is a junior subjective synonym of Papilio lethe Fabricius, 1793) has been divided into two species groups: the paullus group (includes the type species of Hypanartia) and the dione group (Willmott et al. 2001; Llorente et al. 2023). Our genomic tree shows this split (Fig. 7) and is consistent with the cladogram constructed using morphological characters (Willmott et al. 2001). Here, the division of Hypanartia into two clades is formalized, and the new subgenus is proposed to encompass the dione group. This new subgenus is distinguished from the nominotypical subgenus by male genitalia: nearly triangular in lateral view valvae, separated at the base in ventral view; vinculum broader near the base of succus in lateral view; saccus with narrower anterior part (at least in lateral view); and gnathos continuously sclerotized, joined. See Willmott, Hall, and Lamas (2001) for additional information and illustrations. A combination of the following nuclear genomic base pairs is diagnostic: hm 2021257 - RA. 1: A 261 G, hm 2002154 - RA. 32: T 1114 A, hm 2013826 - RA. 2: G 702 A, hm 2006214 - RA. 3: T 888 C, hm 2005917 - RA. 1: C 3222 G.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF9CFFB02512FB1CFB45F27E.taxon	etymology	Etymology. The Latin prefix hypo - means “ below ”, “ beneath ”, and sometimes “ less than ”. Species of the new subgenus are clearly more than that, and this prefix is replaced with hyper - (i. e., “ above ”, “ high ”, “ beyond ”, “ excessive ”) for an exaggerated look of some of these butterflies: typically with more angular wings, longer tails, and bolder white spots. The name is a feminine noun in the nominative singular. Willmott & J. Hall, 2001, Eurema charon Hewitson, 1878, Hypanartia christophori Jasinski, 1998, Hypanartia cinderella Lamas, Willmott & J. Hall, 2001, Hypanartia fassli Willmott, J. Hall & Lamas, 2001, Eurema kefersteini Doubleday, [1847], Eurema lindigii C. Felder & R. Felder, 1862, Hypanartia splendida Rothschild, 1903, and Hypanartia trimaculata Willmott, J. Hall & Lamas, 2001 (including their subspecies and synonyms). Parent taxon. Genus Hypanartia Hübner, [1821].	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF9CFFB02512FB1CFB45F27E.taxon	discussion	Comments. In their genetic differentiation (Fig. 7), the two subgenera of Hypanartia are approximately the same as some subgenera in Nymphalis Kluk, 1780 (type species Papilio polychloros Linnaeus, 1758). Therefore, they are phylogenetically equivalent to the two subgenera Nymphalis and Aglais Dalman, 1816 (type species Papilio urticae Linnaeus, 1758) (i. e., the same level in the tree), and are stronger differentiated genetically than Nymphalis from Polygonia Hübner, [1819] (type species Papilio c-aureum Linnaeus, 1758). from Vanessa hippomene (Hübner, 1823) Genomic sequencing reveals notable genetic differentiation between the nominotypical Vanessa hippomene (Hübner, 1823) (type locality not given, deduced by wing shape and patterns of a specimen shown in the original illustration to be in South Africa) and Vanessa hippomene madegassorum (Aurivillius, 1899) (type locality in Madagascar) (Fig. 7). The COI barcodes of the two taxa differ by 2.9 % (19 bp). Phenotypically, V. h. madegassorum is characterized by more prominently scalloped (even toothed at veins) wing margins, a longer and thinner major hindwing tail at the end of vein M 3, a second, shorter tail at the end of vein CuA 2 (absent in the nominotypical V. hippomene), orange (rather than yellower) forewing band, green scaling by the forewing apex beneath, and reduced pale scaling and spot by mid-costa on the ventral hindwing (Fig. 8). Taken together, these observations suggest that Vanessa madegassorum (Aurivillius, 1899), stat. nov. is a species distinct from Vanessa hippomene (Hübner, 1823). Vanessa madegassorum stat. nov. is known only from Madagascar, with the last reported record from 1976 (Lees et al. 2003), and may be of conservation concern, if not already extinct. The COI barcode sequence of V. madegassorum stat. nov., sample NVG- 19122 B 12, GenBank accession OR 578710, 658 base pairs, is: TACTTTATATTTTATTTTCGGAATTTGAGCAGGAATAGTTGGAACTTCACTTAGTTTATTAATTCGAACTGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACA ATTGTTACAGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGTTTTGGTAATTGATTAATTCCACTTATATTAGGAGCCCCTGATATAGCTTTTCCACGTA TAAATAATATAAGATTTTGACTTTTACCCCCTTCATTAATATTATTAATTTCTAGTAGAATTGTTGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGC TCATAGAGGATCTTCTGTAGATCTAGCAATTTTTTCATTACATTTAGCTGGAATTTCCTCTATTTTAGGAGCAATTAATTTTATTACTACTATTATTAATATACGAATTAATAGAATATCT TTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGTATTACAGCTTTACTTTTATTAATCTCTCTTCCTGTTTTAGCTGGAGCTATTACTATACTTCTAACAGATCGAAATATTAATACAT CATTTTTTGATCCTGCGGGAGGAGGAGACCCAATTCTTTATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF9CFFB02512FB1CFB45F27E.taxon	description	Subgenera in Vanessa [Fabricius], 1807 The genus Vanessa [Fabricius], 1807 (type species Papilio atalanta Linnaeus, 1758) has been divided into five species groups: the atalanta group (includes the type species of Vanessa), the cardui group (Papilio cardui Linnaeus, 1758 is the type species of Cynthia [Fabricius], 1807), the carye group (Hamadryas carye Hübner, 1812 is the type species of Neofieldia Özdikmen, 2008), the itea group (Wahlberg and Rubinoff 2011). Because four of these groups are characterized by notable genetic differentiation (Fig. 7), we propose to treat the two names as subgenera: Neofieldia Özdikmen, 2008, stat. rest. and Bassaris Hübner, [1821], stat. rev. and leave Cynthia as a junior subjective synonym of Vanessa. The hippomene species group does not have a name. It is described below.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF99FFB0253FFEEBFD0CF620.taxon	type_taxon	Type species. Hypanartia hippomene Hübner, [1823]. Definition. Comprises the hippomene species group in Vanessa [Fabricius], 1807, as proposed by Wahlberg and Rubinoff (2011), who inferred a comprehensive phylogeny of Vanessa and its relatives and discovered the phylogenetic position of the hippomene group within Vanessa. This group is unusual because its constituent species have been previously placed in Antanartia Rothschild & Jordan, 1903 (type species Papilio delius Drury, 1782) due to phenotypic similarities. We treat the hippomene group as a new subgenus (Fig. 7). This subgenus is distinguished from Antanartia by genitalia: in males, aedeagus without spines and projections (does not end in a “ barb ” like a fish hook end structure) and valva without projections off costa, which is nearly straight; and in females, with developed signa in corpus bursae (Howarth 1966), and from Vanessa by a sharp tooth-like tail at the vein M 3 on hindwing. A combination of the following nuclear genomic base pairs is diagnostic: hm 2005743 - RA. 6: T 48 C, hm 2002542 - RA. 3: A 237 G, hm 2017019 - RA. 1: T 160 C, hm 2002154 - RA. 32: A 1116 G, hm 2021745 - RA. 5: C 862 A.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF99FFB0253FFEEBFD0CF620.taxon	etymology	Etymology. The prefix para - means “ beside ”, “ beyond ”, or “ similar to ”. Species of the new subgenus are similar to and were previously placed in Antanartia, and the prefix para - is fused with the latter genus name to form the new name. The name is a feminine noun in the nominative singular. Species included. The type species (i. e., Hypanartia hippomene Hübner, [1823]), Antanartia dimorphica Howarth, 1966, and Hypanartia hippomene var. madegassorum Aurivillius, 1899, stat. nov. (including their subspecies and synonyms). Parent taxon. Genus Vanessa [Fabricius], 1807.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF99FFB0253FFEEBFD0CF620.taxon	discussion	Comments. The four subgenera of Vanessa are more genetically distinct from each other than some subgenera within Nymphalis Kluk, 1780 (type species Papilio polychloros Linnaeus, 1758) (Fig. 7), and several of such Nymphalis subgenera are commonly treated as genera, e. g., Polygonia Hübner, [1819] (type species Papilio c-aureum Linnaeus, 1758).	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF98FFBC250BFF38FCD0F6E3.taxon	diagnosis	Definition and diagnosis. Genomic sequencing of Microtia H. Bates, 1864 (type species Microtia elva H. Bates, 1864) specimens reveals a deep split within its type species (Fig. 10). The western clade (Fig. 10 red) is profoundly differentiated from the eastern clade (Fig. 10 blue) with the Z chromosome Fst / Gmin of 0.60 / 0.006 and COI barcode difference of 4.7 % (31 bp), which is more than expected from phenotypic similarity. This scenario parallels that of Microtia perse (W. H. Edwards, 1882) (type locality in USA: AZ, Graham Co.) vs. Microtia elada (Hewitson, 1868) (type locality in Mexico) (Fig. 10 green vs. violet). Therefore, the two clades represent distinct species. Specimens from around the type locality (Guatemala) belong to the eastern clade. Curiously, Microtia elva horni Rebel, 1906 (type locality in Mexico: Oaxaca) and its junior subjective synonym Microtia elva form draudti Röber, [1914] (type locality in Mexico, “ Coatepec ” on the label of a syntype) (Fig. 10 teal colored), which are also in the eastern clade but are visually rather distinct in their much broader orange-yellow markings and nearly half of dorsal hindwing orange-yellow, are not particularly different genetically from the nominotypical M. elva. Thus, the western clade does not have available names associated with it and represents a new species. This new species is most similar to M. elva, with which it was previously combined. Distinguished from M. elva by largely yellow or orange-yellow tibiae and frequently other leg parts (legs in M. elva are back). Additionally, characterized by narrower orange-yellow bands and thinner, bar-like (particularly in males) orange-yellow mark by the middle of the inner forewing margin (Figs. 11, 12 a). In M. elva, this bar is more rounded, larger, and can be nearly triangular and much broader at the base, widening both distad and basad (Fig. 12 c). The outer edge of the hindwing discal band (on both dorsal and ventral sides) is more angled in the middle (Figs. 11, 12 b), instead of straighter and more rounded edge in M. elva (Fig. 11 d). Due to variation in colors and patterns, most confident identification is provided by DNA. The following combination of characters is diagnostic in the nuclear genome: hm 2014195 - RA. 2: C 190 T, hm 2014195 - RA. 2: T 201 A, hm 2016592 - RA. 17: G 261 A, hm 2017493 - RA. 1: G 240 A, hm 2008057 - RA. 6: T 171 C and COI barcode: G 38 A, C 238 C, 421 C, A 583 T, T 637 C. Barcode sequence of the holotype: Sample NVG- 22096 H 10, GenBank OR 578711, 658 base pairs: TACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAATTGGAACATCTTTAAGACTTTTAATTCGAACTGAATTAGGAAACCCAGGATCATTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAATTCCATTAATATTAGGAGCTCCTGATATAGCTTTCCCCCGAA TAAATAATATAAGATTTTGACTACTACCCCCATCACTTATATTATTAATTTCTAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCTTCTAATATTGC TCATAGAGGATCATCTGTTGATTTAGCAATTTTTTCACTACATCTAGCAGGAATTTCCTCAATTCTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAATAATATATCA TTTGATCAAATACCTTTATTTGTTTGAGCAGTTGGTATTACAGCTCTTTTATTATTATTATCTTTACCAGTATTAGCAGGAGCTATTACTATACTCCTTACTGATCGAAATATTAATACAT CATTTTTTGACCCAGCTGGAGGAGGGGATCCCATTTTATATCAACATCTATTT Fig. 12. Microtia elvira sp. n. (a, b) and Microtia elva (c, d) iNaturalist observations: USA: AZ, Santa Cruz Co.: a) 144668453 Montosa Canyon, GPS 31.6727, − 110.9406, 19 - Aug- 2016 © jmbearce; b) 141491956 Atascosa Mts., California Gulch, GPS 31.4220, − 111.2404, 3 - Oct- 2014 © Ken Kertell; and Mexico: Nuevo Leon, Monterrey: c) 4292755 Parque la Estanzuela, GPS 25.5507, − 100.2707, 7 - Oct- 2016 © Roberto González; d) 171257635 Guadalupe, Contry Sol, GPS 25.6505, − 100.2648, 5 - Jul- 2023 © Rodolfo Salinas Villarreal. Arrows in b) and d) point at the legs to draw attention to their color difference. Images are color-corrected and rotated. CC BY-NC 4.0 https: // creativecommons. org / licenses / by-nc / 4.0 /	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF98FFBC250BFF38FCD0F6E3.taxon	materials_examined	Type material. Holotype: ♂ deposited in the Los Angeles County Museum of Natural History, Los Angeles, CA, USA [LACM], illustrated in Fig. 11, bears three printed (number “ 12 ” handwritten) labels: two white [October 12, 1954 | Madera Canyon, Santa Rita Mt’s. | Southern Arizona. | W. Rees & H. Reid], [DNA sample ID: | NVG- 22096 H 10 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Microtia elvira | Grishin]. Paratypes: 5 ♂♂ 2 ♀♀: 1 ♂ USA, Arizona, Santa Cruz Co., Sycamore canyon, GPS 31.4213, − 111.1942, 25 - Sep- 2015, Brian Banker leg. (NVG- 21091 A 03); others at LACM, Mexico: Sonora: 2 ♂♂ Rio Cuchujaqui, 8 rd. mi E of Alamos, el. 1000 ', 30 - Aug- 1976, J. P. & K. E. Donahue leg. (NVG- 22096 G 07 & G 08); 1 ♀ Alamos, 25 - Jul- 7 - Aug- 1953, Fred S. Truxal leg. (NVG- 22096 H 08); 1 ♂ Sinaloa, 27.8 km S Culiacán, 30 - Aug- 1976, C. D. George & R. K. Snelling leg. (NVG- 22097 A 04); 1 ♂ 1 ♀ Nayarit, 5 – 10 mi N of Tepic, 2500 ' - 3000 ', 13 - Dec- 1946 (NVG- 22097 A 03 & A 01). Type locality. USA: Arizona, Pima / Santa Cruz Cos., Santa Rita Mountains, Madera Canyon.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF98FFBC250BFF38FCD0F6E3.taxon	etymology	Etymology. The meaning of the name Elvira is typically associated with traits such as truthful, trustworthy, or pure, and also noble or elf-like. Formed from the name of its sister species, elva, it signifies our high confidence that this is a “ trustworthy ” species, i. e., strongly differentiated from M. elva but is elva - or elf-like. The name of this western counterpart of M. elva is longer to mean that it takes a long day from sunrise in the east to sunset in the west. The name is a feminine noun in apposition. English name. Elfoid.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF98FFBC250BFF38FCD0F6E3.taxon	distribution	Distribution. Southeastern Arizona and western Mexico (confirmed from Sonora, Sinaloa, and Nayarit).	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF98FFBC250BFF38FCD0F6E3.taxon	discussion	Comment. Both M. elvira sp. n. and M. elva occur in the USA. Microtia elva strays into the lower Rio Grande Valley of Texas, e. g., a male from Brownsville in Cameron County collected by William W. & Nadine McGuire on 20 - Jul- 1971 [TAMU] that we sequenced as NVG- 10626 (Fig. 10). http: // zoobank. org / 3 EE 47 FD 0 - 31 EF- 4 CE 0 - BE 21 - 5 DC 240 F 1 FFEC (Figs. 13 part, 14 – 16)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF98FFBC250BFF38FCD0F6E3.taxon	diagnosis	Definition and diagnosis. Inspection of nuclear genomic trees reveals that a single specimen from Mexico, Sonora, initially identified as “ Cyllopsis pertepida ”, is confidently placed as sister to the clade of three species: Cyllopsis gemma (Hübner, 1808), Cyllopsis pertepida (Dyar, 1912), and Cyllopsis pyracmon (A. Butler, 1867) (Fig. 13 a, b, red and blue), and therefore represents a species distinct from them. In the mitochondrial genome tree, which has lower statistical support, this species is also in the same clade with the three others but is sister to C. gemma (Fig. 13 c). Because all other described species of Cyllopsis R. Felder, 1869 (type species Cyllopsis hedemanni R. Felder, 1869) belong to other clades (Fig. 13) and are phenotypically different (Miller 1974), this species is new. It differs from its relatives by a combination of larger size (forewing length about 20 mm, while typically less than 18 mm in C. gemma), a large androconial patch (cut by veins) in the discal Fig. 15. Cyllopsis brocki sp. n. (possible), iNaturalist observation 142409312 Mexico: Sonora, area of the dorsal forewing (absent in C. gemma), postdiscal brown Yécora, GPS 28.3783, − 108.8370, 3 - Sep- 2018, © line strongly toothed towards the margin at vein M 1 and not jmbearce. Brightened and color-corrected. CC BY-NC reaching the costal margin (as in C. gemma and some C. pertepida, 4.0 https: // creativecommons. org / licenses / by-nc / 4.0 / but not in C. pyracmon), more extensive and coarse mottling on the ventral side of wings, especially in the basal part of the hindwing (as in some C. pyracmon but not in other species), and reduced rusty overscaling dorsally: wings appear more brown than reddish (Figs. 14, 15). In male genitalia (Fig. 16), diagnosed by broader valva with more convex costa-ampulla, valva more distinctively narrowing into harpe in lateral view, harpe with broader and more angular distal end in dorsal view shaped like a triangular plate rather than ending in a point. In DNA, a combination of the following characters is	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF98FFBC250BFF38FCD0F6E3.taxon	materials_examined	Type locality. Mexico: Sonora, Yécora, E of Santa Rosa, Trinidad-Yecora Rd., 3 – 5 mi E of Trinidad mine.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF98FFBC250BFF38FCD0F6E3.taxon	etymology	Etymology. The name honors Jim P. Brock, the collector of the holotype and one of the finest and most knowledgeable Lepidopterists with a sixth sense for butterflies and caterpillars, finding them effortlessly (or so it seems) where others fail. Jim’s significant contributions to butterfly knowledge delivered through his many books, presentations, and nature tours can only be matched by his contagious excitement, passion for sharing his expertise, and unsurpassed kindness. We deeply appreciate Jim's extensive support of our projects throughout the years. The name is a singular noun in the genitive case.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF98FFBC250BFF38FCD0F6E3.taxon	distribution	Distribution. Known only from the holotype collected in Mexico: Sonora.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF98FFBC250BFF38FCD0F6E3.taxon	discussion	Comment. The type locality of this new species is near the type locality of Amblyscirtes brocki H. Freeman, 1992 (Hesperiidae), with its two paratypes collected on the same date and at approximately the same place as the holotype of Cyllopsis brocki sp. n.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF95FFBA250DFA07FD06F27B.taxon	description	http: // zoobank. org / 8 C 350 BD 8 - 8094 - 472 C- 9 C 17 - 70 A 9 C 2023 D 20	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF95FFBA250DFA07FD06F27B.taxon	type_taxon	Type genus. Teratophthalma Stichel, 1909. Definition. Currently placed in the subtribe Eunogyrina Grishin, 2021, Teratophthalma (type species Mesosemia phelina C. Felder & R. Felder, 1862) is indeed sister to its type genus Eunogyra Westwood, 1851, but is rather distant from it both genetically (Fig. 17) and phenotypically, and therefore represents a subtribe of its own. The description and diagnostic characters of this new subtribe are as those given for Teratophthalma on pages 76 – 77 (illustrated in Fig. 11) by Stichel (1910). In brief, the subtribe belongs to Mesosemiini (see Hall (2003) for Teratophthalma) and is diagnosed by the following combination of characters: wings without multiple narrow bands, eyespots at the end of the forewing discal cell but not along wing margins; genitalic valvae short (as long as tegumen) and triangular, simple with pointed apex, genomic base pairs is diagnostic: cne 1792.4.2: T 805 C, cne 11317.11.9: A 512 G, cne 12569.1.1: T 2145 C, cne 599.10.1: A 4814 T, cne 1398.1.1: C 838 G. Genera included. Only the type genus.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF95FFBA250DFA07FD06F27B.taxon	description	Parent Taxon. Tribe Mesosemiini Bates, 1859. Argyrogrammanina Grishin, new subtribe http: // zoobank. org / FA 7881 EE- 0382 - 4796 - 9 C 6 B-A 10 B 4 C 08 B 0 A 1	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF95FFBA250DFA07FD06F27B.taxon	type_taxon	Type genus. Argyrogrammana Strand, 1932. Definition. Argyrogrammana (type species Erycina stilbe Godart, 1824) is prominently differentiated genetically from the rest of Symmachiini Reuter, 1896 (Fig. 17), and we propose that the lineage containing Argyrogrammana is a subtribe. This new subtribe differs from other Symmachiini by a thin submarginal line of (sometimes fused) metallic (golden or silvery-blue) spots on both wings above and beneath and a dark medial stripe across the eyes (Hall and Willmott 1996). A combination of the 2.10: G 382 A, cne 2478.7.10: C 607 A, cne 6674.8.2: G 397 C. Genera included. Only the type genus.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF95FFBA250DFA07FD06F27B.taxon	description	Parent Taxon. Tribe Symmachiini Reuter, 1896.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF93FFBB26D1FEF6FA53F79A.taxon	description	(Figs. 18, 19)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF93FFBB26D1FEF6FA53F79A.taxon	diagnosis	Definition and diagnosis. Genomic sequencing of the holotype of Argyrogrammana praestigiosa (Stichel, 1929) (type locality not specified, likely the Guianas) (in MFNB, NVG- 18077 D 12) reveals that a sequenced specimen identified as A. praestigiosa from southeastern Peru (illustrated in Fig. 11 in Hall et al. (2023 )) is genetically distant from it with COI barcodes differing by 2.6 % (17 bp). In the presence of phenotypic differences, such as those in wing patterns discussed in detail by Hall et al. (2023), the observed genetic differentiation suggests that the specimen from Peru is not A. praestigiosa but a distinct species. This species is new, and its males (female is unknown) differ from superficially most similar A. praestigiosa by the characters described for “ west Amazonian males ” in Hall et al. (2023), such as more extensive orange coloration of dorsal wings, i. e., basal area of forewing with three orange bands and in some specimens an orange marginal streak near tornus, hindwing with more orange scaling by its apex,	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF93FFBB26D1FEF6FA53F79A.taxon	description	Fig. 19. Argyrogrammana astuta sp. n. iNaturalist observations from Peru: Madre de Dios, Tambopata: a) 175878841 GPS − 12.6060, − 69.0324, 27 - Jul- 2023 © danielblanco 521; b) 67719625 Tambopata, GPS − 12.0467, − 69.6766, 29 - Sep- 2017, © Ken Kertell; c) 94229584 ventral of b) © David Geale. Images are color-corrected and rotated. CC BY-NC 4.0 https: // creativecommons. org / licenses / by-nc / 4.0 /	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF93FFBB26D1FEF6FA53F79A.taxon	materials_examined	Type material. Holotype: ♂ deposited in the National Museum of Natural History, Washington, DC, USA [USNM], illustrated in Fig. 18 (and Fig. 11 in Hall et al. (2023) left-right inverted — i. e., mirror image of the specimen — and with imperfections edited out), bears four printed labels: three white [PERU, Madre de Dios | Tambopata Reserve | 12 ° 50 ’ S 69 ° 17 ’ W, 300 m | 28 Oct 1991 | Leg. R. Robbins], [DNA sample ID: | NVG- 19029 F 11 | c / o Nick V. Grishin], [USNMENT | {QR Code} | 01544363], and one red [HOLOTYPE ♂ | Argyrogrammana | astuta Grishin]. Type locality. Peru: Madre de Dios, Tambopata National Reserve, elevation 300 m, GPS − 12.83, − 69.28.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF93FFBB26D1FEF6FA53F79A.taxon	etymology	Etymology. In Latin, astutus is astute, cunning, clever, sly, and artful, and praestigiosus is deceptive and misleading. This new species was skillfully hiding among the deceitful A. praestigiosa until genomic sequencing revealed its distinction. The name is a feminine adjective.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF93FFBB26D1FEF6FA53F79A.taxon	distribution	Distribution. This species is genetically confirmed only from the holotype collected in southeastern Peru; however, it is expected at least in the southwestern Amazonian Basin (Fig. 19).	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF93FFBB26D1FEF6FA53F79A.taxon	discussion	Comments. Hall et al. (2023) described in detail wing pattern differences between populations of A. praestigiosa, concluding that they represent intraspecific variation due to the lack of apparent differences in genitalia and citing phenotypic intermediates. Argyrogrammana astuta sp. n. corresponds to the “ west Amazonian ” A. praestigiosa of Hall et al. (2023). It is possible that A. praestigiosa is even more deceitful, and additional variation described by Hall et al. (2023) may refer to additional species in this complex.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF92FFB82512FA96FCE7F589.taxon	description	Inspection of the genomic tree reveals that Sarota Westwood, 1851 (type species Papilio chrysus Stoll, 1782), which is confidently placed in the tribe Helicopini Stichel, 1928 (Fig. 17), diverges from other members of the tribe at the tree level corresponding to subtribes (left of the lime bar in Fig. 17). Therefore, this lineage represents a valid subtribe. As a result, we propose to split Helicopini into two subtribes: the nominotypical and Sarotina Bridges, 1988, stat. rest. Echenaidina Grishin, new subtribe http: // zoobank. org / 3 BAD 20 C 2 - 92 C 3 - 4 F 44 - A 713 - 583 D 7 B 3932 E 2	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF92FFB82512FA96FCE7F589.taxon	type_taxon	Type genus. Echenais Hübner, [1819]. Definition. Two subgenera, Echenais (type species Lemonias alphaea Hübner, 1808, which is a junior subjective synonym of Papilio thelephus Cramer, 1775) and Imelda Hewitson, 1870 (type species Imelda glaucosmia Hewitson, 1870), show prominent genetic differentiation from other taxa in the tribe Calydnini Seraphim, Freitas & Kaminski, 2018 and, therefore, constitute a subtribe (Fig. 17). This new subtribe differs from other Calydnini by a submarginal (not marginal) continuous yellow, blue, or metallic black or dark brown) hindwing above, or orange patch in the middle of the hindwing. A combination of the following nuclear genomic base pairs is diagnostic: cne 2872.1.1: A 361 C, cne 12666.5.7: A 497 G, cne 2222.10.1: A 431 T, cne 2483.2.1: A 1667 G, cne 254274.1.1: T 198 C. Genera included. Only the type genus (including subgenus Imelda Hewitson, 1870).	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF92FFB82512FA96FCE7F589.taxon	description	Parent Taxon. Tribe Calydnini Seraphim, Freitas & Kaminski, 2018. Echydnina Grishin, new subtribe http: // zoobank. org / 7 E 98 DF 54 - 98 E 3 - 41 D 7 - BC 19 - 3528 A 548 CD 96	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF92FFB82512FA96FCE7F589.taxon	type_taxon	Type genus. Echydna J. Hall, 2002. Definition. Echydna (type species Calydna chaseba Hewitson, 1854) is genetically differentiated from other Calydnini genera at the tree level similar to that of Echenaidina subtrib. n. and therefore represents a distinct subtribe (Fig. 17). Diagnostic characters for this subtribe are as those given in detail and illustrated by Hall (2002) for Echydna. In brief, it is diagnosed by a combination of setose eyes and black frons; in male genitalia, unique cornuti of three elements: a narrow unspined plate anteriad of an unsclerotized sack with small spines and sclerotized ovoid with larger spines; and in female genitalia, small signa without surface sculpturing. A combination of the following nuclear genomic base pairs is diagnostic: cne 2156.9.5: A 3355 G, cne 5645.4.3: G 360 A, cne 16213.4.1: A 205 G, cne 16034.2.1: T 643 G, cne 5785. 9.3: G 454 A. Genera included. Only the type genus.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF92FFB82512FA96FCE7F589.taxon	description	Parent Taxon. Tribe Calydnini Seraphim, Freitas & Kaminski, 2018. Cariina Grishin, new subtribe http: // zoobank. org / 6 D 9 F 6 CE 6 - E 393 - 4484 - 8124 - 963 E 2 C 60 DE 55	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF92FFB82512FA96FCE7F589.taxon	type_taxon	Type genus. Caria Hübner, 1823. Definition. The tribe Riodinini Grote, 1895 (1827) splits into two prominent clades: the larger includes the type genus, and the smaller consists of genera not previously used for family-group names (Fig. 17). We propose that these two clades represent two subtribes, one of which is new. This new subtribe is diagnosed by a combination of the following characters: eyes bare, palpi short, not visible above, both sides of all wings either with submarginal row of metallic (silver, green) spots usually connected into a band, or dark and with yellow bands or spots, or pale veins. In Barbicornis, hindwings unique, shovelshaped with a tail in the middle nearly equal to the hindwing length; in Chamaelimnas, forewings elongated and with a yellow band, either diagonal (from mid-costa to tornus) or longitudinal (from base towards outer margin); in Caria and Seco, forewing costal margin typically at least slightly convex. Male genitalia with terminally bilobed valvae; in Chamaelimnas, boomerang-shaped, ventral lobe vestigial. Best identified by DNA, and a combination of the following nuclear genomic base pairs is diagnostic: cne 1302.2.1: A 1473 G, cne 1302.2.1: A 2614 C, cne 1143.5.1: A 883 G, cne 1143.5.1: A 884 C, cne 8241.4.4: A 67 C. Genera included. The type genus (Caria Hübner, 1823), Barbicornis Godart, 1824, Chamaelimnas C. Felder & R. Felder, 1865, and Seco J. Hall & Harvey, 2002.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF92FFB82512FA96FCE7F589.taxon	description	Parent Taxon. Tribe Riodinini Grote, 1895 (1827).	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF91FFB9253AF8AEFCABF7E0.taxon	description	Currently treated as a tribe within subfamily Miletinae Reuter, 1896, Liphyrini Doherty, 1889 show corresponds to subfamilies (Fig. 20). Therefore, we return this morphologically unique group to the status of a subfamily as originally proposed: Liphyrinae Doherty, 1889, stat. rest. Megalopalpina Grishin, new subtribe http: // zoobank. org / 2 A 22 AFFB- 346 D- 4 DCF-B 256 - C 59 DA 7 FCEFB 1	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF91FFB9253AF8AEFCABF7E0.taxon	type_taxon	Type genus. Megalopalpus Röber, 1886. Definition. Megalopalpus Röber, 1886 (type species Megalopalpus simplex Röber, 1886) forms a lineage sister to all other Miletini Reuter, 1896 and is more prominently separated from them than they are from each other (Figs. 20, 21). Therefore, we propose that this lineage represents a subtribe. This new subtribe is diagnosed by a combination of the following characters, as given for the Megalopalpus section by Eliot (1973): uncus with tegumen plates triangular, with a unique for this group broad lobe-like triangular ventrally-pointed process, falces strongly curved, males lack secondary sexual characters, hindwing with precostal vein. A combination of the following nuclear genomic base pairs is diagnostic: cce 64.1.4: G 152 C, cce 5960.3.7: A 41 T, cce 7884.1.3: A 388 A (not C), cce 28693.2.4: G 109 G (not A), cce 9880.2.2: A 83 A (not C), cce 49.4.1: C 595 C (not T), cce 16970.13.7: T 187 T (not G). Genera included. Only the type genus.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFF91FFB9253AF8AEFCABF7E0.taxon	description	Parent Taxon. Tribe Miletini Reuter, 1896.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFAEFF842538FB3EFD18F036.taxon	type_taxon	Type species. Papilio thysbe Linnaeus, 1764. Definition. African genus Chrysoritis Butler, 1898 (type species Zeritis oreas Trimen, 1891) has been divided into two clades: the eastern (chrysaor clade) and the western (includes the thysbe clade) (Talavera et al. 2020) (Fig. 21). Strong genetic differentiation between these clades warrants their recognition at least as subgenera: estimated divergence time between them is about 17 Mya (Talavera et al. 2020), comparable to that of some genera. Among all Chrysoritis species, the type species of available genus-group names belong to the eastern clade (Talavera et al. 2020): Zeritis oreas Trimen, 1891 (of Chrysoritis), Zeritis lycegenes Trimen, 1874, which is a subspecies of Zeritis lyncurium Trimen, 1868 (of Poecilmitis Butler, 1899), Zeritis phosphor Trimen, 1864 (of Bowkeria Quickelberge, 1972), and Phasis dicksoni Gabriel, 1947 (of Oxychaeta Tite & Dickson, 1973). This eastern clade represents the nominotypical subgenus. However, the western clade remains without a name and represents a new subgenus. This subgenus differs from the nominal by the absence of tibial spicules (Heath 1997), produced (but not tailed) hindwing tornus and / or blue or violet scaling on dorsal surface of wings in some species (lacking in the nominotypical subgenus), and in species with more rounded tornus, spots on ventral forewing — especially at the end of discal cell — are with more extensive silvery scaling. A combination of the following nuclear genomic base pairs is diagnostic: cce 3229.3.2: A 633 G, cce 2784.3.3: C 85 G, cce 2423.1.2: A 2767 T, cce 7537.1.5: C 57 T, cce 5689.1.7: A 744 G.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFAEFF842538FB3EFD18F036.taxon	etymology	Etymology. The name Chrysoritis may have been derived from the Greek " chryso " (gold) and " ritis " (hair or curl). Their Latin equivalents are " aurum " (gold) and “ cirrus " (lock or curl of hair), connected with a Species included. The type species (i. e., Papilio thysbe Linnaeus, 1764) and 41 others, names given in their original combinations: Poecilmitis adonis Pennington, 1962, Poecilmitis turneri amatola Dickson & McMaster, 1967, Chrysoritis adonis aridimontis Heath & Pringle, 2007, Poecilmitis aridus Pennington, 1953, Poecilmitis azurius Swanepoel, 1975, Poecilmitis beaufortia Dickson, 1966, Poecilmitis beulah Quickelberge, 1966, Poecilmitis blencathrae Heath & Ball, 1992, Poecilmitis braueri Pennington, 1967, Poecilmitis thysbe brooksi Riley, 1938, Zeritis chrysantas Trimen, 1868, Poecilmitis (Poecilmitis) daphne Dickson, 1975, Poecilmitis endymion Pennington, 1962, Zeritis felthami Trimen, 1904, Poecilmitis irene Pennington, 1968, Poecilmitis lyndseyae Henning, 1979, Poecilmitis lysander Pennington, 1962, Poecilmitis mithras Pringle, 1994, Phasis thysbe var. nigricans Aurivillius, 1924, Poecilmitis orientalis Swanepoel, 1976, Papilio palmus Stoll, 1781, Poecilmitis pan Pennington, 1962, Poecilmitis pelion Pennington, 1953, Poecilmitis penningtoni Riley, 1938, Poecilmitis perseus Henning, 1977, Poecilmitis plutus Pennington, 1967, Poecilmitis pyramus Pennington, 1953, Zeritis pyroeis Trimen, 1864, Poecilmitis rileyi Dickson, 1966, Poecilmitis stepheni Dickson, 1978, Poecilmitis swanepoeli Dickson, 1965, Poecilmitis thysbe trimeni Riley, 1938, Poecilmitis turneri Riley, 1938, Poecilmitis uranus Pennington, 1962, Poecilmitis violescens Dickson, 1971, Poecilmitis whitei Dickson, 1994, Poecilmitis williami Heath, 1997, Poecilmitis wykehami Dickson, 1980, Papilio zeuxo Linnaeus, 1764, Phasis zeuxo zonarius Riley, 1938, Poecilmitis nigricans zwartbergae Dickson, 1982 (including their subspecies and synonyms). Species taxonomy follows Heath (2023) and Williams (2023 c). Parent taxon. Genus Chrysoritis Butler, 1898.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	description	Inspection of the genomic tree reveals three strongly supported clades in the subfamily Aphnaeinae Distant, 1884 that we define as tribes (Figs. 20, 21): nominotypical, “ Apharitini ” Chou et al., 1994, and the third one that does not have a name and is described below. The name “ Apharitini ” was published in Chou et al. (1994) in an informal way without description, definition, or references to them (fails ICZN Art. 13.) and is a nomen nudum. The name for this tribe that satisfies the requirements of the ICZN Code is proposed below. We define three tribes and not two because the phylogenetic affinities of the unnamed tribes with the nominotypical one are not particularly strong (86 %), and combining their clades may not result in a monophyletic taxon if this topology is incorrect. The three clades are the same in the recently published large-scale tree (Kawahara et al. 2023), but the topology is different in a tree based on a more limited set of gene markers (but a larger set of taxa) (Boyle et al. 2015). http: // zoobank. org / E 44 D 9831 - 7137 - 4120 - 86 CB- 700 DBCC 8 D 752	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	type_taxon	Type genus. Cigaritis Donzel, 1848. Definition. The clade with Cigaritis (type species Cigaritis zohra Donzel, 1848) and related genera is genetically differentiated from other clades and is at the tree level of a tribe (Figs. 20, 21). This new tribe is morphologically diverse and can be distinguished from other members of the subfamily Aphnaeinae Distant, 1884 by the shape of uncus, which is highly variable, but nevertheless bilobed or divided, with centrally concave distal margin (see Stempffer (1967) for illustrations and more detailed descriptions): in Lipaphnaeus Aurivillius, 1916, subtriangular uncus is deeply divided with narrow, tooth-like pointed lobes; in Chloroselas Butler, 1886, the lobes are small and subtriangular uncus is with a central notch separating finely serrated lobes; in Cigaritis Donzel, 1848, uncus is broader than long, nearly rectangular or trapezoidal in dorsal view (sometimes nearly vestigial), lobes widely separated, uncus mostly concave (may be with irregularities) between the lobes; in Chrysoritis Butler, 1898 and Crudaria Wallengren, 1875, uncus is similar, trapezoidal or heart-shaped, but less broad, with rounded lobes and convex margin between them; in Pseudaletis H. H. Druce, 1888, uncus is divided for nearly its entire length with finger-like terminally rounded lobes. In other Aphnaeinae tribes, uncus in undivided and not strongly bilobed: typically, from almost square to broadly rectangular, with nearly flat (with some irregularities) distal margin, or dome-shaped with convex distal margin, which is only slightly concave in Trimenia Tite & Dickson, 1973 (type species Zeritis wallengrenii Trimen, 1887), thus resembling Chrysoritis, but uncus is narrower and without clearly defined lobes expanded laterally (as in Chrysoritis and Crudaria). Furthermore, Trimenia has saccus, which is not developed in Chrysoritis. A combination of the following nuclear genomic base pairs is diagnostic: cce 332.12.5: A 61 T, cce 1232.20.1: A 596 G, cce 1351.40.3: A 349 T, cce 5072.9.1: A 67 C, cce 2368.14.7: G 95 T. Genera included. The type genus (i. e., Cigaritis Donzel, 1848), Chloroselas Butler, 1886, Chrysoritis Butler, 1898, Crudaria Wallengren, 1875, Lipaphnaeus Aurivillius, 1916, and Pseudaletis H. H. Druce, 1888, including their subgenera and synonyms (e. g., Cesa Seven, 1997, Vansomerenia Heath, 1997, and Apharitis Riley, 1925).	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	description	Parent Taxon. Subfamily Aphnaeinae Distant, 1884.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	discussion	Comment. This tribe corresponds to “ Apharitini ” of Chou et al. (1994), published without description, definition, or references to them: a nomen nudum (fails ICZN Art. 13.). Apharitis Riley, 1925 (type species Polyommatus epargyros Eversmann, 1855) is a junior subjective synonym of Cigaritis. Pseudaletidina Grishin, new subtribe http: // zoobank. org / D 8 A 065 B 1 - F 0 CF- 4 A 7 F-BADA-F 06 FDEECA 919	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	type_taxon	Type genus. Pseudaletis H. H. Druce, 1888. Definition. Pseudaletis (type species Pseudaletis agrippina H. H. Druce, 1888) is in the lineage that is sister to all other Cigaritini Grishin, trib. n. and is genetically differentiated from them at the subtribal level (Figs. 20, 21). Therefore, we propose to treat this lineage as a subtribe. This new subtribe is diagnosed by a combination of the following characters, as given for the Pseudaletis section by Eliot (1973): palpi short — much less than half of the head length — covered in appressed scales, proboscis very short (but functional), forewing appears disproportionately large comparatively to hindwing; uncus divided for nearly its entire length with finger-like terminally rounded lobes, falces rudimentary, pointed processes inflexibly fused to tegumen; female abdomen with a prominent tuft of specialized scales, which are spoon-shaped with long “ handles ”. A combination of the following nuclear genomic base pairs is diagnostic: cce 1853.23.8: T 1384 A, cce 133.4.1: A 287 G, cce 4260.4.1: G 34 A, cce 1367.9.3: G 1252 A, cce 17940.6.2: C 71 A. Genera included. Only the type genus.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	description	Parent Taxon. Tribe Cigaritini Grishin, trib. n. http: // zoobank. org / 1 BBFE 9 EC-AB 8 B- 4709 - A 250 - 4 DA 082 ED 2 B 4 E	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	type_taxon	Type genus. Axiocerses Hübner, [1819]. Definition. Axiocerses (type species Papilio perion Stoll, 1782, which is a junior subjective synonym of Papilio harpax Fabricius, 1775) and Zeritis Boisduval, 1836 (type species Zeritis neriene Boisduval, 1836) are confident sisters in the genomic tree (Figs. 20, 21), consistently with similarities in their morphology reported previously (Stempffer 1967). The two genera form a clade that originates early in the radiation of the subfamily Aphnaeinae Distant, 1884, and, therefore, it corresponds to a tribe. This new tribe is distinguished from the relatives by a combination of the following characters: uncus very broad and short, distal margin straight or convex, lobes nearly triangular or rounded, falces thick at the base, then strongly angled with free branch long and slender, ventral side with apophysis, tegumen with uncus hood-shaped, tegumen with convex anterior margin; palpi short, not extending or slightly extending beyond the fronts, 2 nd segment of palpi with long scales and hairs; tarsus unsegmented, with spines below; forewing with only 10 veins (Stempffer 1967; Henning and Henning 1996). The similarity in uncus, falces, and tegumen unifies Axiocerses and Zeritis Boisduval, 1836 (Stempffer 1967). A combination of the following nuclear genomic base pairs is diagnostic: cce 243.9.9: A 1417 C, cce 15587.11.3: G 103 A, cce 127.4.3: A 149 T, cce 980.22.7: C 902 T, cce 2423.1.2: T 2315 C. Genera included. The type genus (i. e., Axiocerses Hübner, [1819]) and Zeritis Boisduval, 1836.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	description	Parent Taxon. Subfamily Aphnaeinae Distant, 1884. Aloeidina Grishin, new subtribe http: // zoobank. org / A 32 E 1 EE 2 - A 06 D- 4100 - AFD 9 - 3214 F 38 A 2 C 93	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	type_taxon	Type genus. Aloeides Hübner, [1819]. Definition. Within Aphnaeini Distant, 1884, the clade of several genera that includes Aloeides (type species Papilio pierus Cramer, 1779) corresponds to the subtribal level in the tree (Figs. 20, 21). This new subtribe is distinguished from its relatives by a combination of these characters, as discussed and illustrated by Stempffer (1967), Tite & Dickson (1973), and Eliot (1973): foreleg and midleg tibiae with apical spurs, palpi smooth, with equal length scales (in several species with some scattered long ribbonshaped blunt scales), or with uniquely long and bristly white scales (in Erikssonia Trimen, 1891), forewing vein R 4 + 5 originates at or beyond the junction of the discocellular vein and vein M 1, vein R 2 originates next to the origin of vein R 4 + 5. A combination of the following nuclear genomic base pairs is diagnostic: cce 5760.10.2: C 484 T, cce 2790.13.2: T 63 C, cce 2790.13.2: A 183 G, cce 1354.3.7: A 61 T, cce 1354.3.7: T 1903 A. Genera included. The type genus (i. e., Aloeides Hübner, [1819]), Argyraspodes Tite & Dickson, 1973, Erikssonia Trimen, 1891, and Trimenia Tite & Dickson, 1973.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	description	Parent Taxon. Tribe Aphnaeini Distant, 1884. Phasisina Grishin, new subtribe http: // zoobank. org / B 6 D 8239 D-DAF 0 - 4865 - 9 F 3 E- 18677 ABDEA 6 F	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	type_taxon	Type genus. Phasis Hübner, [1819]. Definition. Within Aphnaeini Distant, 1884, the clade of several genera that includes Phasis (type species Papilio salmoneus Stoll, 1781, which is a junior subjective synonym of Papilio thero Linnaeus, 1764) corresponds to the subtribal level in the tree (Figs. 20, 21). This new subtribe is distinguished from its relatives by a combination of the following characters, as discussed and illustrated by Tite & Dickson (1973): tibia of all legs without apical spurs, forewing vein M 2 originates much closer to the origin of vein longer than 16 mm. A combination of the following nuclear genomic base pairs is diagnostic: cce 288.3.2: A 79 C, cce 33.3.3: A 234 G, cce 2859.6.1: T 729 C, cce 511.6.1: A 54 G, cce 14215.5.1: T 850 C, cce 33280.1.7: T 944 T (not A), cce 3467.4.4: A 374 A (not G), cce 7428.5.1: G 156 G (not A), cce 4435.12.1: C 616 C (not A), cce 1239.1. 3: T 235 T (not G). Genera included. The type genus (i. e., Phasis Hübner, [1819]) and Tylopaedia Tite & Dickson, 1973.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	description	Parent Taxon. Tribe Aphnaeini Distant, 1884.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	description	Drinini Grishin, new tribe http: // zoobank. org / 2001 E 28 A- 4 C 8 C- 45 D 9 - B 228 - E 34 D 99 B 26 E 85	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	type_taxon	Type genus. Drina Nicéville, 1890. Definition. Currently in Loxurini Swinhoe, 1910, Drina (type species Myrina donina Hewitson, 1865) is not monophyletic with it and is not closely related to that tribe, instead forming a separate lineage originating early in the diversification of Theclinae Swainson, 1831 (Fig. 20). Therefore, we propose that this lineage corresponds to a tribe. This new tribe is diagnosed by a combination of the following characters, as given for the Drina section by Eliot (1973): male genitalia with significantly reduced (nearly vestigial) tegumen (not wider than valva in lateral view), uncus, and falces, and long and narrow vinculum; forewing with 11 veins, the three M veins are nearly at the same distance from each other, hindwing with a single tail at vein CuA 2. A combination of the following nuclear genomic base pairs is diagnostic: cce 305.14.6: G 130 A, cce 305.14.6: T 131 C, cce 1105.7.5: G 93 A, cce 144.8.2: G 223 A, cce 204.17.10: C 49 A, cce 3081.9.2: G 97 G (not T), cce 2598.5.13: G 484 G (not C), cce 2598.5.13: C 485 C (not A), cce 948.2.2: T 73 T (not A), cce 948.2.2: A 139 A (not G). Genera included. Only the type genus.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	description	Parent Taxon. Subfamily Theclinae Swainson, 1831. Hypochrysopini Grishin, new tribe http: // zoobank. org / 71317481 - C 0 FE- 4839 - 97 E 2 - 341444327 DD 7	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	type_taxon	Type genus. Hypochrysops C. Felder & R. Felder, 1860. Definition. Currently placed in Luciini Waterhouse & Lyell, 1914, Hypochrysops (type species Papilio polycletus Linnaeus, 1758) and related genera are not monophyletic with it and instead form a distinct clade within Theclinae Swainson, 1831 not confidently associated with any other subtribe (Fig. 20). Therefore, this clade represents a subtribe. This new tribe is diagnosed by a combination of the following characters, as given for the Hypochrysops section by Eliot (1973): uncus not produced, rounded, falces prominent, strongly curved, juxta absent or vestigial, aedeagus very thick, just slightly narrower than valva, valva rhomboidal, saccus not developed; ventral wing surface typically with obsolete or distorted patterns with metallic silver or green spots and bands and red blotches. A combination of the following nuclear genomic base pairs is diagnostic: cce 3313.6.1: G 1784 C, cce 3313.6.1: G 2131 C, cce 67043.1.6: C 55 G, cce 67043.1.6: A 56 T, cce 1184.15.22: G 142 C.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	description	Jalmenini Grishin, new tribe http: // zoobank. org / D 58 D 0 D 0 A- 382 D- 4 E 6 D-B 879 - 75 D 3 DE 7 A 3670	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	type_taxon	Type genus. Jalmenus Hübner, 1818. Definition. Currently in Zesiusinae Swinhoe, 1912, Jalmenus (type species Jalmenus evagoras Hübner, 1818, which is a junior homonym of Papilio evagoras Donovan, 1805) is far removed from the genus Zesius Hübner, [1819] (type species Zesius chrysomallus Hübner, 1823) in the genomic tree, and instead forms a distinct lineage within Theclinae Swainson, 1831 not confidently associated with other genera (Fig. 20). Therefore, this lineage represents a tribe. This new tribe is diagnosed by a combination of the following characters, as given for the Jalmenus section (excluding Pseudalmenus H. H. Druce, 1902) by Eliot (1973): uncus and tegumen narrower in lateral view, longer than in relatives, ventral side not expanded, falces smaller, tegumen not expanded anteriad, valva without costal process, simple and rounded; palpi with 3 rd segment very long, 2 nd segment with bristle-like scales. A combination of the following nuclear genomic base pairs is diagnostic: cce 9330.11.2: G 69 A, cce 7486.3.3: T 58 G, cce 9657.10. 14: T 3166 C, cce 10680.1.1: T 28 C, cce 4529.2.2: A 67 G. Genera included. Only the type genus.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	description	Parent Taxon. Subfamily Theclinae Swainson, 1831. Pseudalmenini Grishin, new tribe http: // zoobank. org / BB 6 B 6 C 59 - EAD 7 - 42 B 4 - B 7 E 6 - CA 95 E 94 A 419 D	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	type_taxon	Type genus. Pseudalmenus H. H. Druce, 1902. Definition. In the genomic tree, Pseudalmenus (type species Ialmenus myrsilus Westwood, 1851, which is a subspecies of Thecla chlorinda Blanchard, 1848) is a weakly supported (54 %) sister of Jalmenus Hübner, 1818, and therefore may not be monophyletic with it (Fig. 20). Hence, we propose that this lineage represents a tribe. This new tribe was included in the Jalmenus section by Eliot (1973) and is diagnosed by a combination of the following characters: 3 rd segment of palpi shorter than in Jalmenini trib. n., 2 nd segment hairy; uncus with ventral portion expanded, protruding posteriad of the dorsal margin, falces long and strongly curved, tegumen well-developed, expanded anteriad, valva with the curved costal process giving it a crab claw-like appearance. A combination of the following nuclear genomic base pairs is diagnostic: cce 10780.3.1: G 247 A, cce 1122.11.2: C 1079 G, cce 11670.2.2: C 750 T, cce 24738.4.8: A 1793 G, cce 10780.2.2: A 2954 G. Genera included. Only the type genus.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	description	Parent Taxon. Subfamily Theclinae Swainson, 1831. Myrinini Toxopeus, 1929 is a tribe Currently in Amblypodiini Doherty, 1886, close relatives Myrina [Fabricius], 1807 (type species Papilio alcides Cramer, 1776) and Iraota F. Moore, 1881 (type species Hesperia maecenas Fabricius, 1793) are distantly related to Amblypodia Horsfield, 1829 (type species Thecla narada Horsfield, 1828). The clade of these three genera is not strongly supported (42 %) in our tree (Fig. 20), and their union is not monophyletic in a global phylogeny of butterflies (Kawahara et al. 2023). Therefore, we propose a status of a tribe for Myrinini Toxopeus, 1929, stat. nov., which consists of two genera (Myrina and Iraota). Horagina Swinhoe, 1910 and Loxurina Swinhoe, 1910 are subtribes of Cheritrini Swinhoe, 1910 Currently regarded as distinct tribes, Cheritrini Swinhoe, 1910, Horagini Swinhoe, 1910, and Loxurini Swinhoe, 1910 (Eliot 1973) are closely related to each other and are at the tree level of subtribes (Fig. 20). Being combined, all three constitute one tribe. The priority of these names could not be determined because they were proposed (as subfamilies) on the same page of the same work (i. e., issued on the same date). As the first revisers, we give priority to Cheritrini Swinhoe, 1910, because this group includes more genera and species than the other two. As a result, we propose that Horagina Swinhoe, 1910, stat. nov. and Loxurina Swinhoe, 1910, stat. nov. are subtribes of Cheritrini Swinhoe, 1910. Rapalini Grishin, new tribe http: // zoobank. org / 6 B 76 C 64 C- 1 C 57 - 4 CC 8 - BBA 2 - 925 D 4 AFBCF 7 D	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	type_taxon	Type genus. Rapala F. Moore, 1881. Definition. Currently, in Deudorigini Doherty, 1886, several genera, including Rapala (type species Thecla varuna Horsfield, 1829), form a clade that is not confidently monophyletic with it: only 26 % partitions in the genomic tree support their grouping with Deudorigini. Low support values indicate a more distant relationship and a possibility of incomplete lineage sorting or gene exchange around the time of origin of these clades. The clade consisting of Rapala (mostly Oriental) and three Afrotropical genera closely related to Pilodeudorix H. H. Druce, 1891 (type species Pilodeudorix barbatus H. H. Druce, 1891) is most confidently supported (100 %) and corresponds to the level of a tribe in the tree (Fig. 20). This new tribe differs from relatives by male genitalia having conjoined valvae that evenly taper to narrow rounded or pointed apices, uncus and tegumen broad, two lobes of uncus with a concave margin between them, hood-shaped; secondary sexual characters in males: an oval brand of small androconia near the base of cell Sc + R 1 - RS (at least in non-African species), and typically a hair tuft on ventral forewing near inner margin to complement the brand, sometimes with other brands, including those on abdomen; hindwing tailed, forewing veins R 4 + 5 and M 1 originate separately, although may be very narrowly separated at their origins (Eliot 1973). Most confidently distinguished by DNA and a combination of the following base pairs in the nuclear genome is diagnostic: cce 303273.1.1: G 197 A, cce 1093.2.1: A 4672 C, cce 3516.7.1: A 173 T, cce 12299.7.3: G 134 A, cce 4160.2.2: A 207 G. Genera included. The type genus (i. e., Rapala F. Moore, 1881), Pilodeudorix H. H. Druce, 1891, Hypomyrina H. H. Druce, 1891, and Paradeudorix Libert, 2004.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	description	Parent Taxon. Subfamily Theclinae Swainson, 1831. Pilodeudorigina Grishin, new subtribe http: // zoobank. org / 5826 F 9 A 8 - 6834 - 487 C-B 207 - DC 883 CE 19307	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	type_taxon	Type genus. Pilodeudorix H. H. Druce, 1891. Definition. Afrotropical clade of Rapalini trib. n. that includes Pilodeudorix (type species Pilodeudorix barbatus H. H. Druce, 1891, which is a junior subjective synonym of Sithon camerona Plötz, 1880) is genetically differentiated from non-Arican (mostly Oriental) species at the tree level of a subtribe (Fig. 20). This new subtribe is diagnosed by a combination of the following characters: abdomen frequently with scent brands and hindwings with hair tufts; aedeagus shorter and less gracile that in the nominotypical tribe, frequently expanded terminally, vesica with many small cornuti and usually with large cuneus; basally fused valvae with a rectangular gap between them in many species, in others, each valva with a process, hook-like in ventral view, uncus lobes are frequently less separated from each other than in the nominotypical subtribe (Stempffer 1967). Best distinguished by DNA and a combination of the following nuclear genomic base pairs is diagnostic: cce 303351.9.14: A 88 G, cce 303351.9.14: A 89 G, cce 14215.8.1: C 143 T, cce 881.1.6: A 79 G, cce 462.24.2: C 89 G. Genera included. The type genus (i. e., Pilodeudorix H. H. Druce, 1891), Hypomyrina H. H. Druce, 1891, and Paradeudorix Libert, 2004.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	description	Parent Taxon. Tribe Rapalini Grishin, trib. n.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	description	Hemiolaina Grishin, new subtribe http: // zoobank. org / 45 FFC 7 EB- 6 CFA- 49 A 6 - A 688 - EC 98 E 721 BA 62	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	type_taxon	Type genus. Hemiolaus Aurivillius, 1922. Definition. Hemiolaus (type species Jolaus caeculus Hopffer, 1855) forms a lineage sister to other Oxylidini Eliot, 1973, but is genetically differentiated from them at the subtribal level, and therefore represents a subtribe (Fig. 22). This new subtribe is diagnosed by a combination of the following characters, as given for the Hemiolaus section by Eliot (1973): juxta enlarged, longer than half of valva, shaped as the end of a nail puller with a deep cleft; ventral hindwing of males with a scent patch beneath a hair brush; antennal club short, nudum confined to the club, about 32 segments, palpi with 3 rd segment slightly less than half of the 2 nd, tarsus of male foreleg terminally tapered and downturned. A combination of the following nuclear genomic base pairs is diagnostic: cce 54422.3.2: C 373 T, cce 993.15.2: A 922 T, cce 303329.2.7: A 2399 C, cce 2502.15.1: A 320 C, cce 5483.2.11: T 370 A. Genera included. Only the type genus.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	description	Parent Taxon. Tribe Oxylidini Eliot, 1973. Cupidopsina Grishin, new subtribe http: // zoobank. org / 8 AFD 9453 - 3743 - 4 ECB-BA 87 - 4 DAC 0 A 3297 FB	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	type_taxon	Type genus. Cupidopsis Karsch, 1895. Definition. Confidently placed in the tribe Hypotheclini Eliot, 1973, the lineage with Cupidopsis (type species Lycaena jobates Hopffer, 1855) is genetically differentiated from the Hypothecla Semper, 1890 lineage at the tree level of subtribes (Fig. 22) and therefore represents a subtribe. This new subtribe is diagnosed by a combination of the following characters as given for the Cupidopsis section by Eliot (1973): only 10 veins on the forewing, secondary sexual characters absent, aedeagus with developed coecum and ductus entrance on dorsal side, saccus smaller than in relatives, nearly vestigial, tegumen with uncus comparatively massive, the same length as valva in lateral view. A combination of the following nuclear genomic base pairs is diagnostic: cce 9377.2.3: A 136 T, cce 4053.12.2: A 3235 C, cce 332.21. 2: G 117 T, cce 199. 20.2: A 244 C, cce 3203.9.2: A 172 C. Genera included. Only the type genus.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	description	Parent Taxon. Tribe Hypotheclini Eliot, 1973.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	discussion	Comments. A family-group name formed from the same genus was proposed as a nomen nudum (fails ICZN Art. 13.) by Koçak (1996). The genomic tree demonstrates that this subtribe (as other Hypotheclini) belongs to Polyommatinae Swainson, 1827 (Figs. 20, 22), contrary to the hypothesis of Stradomsky Niphandina Sibatani & Ito, 1942 is a subtribe In agreement with Stradomsky (2016), we find that Niphandini Sibatani & Ito, 1942 clusters closely with Polyommatini Swainson, 1827, being at the tree level with subtribes (Fig. 22). Therefore, we confirm its treatment as a subtribe Niphandina Sibatani & Ito, 1942, stat. conf. Theclinesthina Grishin, new subtribe http: // zoobank. org / 32 E 65131 - DDFB- 4 EBC-BE 37 - 4 F 42 E 8 F 5 F 6 D 3	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	type_taxon	Type genus. Theclinesthes Röber, 1891. Definition. The clade with Theclinesthes (type species Plebeius (Theclinesthes) eremicola Röber, 1891, which is a junior subjective synonym of Nacaduba miskini gaura Doherty, 1891) originates near the base of Polyommatini Swainson, 1827 (Fig. 22) and therefore represents a subtribe. This new subtribe is diagnosed by a combination of the following characters, as given for the Theclinesthes section by Eliot (1973) and Stradomsky (2016): uncus lobes and (vestigial) falces directed ventrad, vinculum in lateral view much broader than in relatives, as broad as valva, aedeagus basally bulbous and apically tapered, ductus enters at anterior end, valva constricted in the middle. A combination of the following nuclear genomic base pairs is diagnostic: cce 2737.15.2: A 259 G, cce 3516.7.8: A 98 T, cce 10374.3.2: A 67 C, cce 2234.8. 11: G 1960 A, cce 2399.18.8: A 86 G. Genera included. The type genus (i. e., Theclinesthes Röber, 1891), Neolucia G. Waterhouse & Turner, 1905, and Sahulana Hirowatari, 1992.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	description	Parent Taxon. Tribe Polyommatini Swainson, 1827.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	discussion	Comment. The same name was published in a pioneering study by Stradomsky (2016) without explicitly indicating that the name was intentionally new (fails ICZN Art. 16.1.) and not stating what the type genus of this taxon was (fails ICZN Art. 16.2.). This name for the subtribe already discovered by Stradomsky and confirmed by our genomic analysis is simply formalized here to comply with the ICZN Code (ICZN [International Commission on Zoological Nomenclature] 1999). Azanina Grishin, new subtribe http: // zoobank. org / DF 55 B 888 - 23 ED- 4 B 2 E- 94 F 9 - B 1 B 6685 CBDA 3	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	type_taxon	Type genus. Azanus F. Moore, 1881. Definition. Azanus (type species Papilio ubaldus Stoll, 1782) is confidently placed in a clade of Polyommatini Swainson, 1827 containing several subtribes, not confidently grouping with any of them (Fig. 22). Therefore, the lineage with Azanus represents a subtribe. This new subtribe is diagnosed by a combination of the following characters, as given for the Azanus section by Eliot (1973): male genitalia elongated and flattened, uncus narrowly divided into separate lobes, forewings veins SC and R 1 come together and then diverge, androconia of two unusual types: nearly rectangular scales with concave bases and long padded scales, eyes hairy, ventral forewing with a dark streak below SC vein. A combination of the following nuclear genomic base pairs is diagnostic: cce 9549.2.2: A 815 G, cce 302383.7.1: T 1153 A, cce 302383.7.1: C 1154 G, cce 2510.1.2: A 686 G, cce 178.15.6: A 356 G. Genera included. Only the type genus.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	description	Parent Taxon. Tribe Polyommatini Swainson, 1827.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	discussion	Comment. The same name was proposed as a nomen nudum (fails ICZN Art. 13.) by Koçak (1996) and then published in a pioneering study by Stradomsky (2016) without explicitly indicating that the name was intentionally new (fails ICZN Art. 16.1.) and not stating what the type genus of this taxon was (fails by our genomic analysis is simply formalized here to comply with the ICZN Code (ICZN [International Commission on Zoological Nomenclature] 1999). Unina Grishin, new subtribe http: // zoobank. org / 2 FD 670 E 6 - 5 ECD- 404 E-A 1 F 7 - 842 AEF 97335 C	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	type_taxon	Type genus. Una Nicéville, 1890. Definition. Una (type species Zizera? usta Distant, 1886) is confidently placed in the clade of Polyommatini Swainson, 1827 with several subtribes, not confidently grouping with any of them (Fig. 22). Therefore, the lineage with Ionolyce represents a subtribe. This new subtribe is a union of the Una and Petrelaea sections of Eliot (1973), who listed characters for them, and is diagnosed as follows: male genitalia elongated and appear flattened, with gracile and long aedeagus and prominent saccus (absent in close relatives); forewings with 11 veins, veins SC and R 1 fuse at least for some distance. A combination of the following nuclear genomic base pairs is diagnostic: cce 10730.5.6: A 179 T, cce 7658.4.3: A 184 G, cce 4822.3.3: A 98 T, cce 5018.4.1: A 78 G, cce 870.7.1: G 452 A. Genera included. The type genus (i. e., Una Nicéville, 1890), Orthomiella Nicéville, 1890, Petrelaea Toxopeus, 1929, and Pseudonacaduba Stempffer, 1942.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	description	Parent Taxon. Tribe Polyommatini Swainson, 1827.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	discussion	Comment. The same name was proposed as a nomen nudum (fails ICZN Art. 13.) by Koçak & Seven (1997). Ionolycina Grishin, new subtribe http: // zoobank. org / 77081 BED-FF 23 - 424 A- 98 B 3 - 541 E 04 BA 53 E 5	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	type_taxon	Type genus. Ionolyce Toxopeus, 1929. Definition. Ionolyce (type species Ionolyce helicon javanica Toxopeus, 1929) is confidently placed in the clade of Polyommatini Swainson, 1827 with several subtribes, not confidently grouping with any of them (Fig. 22). Therefore, the lineage with Ionolyce represents a subtribe. This new subtribe is diagnosed by a combination of the following characters, as given for Ionolyce by Tite (1963): cornuti in aedeagus are large and spine-like, ribs in androconial scales are ribbon-like with nodular irregularities mainly in the posterior third of the scale; fused part of veins SC and R 1 is typically longer than in relatives, and the free end of vein SC is faint. A combination of the following nuclear genomic base pairs is diagnostic: cce 437.15.1: A 182 G, cce 303334.4.2: C 106 G, cce 3111.1.6: A 86 G, cce 3368.2.2: T 241 A, cce 29649.12.1: A 151 G. Genera included. The type genus (i. e., Ionolyce Toxopeus, 1929) and Paraduba Bethune-Baker, 1906.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	description	Parent Taxon. Tribe Polyommatini Swainson, 1827. Pithecopina Grishin, new subtribe http: // zoobank. org / 3 E 5 E 4 A 9 A- 64 A 9 - 4 AFC- 85 DD- 81 B 13 BE 53 FBF	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	type_taxon	Type genus. Pithecops Horsfield, 1828. Definition. The clade with Pithecops (type species Pithecops hylax corax Fruhstorfer, 1919, which is a subspecies of Pithecops corvus Fruhstorfer, 1919) is confidently placed as sister to the “ crown group ” of Polyommatini Swainson, 1827 that undergoes extensive diversification (Fig. 22), and we include it in the “ crown group ” despite its unusual wing patterns. The Pithecops clade does not have close relatives within Polyommatini and, therefore, represents a subtribe. This new subtribe is diagnosed by a combination of the following characters, as given for the Pithecops section by Eliot (1973): male genitalia elongated and and R 1 fuse at least for some distance, eyes not hairy, palpi hairy. A combination of the following nuclear genomic base pairs is diagnostic: cce 59502.1.2: A 118 G, cce 1246.19.3: A 71 G, cce 9990.6.1: G 740 A, cce 1317. 1.1: C 772 T, cce 3516.4.2: G 83 T. Genera included. Only the type genus.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	description	Parent Taxon. Tribe Polyommatini Swainson, 1827.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	discussion	Comment. The same name was published in a pioneering study by Stradomsky (2016) without explicitly indicating that the name was intentionally new (fails ICZN Art. 16.1.) and not stating what the type genus of this taxon was (fails ICZN Art. 16.2.). This name for the taxon already discovered by Stradomsky and confirmed by our genomic analysis is simply formalized here to comply with the ICZN Code (ICZN [International Commission on Zoological Nomenclature] 1999). Zizulina Grishin, new subtribe http: // zoobank. org / A 230 CCD 1 - B 083 - 4025 - 8 B 78 - A 31 A 89478932	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	type_taxon	Type genus. Zizula Chapman, 1910. Definition. The lineage with Zizula (type species Lycaena gaika Trimen, 1862, which is a junior subjective synonym of Papilio hylax Fabricius, 1775) is a confident sister to Brephidiina Stempffer, 1957, but is at the tree level that corresponds to subtribes in the “ crown group ” of Polyommatini Swainson, 1827 (Fig. 22) and therefore represents a subtribe. This new subtribe is diagnosed by a combination of the following characters, as given for the Zizula section by Eliot (1973): male genitalia unusual, aedeagus stout and terminally divided into two processes of about half of its length, dorsal and ventral, together resembling a beak, valva with a rod-like process of about the same length as genitalia and long bristles twice of valval length, veins SC and R 1 fused towards costa, secondary sexual characters absent. A combination of the following nuclear genomic base pairs is diagnostic: cce 993.15.2: A 161 G, cce 993.15.2: T 162 C, cce 811.10.3: A 2207 G, cce 811.10.3: T 2197 C, cce 1162.15.2: T 151 A. Genera included. Only the type genus.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	description	Parent Taxon. Tribe Polyommatini Swainson, 1827.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	discussion	Comment. The same name was proposed as a nomen nudum (fails ICZN Art. 13.) by Koçak (1996) and then published in a pioneering study by Stradomsky (2016) without explicitly indicating that the name was intentionally new (fails ICZN Art. 16.1.) and not stating what the type genus of this taxon was (fails ICZN Art. 16.2.). This name for the subtribe already discovered by Koçak and Stradomsky and confirmed by our genomic analysis is simply formalized here to comply with the ICZN Code (ICZN [International Commission on Zoological Nomenclature] 1999). Jamidina Grishin, new subtribe http: // zoobank. org / F 3 E 26669 - CDF 0 - 4 EFC- 9539 - F 88 A 3 D 47 B 1 F 7	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	type_taxon	Type genus. Jamides Hübner, [1819]. Definition. The lineage with Jamides (type species Papilio bochus Stoll, 1782) is a confident sister to Celastrinina Tutt, 1907, but splits from the latter at the tree level of subtribes (Fig. 22), thus representing a subtribe. This new subtribe is diagnosed by a combination of the following characters, as given for the Jamides section by Eliot (1973): male genitalia with vinculum lacking cephalad expansion, uncus directed ventrad, falces very long (nearly half of valva length), aedeagus longer than valva (usually by a third or more), valva deeply bilobed; forewing veins SC and R 1 are not fused for any distance, but connected with a short cross-vein. A combination of the following nuclear genomic base pairs is diagnostic: cce 23510.3.2: T 93 C, cce 23510.3.2: A 432 G, cce 1568.2.4: A 5519 G, cce 1568.2.4: A 6856 C, cce 10823.2.3: T 258 C. Parent Taxon. Tribe Polyommatini Swainson, 1827.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	discussion	Comment. The same name was proposed as a nomen nudum (fails ICZN Art. 13.) by Koçak (1996) and then published in a pioneering study by Stradomsky (2016) without explicitly indicating that the name was intentionally new (fails ICZN Art. 16.1.) and not stating what the type genus of this taxon was (fails ICZN Art. 16.2.). This name for the subtribe already discovered by Koçak and Stradomsky and confirmed by our genomic analysis is simply formalized here to comply with the ICZN Code (ICZN [International Commission on Zoological Nomenclature] 1999). Fameganina Grishin, new subtribe http: // zoobank. org / 07 D 24435 - 1 EAD- 4 C 80 - 9350 - 0 A 1 FA 6003972	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	type_taxon	Type genus. Famegana Eliot, 1973. Definition. The lineage with Famegana (type species Lycaena alsulus Herrich-Schäffer, 1869, which is a junior subjective synonym of Lycaena nisa Wallace, 1866) is sister to Zizeeriina Chapman, 1910 with moderate confidence (Fig. 22). Because the confidence of this grouping is not the highest and because this lineage originates at the tree level of subtribes, it represents a subtribe. This new subtribe is diagnosed by a combination of the following characters, as given for the Famegana section by Eliot (1973): in male genitalia, tegumen and uncus bulky, falces stout and nearly rigidly connected, uncus lobes terminally pointed and slightly downturned; veins SC and R 1 touch each other over a short distance, eyes not hairy, palpi with bristles. A combination of the following nuclear genomic base pairs is diagnostic: cce 1088.12. 3: A 100 T, cce 1088.12.3: G 102 A, cce 18.45.4: G 1256 T, cce 18.45.4: G 1255 A, cce 10490.1.2: T 1933 A. Genera included. Only the type genus.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	description	Parent Taxon. Tribe Polyommatini Swainson, 1827.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	discussion	Comment. The same name was proposed as a nomen nudum (fails ICZN Art. 13.) by Koçak & Seven (1997) and then published in a pioneering study by Stradomsky (2016) without explicitly indicating that the name was intentionally new (fails ICZN Art. 16.1.) and not stating what the type genus of this taxon was (fails ICZN Art. 16.2.). This name for the subtribe already discovered by Koçak & Seven and Stradomsky and confirmed by our genomic analysis is simply formalized here to comply with the ICZN Code (ICZN [International Commission on Zoological Nomenclature] 1999). Oboroniina Grishin, new subtribe http: // zoobank. org / FB 96541 D- 672 A- 41 A 6 - 9 C 47 - 2 EDAADEC 0 D 60	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	type_taxon	Type genus. Oboronia Karsch, 1893. Definition. The clade with Oboronia (type species Oboronia staudingeri Hemming, 1960, which is a junior subjective synonym of Plebeius punctatus Dewitz, 1879) is placed within the “ crown group ” of Polyommatini Swainson, 1827 without strongly supported phylogenetic affinity to any subtribe (Fig. 22) and therefore represents a subtribe of its own. This new subtribe is diagnosed by a combination of the following characters, as given for the Euchrysops section by Eliot (1973): male genitalia with long falces, vinculum broadening in the middle in lateral view, long and narrow valva, massive rod-shaped aedeagus with anterior ductus entrance; veins SC and R 1 not fused. A combination of the following nuclear genomic base pairs is diagnostic: cce 349.2.1: C 166 A, cce 349.2.1: A 167 T, cce 935.8.2: A 66 G, cce 2073.8.1: A 230 G, cce 178.15.6: A 190 G. Genera included. The type genus (i. e., Oboronia Karsch, 1893), Euchrysops Butler, 1900, Lepidochrysops Hedicke, 1923, Orachrysops Vári, 1986, and Thermoniphas Karsch, 1895.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	description	Parent Taxon. Tribe Polyommatini Swainson, 1827. indicating that the name was intentionally new (fails ICZN Art. 16.1.) and not stating what the type genus of this taxon was (fails ICZN Art. 16.2.). This name for the subtribe already discovered by Stradomsky and confirmed by our genomic analysis is simply formalized here to comply with the ICZN Code (ICZN [International Commission on Zoological Nomenclature] 1999). Uranothaumatina Grishin, new subtribe http: // zoobank. org / 57 D 2 B 8 F 3 - 36 FA- 4457 - 88 B 2 - FC 99 DADC 2 EF 8	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	type_taxon	Type genus. Uranothauma Butler, 1895. Definition. The lineage with Uranothauma (type species Uranothauma crawshayi Butler, 1895) is confidently placed as sister to Scolitantidina Tutt, 1907 (Fig. 22), but it was not traditionally included in the latter subtribe. Additionally, because it originates at the tree level corresponding to subtribes, it represents a subtribe. This new subtribe is a union of the Uranothauma and Phlyaria sections of Eliot (1973), who listed characters for them, and is diagnosed as follows (see also Stradomsky (2016) for genitalia illustrations): in male genitalia, saccus absent, falces developed, as long as tegumen with uncus, vinculum expanded in the middle in lateral view, aedeagus shorter than valva, rod-shaped with ductus entrance dorso-cephalad, valva elongated, undivided; veins SC and R 1 touch each other or fuse at least for some distance, eyes hairy, palpi hairy or bristly. A combination of the following nuclear genomic base pairs is diagnostic: cce 993.29.2: A 515 G, cce 103.22.12: A 47 G, cce 462.35.1: G 193 T, cce 912.1.1: C 56 A, cce 1162.12.1: G 739 A. Genera included. The type genus (i. e., Uranothauma Butler, 1895) and Phlyaria Karsch, 1895.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	description	Parent Taxon. Tribe Polyommatini Swainson, 1827.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFADFF88250BF9A8FDACF575.taxon	discussion	Comment. The same name was published in a pioneering study by Stradomsky (2016) without explicitly indicating that the name was intentionally new (fails ICZN Art. 16.1.) and not stating what the type genus of this taxon was (fails ICZN Art. 16.2.). This name for the subtribe already discovered by Stradomsky and confirmed by our genomic analysis is simply formalized here to comply with the ICZN Code (ICZN [International Commission on Zoological Nomenclature] 1999). Higher classification of Lycaenidae to the subtribal level Based on our genome-scale phylogeny (Figs. 20 – 22) complemented with other studies (Talavera et al. 2012; Boyle et al. 2015; Robbins et al. 2022; Boyle et al. 2023; Kawahara et al. 2023), we propose the following provisional classification of Lycaenidae into subfamilies, tribes, and subtribes. We partition the family into eight subfamilies. If no tribes and subtribes are listed for a subfamily, we consider that subfamily to be monotypic. If no subtribes are listed for a tribe, we consider that tribe to be monotypic. The type genus name for each taxon is given in parentheses. New taxa and status changes are shown in red font. Synonymy is not provided.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFA1FF97268CF983FC6EF3C0.taxon	description	Subfamily Liphyrinae Doherty, 1889 (Liphyra Westwood, [1864]), stat. rest. Subfamily Miletinae Reuter, 1896 (Miletus Hübner, [1819]) Tribe Lachnocnemini Clench, 1955 (Lachnocnema Trimen, 1887) Tribe Miletini Reuter, 1896 (Miletus Hübner, [1819]) Subtribe Miletina Reuter, 1896 (Miletus Hübner, [1819]) Subtribe Megalopalpina Grishin, subtrib. n. (Megalopalpus Röber, 1886) Tribe Spalgini Toxopeus, 1929 (Spalgis F. Moore, 1879) Subtribe Spalgina Toxopeus, 1929 (Spalgis F. Moore, 1879)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFA1FF97268CF983FC6EF3C0.taxon	description	Subtribe Durbaniina Clench, 1955 (Durbania Trimen, 1862) Subtribe Pentilina Aurivillius, 1914 (Pentila Westwood, [1851]) Subtribe Liptenina Röber, 1892 (Liptena Westwood, [1851]); includes Mimacraeina Stempffer, 1961 Subtribe Iridanina Clench, 1965 (Iridana Aurivillius, 1920) Subtribe Epitolina Jackson, 1962 (Epitola Westwood, [1851]) Subtribe Cooksoniina Sáfián, Boyle & Pierce, 2023 (Cooksonia H. H. Druce, 1905) Tribe Poritiini Doherty, 1886 (Poritia F. Moore, [1866]) Subfamily Aphnaeinae Distant, 1884 (Aphnaeus Hübner, [1819]); not monophyletic with Theclinae! Tribe Axiocersini Grishin, trib. n. (Axiocerses Hübner, [1819]) Tribe Cigaritini Grishin, trib. n. (Cigaritis Donzel, 1848) Subtribe Pseudaletidina Grishin, subtrib. n. (Pseudaletis H. H. Druce, 1888) Subtribe Cigaritina Grishin (Cigaritis Donzel, 1848) Tribe Aphnaeini Distant, 1884 (Aphnaeus Hübner, [1819]) Subtribe Aloeidina Grishin, subtrib. n. (Aloeides Hübner, [1819]) Subtribe Phasisina Grishin, subtrib. n. (Phasis Hübner, [1819]) Subtribe Aphnaeina Distant, 1884 (Aphnaeus Hübner, [1819]) Subfamily Lycaeninae [Leach], [1815] (Lycaena [Fabricius], 1807) Subfamily Theclinae Swainson, 1830 (Thecla [Fabricius], 1807) Tribe Theclini Swainson, 1830 (Thecla [Fabricius], 1807)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFA1FF97268CF983FC6EF3C0.taxon	description	Tribe Drinini Grishin, trib. n. (Drina Nicéville, 1890)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFA1FF97268CF983FC6EF3C0.taxon	description	Tribe Luciini Waterhouse & Lyell, 1914 (Lucia W. Swainson, 1833) Tribe Ogyrini Waterhouse & Lyell, 1914 (Ogyris Angas, 1847) Tribe Jalmenini Grishin, trib. n. (Jalmenus Hübner, 1818) Tribe Pseudalmenini Grishin, trib. n. (Pseudalmenus H. H. Druce, 1902) Tribe Amblypodiini Doherty, 1886 (Amblypodia Horsfield, 1829) Tribe Myrinini Toxopeus, 1929, stat. nov. (Myrina [Fabricius], 1807) Tribe Cheritrini Swinhoe, 1910 (Cheritra F. Moore, 1881) Subtribe Cheritrina Swinhoe, 1910 (Cheritra F. Moore, 1881) Subtribe Horagina Swinhoe, 1910, stat. nov. (Horaga F. Moore, 1881) Subtribe Loxurina Swinhoe, 1910, stat. nov. (Loxura Horsfield, [1829]) Tribe Iolaini Riley, 1958 (Iolaus Hübner, [1819])	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFA1FF97268CF983FC6EF3C0.taxon	description	Subtribe Rapalina Grishin (Rapala F. Moore, 1881) Subtribe Pilodeudorigina Grishin, subtrib. n. (Pilodeudorix H. H. Druce, 1891) Tribe Deudorigini Doherty, 1886 (Deudorix Hewitson, 1863) Tribe Eumaeini Doubleday, 1847 (Eumaeus Hübner, [1819]) Subtribe Eumaeina Doubleday, 1847 (Eumaeus Hübner, [1819]) Subtribe Rhammina Prieto & Busby, 2022 (Rhamma K. Johnson, 1992) Subtribe Timaetina Busby & Prieto, 2022 (Timaeta K. Johnson, Kruse & Kroenlein, 1997) Subtribe Atlidina Martins & Duarte, 2022 (Atlides Hübner, [1819]) Subtribe Evenina Faynel & Grishin, 2022 (Evenus Hübner, [1819])	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFA1FF97268CF983FC6EF3C0.taxon	description	Subtribe Calycopidina Duarte & Robbins, 2010 (Calycopis Scudder, 1876) Subtribe Strymonina Tutt, 1907 (Strymon Hübner, 1818) Subtribe Strephonotina K. Johnson, Austin, Le Crom & Salazar, 1997 (Strephonota K. Johnson et al., 1997) Subtribe Trichonidina Duarte & Faynel, 2022 (Trichonis Hewitson, 1865)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFA1FF97268CF983FC6EF3C0.taxon	description	In his pioneering work based on limited DNA sequence data and careful genitalic comparison, Stradomsky (2016) proposed to partition the tribe Polyommatini into 22 subtribes. Stradomsky’s classification fares well compared to our genomic results (see above), and his study is impressive in its insight. Out of our 23 subtribes, 20 match Stradomsky’s in names, and one, Celastrinina Tutt, 1907, was referred to by its junior subjective synonym, Lycaenopsina Swinhoe, 1910. The remaining two subtribes, Ionolycina subtrib. n. and Unina subtrib. n., were placed by Stradomsky into his Danina Koçak & Seven, 1997 and “ Azanina, ” respectively. Una Nicéville, 1890 cannot belong to “ Azanina, ” because it is in the clade with Danis [Fabricius], 1807 and not with Azanus F. Moore, 1881 (see Fig. 22 and Kawahara et al. (2023 )). While it is indeed possible to unify these four groups into a single subtribe, Danina, genetic differentiation within this subtribe would be larger than in other subtribes in Polyommatini (Fig. 22). Therefore, dividing the group into four subtribes brings the classification in line with the genetic differentiation within other Polyommatini subtribes. Finally, Stradomsky’s “ Cacyreina ” is merged into our Lampidina Tutt, 1907 due to genetic similarities, and Stradomsky’s phylogeny based on a small number of gene markers is poorly supported around these taxa. We put names of subtribes used by Stradomsky in quotes because they were proposed somewhat informally: authorship of previously published names was not indicated, and for the names we could not find in previous publications, Stradomsky did not explicitly indicate that they were intentionally new (fails ICZN Art. 16.1.) and did not specify what their type genera were (fails ICZN Art. 16.2.). Moreover, it remains unclear from the text of intended to propose new ICZN-compliant names in his work.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFBEFF972631FF63FAF5F00D.taxon	description	1890) and Paralycaeides Nabokov, 1945 (type species Itylos inconspicua Draudt, 1921) and (2) Nabokovia Hemming, 1960 (type species Thecla faga Dognin, 1895 and Eldoradina Balletto, 1993 (type species Nabokovia (Eldoradina) cyanea Balletto, 1993) are closely related to each other in each pair (Fig. 23): COI barcode difference of 5.9 % – 6 % (39 – 40 Fig. 23. Nuclear genome tree (autosomes): genus Itylos bp) in each pair. Furthermore, at least one genus in (red, subgenus Paralycaeides in magenta) and genus Nabokovia (blue, subgenus Eldoradina in violet color). each pair consists of a small number of species. Therefore, we propose to treat the junior name in each pair as a subgenus name: Paralycaeides Nabokov, 1945 of Itylos Draudt, 1921 and Eldoradina Balletto, 1993 of Nabokovia Hemming, 1960.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFBEFF972669FC25FC54F523.taxon	description	24), confirming that it is meaningful to treat Shijimia as a valid genus. We sequenced one of the two syntypes of Everes umbriel Doherty, 1889 (type locality Tenasserim Valley) currently treated as a junior subjective synonym (or subspecies) of Lycaena potanini Alphéraky, 1889 (type locality in China: Gansu Province) in the genus Tongeia Tutt, 1908 (type species Lycaena fischeri Fig. 24. Nuclear genome tree (autosomes) of Everina representatives: genera Cupido (green), Shijimia (red), Eversmann, 1843), and found that it is not monophyletic Bothrinia (violet), and Tongeia (blue). with Tongeia fischeri, but is closely related to Shijimia Matsumura, 1919 (type species Lycaena moorei Leech, 1889) (Fig. 24). Therefore, we propose a new combination: Shijimia potanini (Alphéraky, 1889), comb. nov.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFBEFF942612F971FD24F19F.taxon	description	Moreover, some species of Coeliades are patterned similarly, although without extensive green coloration on ventral hindwing: C. lucagus (Cramer, 1777) and C. aeschylus (Plötz, 1884) (both formerly in Pyrrhiades). Our genomic tree and recently published phylogeny (Toussaint et al. 2021) support this close relationship between Pyrrhochalcia and Coeliades by placing the former as a close sister of the latter without prominent separation between them (Fig. 25). Genetic differentiation within Coeliades even after including Pyrrhochalcia is approximately the same as that within the genus Choaspes F. Moore, 1881 (type species Hesperia (Thymele) benjaminii Guérin- Méneville, 1843) (Fig. 25 blue vs. green). Therefore, we propose that Pyrrhochalcia Mabille, 1904, stat. nov. is a subgenus of Coeliades Hübner, 1818.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFBCFF922783FA4EFC68F1DB.taxon	description	The extent of genetic differentiation suggests that the clades within C. pylades represent distinct species (Cong et al. 2019 a). We find that Cecropterus pylades albosuffusa (H. Freeman, 1943) (type locality USA: Texas, Ft. Davis) forms a clade distant from the nominotypical C. pylades with Fst / Gmin of 0.39 / 0.001 and COI barcode difference of 2.1 % (14 bp). Similarly, the westernmost Cecropterus pylades indistinctus (Austin & J. Emmel, 1998) (type locality in USA: California: San Diego Co.) is separated from the nominotypical C. pylades with Fst / Gmin of 0.41 / 0.002 and COI barcode difference of 1.7 % (11 bp). Therefore, we propose treating Cecropterus (Thorybes) albosuffusa (H. Freeman, 1943), stat. nov. and Cecropterus (Thorybes) indistinctus (Austin & J. Emmel, 1998), stat. nov. as species-level taxa, not subspecies of C. pylades. Hence, no subspecies are recognized in the C. pylades species group. Furthermore, three additional clades with strong genetic differentiation do not have names and represent new species. These three new species are described below. Finally, we note that the speciation scenario in the “ crown ” subgroup of the C. pylades group consisting of four USA species: Floridian, eastern, westcoastal, and central (Fig. 27 red, green, cyan, and purple) parallels that of the Erynnis brizo (Boisduval & Le Conte, [1837]) species group as laid out by Burns (2020).	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFBBFF91269CFD5FFD4EF15C.taxon	diagnosis	Definition and diagnosis. Both the Z chromosome and the mitogenome trees reveal partitioning of western US populations previously assigned to Cecropterus (Thorybes) pylades (Scudder, 1870) (type locality in USA: Massachusetts) into two clades: Cecropterus (Thorybes) indistinctus (Austin & J. Emmel, 1998), stat. nov. (type locality in the USA: California: San Diego Co., holotype sequenced as NVG- 17109 A 08) and a clade consisting of specimens from and around the Rocky Mountains region in the US, not associated with any available names (Fig. 27 cyan and purple). The Fst / Gmin between the two clades are 0.37 / 0.004, and their COI barcodes differ by 1.1 % (7 bp). Therefore, the Rocky Mountains clade represents a species-level taxon. This new species is generally similar in appearance to its closest relative, C. indistinctus, in the following combination of characters: stronger checkered fringes (especially on the forewing), ventral wing surface distally paler gray-brown, but not strongly overscaled with white, on average smaller hyaline spots, and less rounded forewings; and differs from it by more prominently checkered fringes, paler ground color, stronger expressed darker framing around (or in place of) hyaline forewing spots, better defined ventral hindwing bands, typically larger hyaline spots and specimen size. In male genitalia, uncus arms are thicker and not as widely separated as in C. (Thorybes) albosuffusa (H. Freeman, 1943), stat. nov. (type locality USA: Texas, Ft. Davis), more angled than rounded at the base between them; similar to C. pylades and C. indistinctus and differ from them by somewhat wider slightly converging distad and usually longer compared to tegumen than in the other two species, a notch between ampulla and harpe is typically shallower and wider, harpe is longer, more upcurved. Definitive identification is provided by DNA, and a combination of the following characters is diagnostic in nuclear genome: aly 5196.9.2: C 915 T, aly 536.8.1: C 750 T, aly 1259.10.2: A 1122 G, aly 276561.5.1: G 2469 A, aly 5021.6.4: A 1940 G and in the COI barcode: A 217 G, T 460 C, T 596 C, A 637 A. Barcode sequence of the holotype: Sample NVG- 22099 H 03, GenBank OR 578714, 658 base pairs: AACTTTATATTTTATTTTCGGAATTTGAGCAGGATTAATTGGAACTTCTTTAAG TTTACTTATTCGAACTGAATTAGGAACTCCAGGATCTTTAATTGGAGATGATCA AATTTATAATACTATTGTCACAGCTCATGCTTTTATTATAATTTTCTTTATAGT TATACCTATTATAATTGGAGGATTTGGAAATTGATTAATTCCCCTTATACTAGG GGCTCCTGACATAGCTTTTCCTCGTATAAATAATATAAGATTTTGATTATTACC TCCATCTTTAACTCTTTTAATTTCAAGAAGTATTGTTGAAAATGGAGCAGGTAC TGGATGAACTATTTACCCCCCTTTATCTTCTAATATTGCTCATCAAGGAGCTTC AGTAGATTTAGCAATTTTTTCTTTACATCTTGCTGGAATTTCTTCAATTTTAGG AGCTATTAATTTTATTACAACTATTATCAATATACGAATTAATAATTTATCATT TGATCAAATACCATTATTTATTTGAGCTGTTGGAATTACAGCTTTATTACTTTT ACTTTCATTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACTGATCGAAA CCTAAATACTTCATTTTTTGATCCAGCAGGTGGAGGAGATCCAATTTTATATCA Fig. 29. A map of sequenced specimens from the Cecropterus ACATTTATTT (Thorybes) pylades group. Different species are shown in different Type material. Holotype: ♂ deposited in the symbols of different colors: C. floridianus sp. n. (larger red California Academy of Sciences, San circles), C. pylades (smaller green circles), C. indistinctus stat.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFBBFF91269CFD5FFD4EF15C.taxon	description	nov. (cyan diamonds), C. rockiensis sp. n. (purple squares), C. Francisco, CA, USA [CAS], illustrated in Fig. albosuffusa stat. nov. (smaller dark blue downturned triangles), 28, bears six printed (other text but “ COLO ” and C. oaxacensis sp. n. (larger orange upturned triangle) and on the first label is handwritten) labels: five labeled on the map near their type localities. Type localities for valid names are indicated by tiny circles placed inside symbols, or white [COLO. V- 24 - 79 | Jefferson Co. | Clear (if no specimens from these localities were sequenced) by a small Cr. Cyn.], [Ray E. Stanford | collector], circle framed with the color of the taxon (for C. pylades only). [Collection of | C. D. MacNeill], [DNA sample ID: | NVG- 22099 H 03 | c / o Nick V. Grishin], [{QR Code} CASENT | 8566837], and one red [HOLOTYPE ♂ | Cecropterus (Thorybes) | rockiensis Grishin]. Paratypes: 20 ♂♂ 7 ♀♀: 1 ♀ Montana, Yellowstone Co., Billings, 5 - Jun- 1948, Neil Euting leg. (NVG- 22099 H 04, CASENT 8566838) [CAS]; 2 ♂♂ Nebraska, Sioux Co., Monroe Cyn., 6 mi. N of Harrison, 25 - Jun- 1983, S. M. Spomer leg. (NVG- 22064 H 01 & H 02); Utah: Salt Lake Co.: 1 ♂ Mill Creek Canyon, 28 - Jun- 1967, C. J. Callaghan leg. (NVG- 22099 H 07, CASENT 8566841) [CAS]; Salt Lake, City Creek Canyon: 1 ♂ 15 - Jun- 1930, Lloyd M. Martin leg. (NVG- 22094 A 09) [LACM]; 1 ♂ 9 - Jun- 1946, L. I. Hewes leg. (NVG- 22099 H 08, CASENT 8566842) [CAS]; Utah Co.: 1 ♂ Provo Canyon, 14 - Jun- 1947, William A. Hammer leg. (NVG- 22099 G 12, CASENT 8566834) [CAS]; 1 ♂ Mt. Timpanogos, 5.6 mi W of Jct. Hwy 189 & 92 on 92, 22 - Jul- 1946, C. D. MacNeill leg. (NVG- 22099 H 09, CASENT 8566843) [CAS]; 1 ♂ Beaver Co., East Fork Baker Canyon, SH 153, Tushar Mts, N side of Beaver Canyon, larva collected on 1 - Jul- 2022, eclosed 7 - Dec- 2022, Todd Stout leg. (NVG- 22068 D 07); 1 ♀ Washington Co., 11 - May- 1977, D. F. Shillingburg leg. (NVG- 22099 H 06, CASENT 8566840) [CAS]; 1 ♀ Zion National Park, 15 - Jun- 1928, T. Craig leg. (NVG- 22099 H 10, CASENT 8566844) [CAS]; San Juan Co.: 1 ♀ La Sal Mts., Pack Creek day use area, 31 - May- 2016, Robb Hannawacker leg. (NVG- 20045 E 07); 1 ♂ Abajo Mts., Indian Creek trail, el. 6400 ' - 7400 ', 8 - May- 2020, Robb Hannawacker leg. (NVG- 20045 E 08); Colorado: 1 ♂ Garfield Co., Glenwood Cyn, el. 6200 ', 8 - Jun- 1977, Ray E. Stanford leg. (NVG- 22099 H 02, CASENT 8566836) [CAS]; 1 ♂ Eagle Co., Fryingpan River, 10 - Jun- 1976, Ray E. Stanford leg. (NVG- 22099 H 05, CASENT 8566839) [CAS]; Boulder Co.: 1 ♀ Lefthand Canyon, 16 - May- 1954, Donald Eff leg. (NVG- 22099 H 01, CASENT 8566835) [CAS]; 1 ♂ Flagstaff Mtn., 15 - Jun- 1953, Donald Eff leg. (NVG- 22094 A 08) [LACM]; New Mexico: 1 ♂ Sandoval Co., Cibola National Forest, SH 165 4.2 mi S of Placitas, GPS 35.2502, − 106.4104, 14 - May- 2017, Qian Cong, Jing Zhang & Nick V. Grishin leg. (NVG- 8800); 1 ♂ 1 ♀ Lincoln Co., 1.5 mi E of Capitan Gap Rd N water course, el. 7000 ', 10 - May- 1981, J. McCaffrey leg. (NVG- 15099 H 08 & H 09) [FMNH]; 2 ♂♂ Otero Co., Lincoln National Forest, La Luz Canyon Rd., 4.8 air mi NE of High Rolls, GPS 32.9992, − 105.7759, 21 - May- 2017, Qian Cong, Jing Zhang & Nick V. Grishin leg. (NVG- 8970, Fig. 30 l 22094 A 02 & A 03) [LACM]; 1 ♂ Lockett Meadow, GPS 35.3605, − 111.6208, 24 - May- 2021, Brian Banker leg. (NVG- 21089 E 12); 1 ♂ Apache Co., Greens Peak area, Pipeline Spring at Fs 117, GPS 34.1413, − 109.5809, 25 - May- 2018, Jing Zhang & Nick V. Grishin leg. (NVG- 11465, Fig. 30 k); 1 ♂ Graham Co., Adam's Flat, GPS 32.6508, − 109.8125, 23 - Apr- 2009, Mark Walker leg. (NVG- 18037 D 10).	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFBBFF91269CFD5FFD4EF15C.taxon	materials_examined	Type locality. USA: Colorado, Jefferson Co., Clear Creek Canyon.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFBBFF91269CFD5FFD4EF15C.taxon	etymology	Etymology. The name is given for the general area of the distribution of this species, which is in and around the Rocky Mountains (the Rockies), by fusing the Latin suffix - ensis (meaning “ from place ” or “ of place ”) with the word “ Rockies ”. The name is a masculine adjective in the nominative case. English name. Rocky Mountains Cloudywing.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFBBFF91269CFD5FFD4EF15C.taxon	distribution	Distribution. Across the Rocky Mountains and neighboring states: confirmed from Montana, Nebraska, Utah, Colorado, New Mexico, and Arizona.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFB8FF9E2664FDD3FA97F03F.taxon	description	(Figs. 27 & 29 parts, 30 a – d, 31)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFB8FF9E2664FDD3FA97F03F.taxon	diagnosis	Definition and diagnosis. Both the Z chromosome and the mitogenome trees reveal that eastern US populations previously assigned to Cecropterus (Thorybes) pylades (Scudder, 1870) (type locality in USA: Massachusetts) are not monophyletic, and populations from Florida form a clade sister to three species combined (C. pylades, C. indistinctus, and C. rockiensis sp. n.) (Fig. 27). Genetic differentiation between C. pylades and the Floridian populations is notable: Fst / Gmin between the two clades are 0.24 / 0.003 and the COI barcode difference is 2.3 % – 2.4 % (15 – 16 bp). Therefore, the Floridian clade represents a distinct species. This new species is similar in appearance to C. pylades in darker ground color, weaker checkered fringes (especially on forewing), weaker developed marginal pale overscaling on wings beneath, larger size, and rounder wings; and differs from it by darker appearance and generally smaller hyaline spots. In the male genitalia, most similar to C. pylades, e. g., uncus arms slightly converge distad, but valva is usually broader, the central bump on its costa is typically less pronounced (in lateral view), harpe is relatively shorter, broader, and straighter, less angled along the ventral margin, and uncus arms are usually shorter compared to tegumen (Fig. 30 a – d). Definitive identification is provided by DNA and a combination of the following characters is diagnostic in nuclear genome: aly 1409.4.2: G 1779 A, aly 383.20.2: T 1131 A, aly 3507.12.1: G 3947 C, aly 383.21.1: A 1654 G, aly 1409.4.2: A 1477 C and in COI barcode: T 91 A, T 232 C, T 355 C, T 478 C, T 514 A. Barcode sequence of the holotype: Sample NVG- 22032 A 09, GenBank OR 578715, 658 base pairs: AACTTTATATTTTATTTTCGGAATTTGAGCAGGATTAATTGGAACTTCTTTAAGTTTACTTATTCGAACTGAATTAGGAACTCCAGGATCATTAATTGGAGATGACCAAATTTATAATACT ATTGTCACAGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAATTCCTCTTATACTAGGAGCTCCTGATATAGCCTTTCCTCGTA TAAATAATATAAGATTTTGATTATTACCCCCATCTTTAACTCTTTTAATTTCAAGAAGTATTGTTGAAAATGGAGCAGGTACTGGATGAACTGTTTATCCCCCATTATCTTCCAATATTGC TCACCAAGGAGCTTCAGTAGATTTAGCAATTTTTTCTTTACATCTTGCAGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGAATTAATAACTTATCA TTTGATCAAATACCATTATTTATTTGAGCAGTTGGAATTACAGCTTTATTACTTTTACTTTCACTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTT CATTTTTTGATCCAGCAGGTGGAGGAGATCCTATTTTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFB8FF9E2664FDD3FA97F03F.taxon	materials_examined	Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA [USNM], illustrated in Fig. 31, bears four printed labels: three white [USA: FLA: Volusia Co. | New Smyrna Beach | 3 April 1969 | Leg. G. Rawson], [DNA sample ID: | NVG- 22032 A 09 | c / o Nick V. Grishin], [genitalia vial | NVG 230917 - 01 | Nick V. Grishin], and one red [HOLOTYPE ♂ | Cecropterus (Thorybes) | floridianus Grishin]. Paratypes: 4 ♂♂ 3 ♀♀ from USA, Florida: 1 ♂ Franklin Co., USH 98 0.4 mi. S of junction with Co. Rd. 370, 3 air mi N of Alligator Point, GPS 29.9378, − 84.3907, 29 - Mar- 1988, J. M. Burns leg., (NVG- 22032 A 08) [USNM]; 1 ♀ Dixie Co., 16 km S Steinhatchee, end of Rt. 361, 4 - Apr- 1988, Scott W. Gross leg. (NVG- 22032 A 07) [USNM]; 1 ♂ Levy Co., Cedar Key, 25 - Jul- 1963, C. J. Durden leg. (NVG- 20062 C 06) [TMMC]; 1 ♀ Alachua Co., Gainesville, 20 - Apr- 1973, E. C. Knudson leg. (NVG- 22032 A 10) [USNM]; 1 ♂ Marion Co., Ocala National Forest nr. Juniper Springs, 15 - May- 1988, Scott W. Gross leg. (NVG- 22032 A 12) [USNM]; 1 ♀ Volusia Co., New Smyrna Beach, G. W. Rawson leg. 10 - Mar- 1969 (NVG- 22032 A 11) [USNM]; 1 ♂ Martin Co., Port Sewall, 16 - Mar- 1939, genitalia 25 - 34 J. W. Tilden (NVG- 22101 A 01, Fig. 30 a) [CAS]. Type locality. USA: Florida, Volusia Co., New Smyrna Beach.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFB8FF9E2664FDD3FA97F03F.taxon	etymology	Etymology. The name for this Floridian species is formed by adding “ - us ” and is a masculine adjective. English name. Florida Cloudywing.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFB8FF9E2664FDD3FA97F03F.taxon	distribution	Distribution. Confirmed only from the USA: Florida, but is likely to be found at least in Georgia.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFB7FF9F2667FC30FB83F5C4.taxon	description	(Figs. 27 & 29 parts, 30 p, 32, 33)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFB7FF9F2667FC30FB83F5C4.taxon	diagnosis	Definition and diagnosis. Inspection of genomic trees reveals that a single specimen from Mexico, Oaxaca, initially identified by us as “ Cecropterus albosuffusa ” (curated with “ Cecropterus drusius ” in the collection), is not placed among Cecropterus (Thorybes) albosuffusa (H. Freeman, 1943) (type locality USA: Texas, Ft. Davis) specimens we sequenced from across the range (Fig. 27). This specimen is sister to all analyzed C. albosuffusa, some from Puebla and DF in Mexico. This consistent placement of the specimen in the trees constructed from protein-coding regions in autosomes, Z chromosome, and mitochondrial genome, where all sequenced C. albosuffusa specimens across the range from Arizona and Texas to Pueblo cluster closely together, and its distinction in the COI barcode of 1.2 % (8 bp, while C. albosuffusa did not show variation in the barcode) suggest that it represents a distinct species. This new species is diagnosed by white hindwing fringe from vein M 2 to tornus, similar to Cecropterus (Thorybes) drusius (W. H. Edwards, [1884]) (type locality in southern Arizona) but has C. albosuffusa - like genitalia with rounded (Fig. 30 p), not claw-shaped (Fig. 30 q) harpe, rounder hindwings in males (in C. drusius males, hindwings are slightly extended at tornus, almost lobed), broad paler “ frosty ” submarginal area on ventral hindwing, which C. drusius typically lacks (some specimens with narrower pale overscaling), and broader forewing subapical spots in a straight line, each spot is nearly square. In male genitalia (Fig. 30 p), it is most similar to C. albosuffusa (Fig. 30 m – o) but differs in thicker and shorter relative to tegumen uncus arms, broader and more rounded in lateral view tegumen, and broader, rounder and more upturned harpe. In DNA, a combination of the following characters is diagnostic in nuclear genome: aly 638.13.2: A 120 C, aly 638.13.2: C 165 T, aly 4592.3.6: T 120 C, aly 4592.3.6: A 159 T, aly 727.34.3: C 417 T, aly 596.8.8: G 120 G (not A), aly 596.8.8: G 618 G (not A), aly 767.17.3: A 273 A (not G), aly 767.17.3: T 941 T (not G), aly 1432.13.4: C 50 C (not T) and COI barcode: A 181 G, A 421 A, T 574 C, C 595 C, T 604 C. Barcode sequence of the holotype: Sample NVG- 19125 B 09, GenBank OR 578716, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACTTCTTTAAGTTTACTTATTCGAACTGAATTAGGAACTCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTCACAGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCTATTATAATTGGGGGATTTGGAAATTGATTAATTCCTCTTATATTAGGAGCTCCTGATATAGCTTTTCCTCGTA TAAATAATATAAGATTTTGATTATTACCCCCATCTTTAACTCTTTTAATTTCAAGAAGTATTGTTGAAAACGGAGCAGGTACTGGATGAACTGTTTATCCCCCTTTATCTTCTAATATTGC TCATCAAGGAGCTTCAGTAGATTTAGCAATTTTTTCTTTACATCTTGCAGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGAATTAATAATTTATCA TTTGATCAAATACCATTATTTATTTGAGCTGTTGGAATTACAGCCTTATTACTTTTACTTTCATTACCTGTTTTAGCTGGAGCTATTACCATATTATTAACTGATCGAAACTTAAATACCT CATTTTTTGATCCTGCAGGTGGAGGAGATCCTATTTTATATCAACATTTATTT Fig. 33. Cecropterus (Thorybes) oaxacensis sp. n. female, iNaturalist observation 110602850 from Mexico: Oaxaca, San Miguel Tequixtepec, 17 - Jun- 2014, © John Kemner; photographs show the same individual. Images are color-corrected, and the rightmost is rotated approximately 90 ° clockwise. CC BY-NC 4.0 https: // creativecommons. org / licenses / by-nc / 4.0 /	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFB7FF9F2667FC30FB83F5C4.taxon	materials_examined	Type material. Holotype: ♂ deposited in the University of Texas Biodiversity Center collection, Austin, TX, USA [TMMC], illustrated in Fig. 32, bears four printed labels: three white [OA. Tlalixtac. 002 | 5 mi N Oaxaca | KemnerJ 88138 A 02], [DNA sample ID: | NVG- 19125 B 09 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 22056 A 03 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Cecropterus (Thorybes) | oaxacensis Grishin], collected by John Kemner on 17 - May- 1988 (i. e., “ 88138 ”: day 138 of 1988). Type locality. Mexico: Oaxaca, Tlalixtac de Cabrera, Hwy 175, ca. 5 mi north of Oaxaca City.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFB7FF9F2667FC30FB83F5C4.taxon	etymology	Etymology. The name is given for the type locality and is a masculine adjective in the nominative case. English name. Oaxaca Cloudywing.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFB7FF9F2667FC30FB83F5C4.taxon	distribution	Distribution. Known only from Mexico: Oaxaca. Specimens from phenotypically similar (but mostly darker-fringed) populations to the north (e. g., Puebla and Ciudad de México) are Cecropterus (Thorybes) albosuffusa (H. Freeman, 1943) as identified by genomic sequencing (Fig. 27).	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFB6FF9D2644F950FD21F6FF.taxon	description	Evans (1952) applied the name “ Nascus solon ” to an Amazonian species not known from Southeast Brazil. This discrepancy found after an inspection of the Berlin collection catalog prompted us to study the original description of T. solon more closely. We concluded that Evans misidentified T. solon because the species Evans identified as “ N. solon ” does not agree with the original description of T. solon. Most significantly, Plötz mentions a brown “ hair pencil ” (a tuft of long hair-like scales) at the base of cell 1 b [i. e., 1 A + 2 A- 3 A] on ventral hindwing in T. solon, but this tuft is pale, mostly yellow, in Evans’ “ N. solon. ” Then, in T. solon, pale spots in the middle of the forewing are close together and “ only separated by veins ” (Plötz 1882); but in “ N. solon ”, the spot in cell M 3 - CuA 1 does not reach the cell origin, which is filled with the ground color (yellow-brown) for at least half of the width of the pale spot in cell CuA 1 - CuA 2 along vein CuA 1. Furthermore, in T. solon, the hyaline spot in forewing cell M 1 - M 2 is small, a pale spot by the costa in the middle of the forewing is mentioned only as “ beneath, costal margin is also spotted with pale ”, and the ventral hindwing is with brown “ crossbar in cell 7 [Sc + R 1 - RS] and in the discal cell ”. In contrast, in “ N. solon ”, the spot in the forewing cell M 1 - M 2 is nearly the same size as the spot in the cell R 5 - M 1, forewing is with a well-developed hyaline spot by mid-costa, which is seen from the dorsal side as well (hyaline!), hindwing is with weakly developed or missing cental brown spot in the discal cell, and the spot in the cell Sc + R 1 - RS is small, not a “ crossbar ”. Therefore, Evans’ “ N. solon ” is not conspecific with the true T. solon. Next, we searched for specimens that agree with the original description of T. solon. The specimen we found to match the description closely was No. 4865 in MFNB. This specimen was previously curated as a type of Netrocoryne seneca Plötz, 1882 (type locality Brazil) because No. 4865 was mentioned by Plötz (1882) in the original description of N. seneca. However, this specimen is a pseudotype because it agrees neither with the original description nor with a copy of Plötz’s unpublished illustration of N. seneca (Zhang et al. 2023 d). It is possible that due to some mistakes in referencing the MFNB specimen numbers, this specimen No. 4865 was instead (or in addition) a syntype of T. solon. However, we do not have defendable evidence to support this hypothesis. Therefore, we proceeded with the neotype designation because there is an exceptional need to clarify both the taxonomic identity and the type locality of T. solon. This taxon has been misidentified by Evans (1952), who applied this name to a species that does not agree with the original description of T. solon. This mistake creates inconsistencies in the literature and the potential for further destabilization of nomenclature due to the existence of additional species in this group unless the name T. solon is objectively defined by the neotype. Therefore, N. V. G. designates the specimen No. 4865 in MFNB illustrated in Fig. 1 a – c in Zhang et al. (2023 d) (DNA sample NVG- 15031 F 11) as the neotype of Telemiades solon Plötz, 1882. Our neotype of T. solon satisfies all requirements set forth by the ICZN Article 75.3, namely: 75.3.1. It is designated to clarify the taxonomic identity of Telemiades solon Plötz, 1882, which has been misinterpreted and attributed to a different species that does not agree with the original description of T. solon, and to detail its type locality that was given only generally (as “ South America ”) in the original and we regard them as follows: forewing with a hyaline spot in cell CuA 2 - 1 A + 2 A, hyaline spots in the middle of the forewing are crowded together and separated only by veins, hyaline spots in cells M 1 - M 2 and M 2 - M 3 are small, and the former is merged with the apical spots that together form an oval-shaped hyaline patch separated by veins, a hyaline spot in cell R 2 - R 3 is merged with this patch and not offset basad, the hyaline spot is absent by the costal margin near its middle, but the costal margin with a pale spot in the middle beneath; ground color of wings olive-brown, the base of ventral hindwing and most of ventral hindwing are clay-yellow, ventral hindwing with brown crossbars in cell Sc + R 1 - RS and the discal cell, and, in addition to the broadly brown outer margin area, with a postdiscal brown band and a brown tuft of hair-like scales at the base of cell 1 A + 2 A- 3 A; 75.3.3. The neotype specimen is a male bearing eight labels (1 st red, 3 rd bluish-greenish, the last orange, and others white): [typus], [4865], [Bahia Sello], [GEN. PREP., | MIELKE | 1996], [seneca | Pl. | type], [DNA sample ID: | NVG- 15031 F 11 | c / o Nick V. Grishin], [{QR Code} http: // coll. mfn-berlin. de / u / | 940 b 3 c], [not a type specimen of | Netrocoryne seneca | Plötz, 1882 | determined by Zhang, | Cong et al. 2023] and illustrated in Fig. 1 a – c (without the last label, which was added later) in Zhang et al. (2023 d); the neotype has a chipped off tornus on both hindwings; 75.3.4. We searched for syntypes of T. solon in the MFNB collection because the original description specified specimen (s) with the number 4874 in Berlin. While there was an entry in the old collection catalog with No. 4874 listing two specimens, we could not find them among Hesperiidae holdings, and therefore, we believe that syntypes were lost; 75.3.5. The neotype closely agrees with the original description of T. solon in all (but one) characters, as evidenced by comparing the neotype illustrated in Fig. 1 a – c in Zhang et al. (2023 d) with the characters for this taxon given in the original description (Plötz 1882) and listed above (75.3.2.); the only discrepancy is that palpi are nearly white beneath, not clay-yellow (could have been discolored) as stated by Plötz (1882); 75.3.6. The neotype is from Brazil: Bahia, which is within the original type locality given as “ South America ”; 75.3.7. The neotype is in the collection of the Museum für Naturkunde, Berlin, Germany (MFNB). Genomic sequencing confirms the phenotypic assessment of the T. solon neotype as a specimen of Nascus (Bron) broteas (Cramer, 1780) (type locality in Suriname) (Zhang et al. 2023 d) because it groups with specimens of the latter species in the tree (Fig. 34). Notably, Draudt (1922) has already placed T. solon within his Nascus cous (Möschler, 1879) (listing Nascus eugamon Godman & Salvin, 1893 as a synonym of the latter), and expressed an opinion that these may be males of N. broteas, which was then known only by females. Therefore, as a result of the neotype designation, Telemiades solon Plötz, 1882, syn. nov. becomes a junior subjective synonym of Nascus (Bron) broteas (Cramer, 1780). The COI barcode sequence of T. solon neotype, sample NVG- 15031 F 11, GenBank OR 578717, 658 base pairs, is: AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAATTGGAACTTCTCTTAGATTACTAATTCGAACTGAATTAGGAACCCCCGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATCGTAACAGCTCATGCTTTCATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTCTTATACTAGGAGCTCCTGATATAGCATTTCCACGAA TAAATAACATAAGATTTTGATTATTACCTCCATCATTAACATTATTAATTTCAAGAAGAATTGTCGAAAATGGTGCTGGTACTGGATGAACAGTTTACCCCCCTTTATCAGCAAATATTGC TCACCAAGGTTCTTCCGTAGATTTAGCAATCTTTTCTTTACATTTAGCTGGAATTTCTTCTATTTTAGGAGCTATTAACTTTATTACAACAATTATTAATATACGAATTAGAAATTTATCT TTTGATCAAATACCATTATTTATTTGAGCTGTAGGAATTACAGCATTATTATTACTACTTTCTTTACCTGTTTTAGCAGGAGCTATTACTATATTACTTACTGATCGAAATTTAAATACAT CTTTCTTTGACCCAGCTGGAGGAGGAGATCCTATTCTTTATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFB3FF9B26E6FEE8FDECF039.taxon	description	(Figs. 34 part, 35)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFB3FF9B26E6FEE8FDECF039.taxon	diagnosis	Definition and diagnosis. Inspection of genomic trees reveals that Amazonian populations, which Evans (1952) considered to be conspecific with Nascus corilla Evans, 1952, stat. nov. (type locality in Venezuela) and misidentified as Telemiades solon Plötz, 1882 (type locality in Brazil: Bahia) as determined above, are genetically differentiated from N. corilla with Fst / Gmin of 0.48 / 0.003 (although their COI barcodes do not reveal differences but in 1 or 2 base pairs) and therefore represent a distinct species (Fig. 34). This species does not have a name. This new species keys to “ Nascus solon solon ” D. 5.3 (b) in Evans (1952) and is distinguished from its closest relative, N. corilla, stat. nov. (see above), by pale-yellow to orange-yellow patches of scales, variable in their expression, dividing the brown outer marginal area on the ventral hindwing (that is solid dark brown in N. corilla) into narrow postdiscal and broad submarginal bands in males, and usually having five (not four) subapical hyaline spots in females; and from other species of Nascus by the following combination of characters: forewing apical spot in cell R 2 - R 3 is in line with others, not offset basad; yellow or pale brown tuft of long scales at the base of cell 1 A + 2 A- 3 A on ventral hindwing; palpi beneath and cheeks are white; prominent hyaline spot in the middle of forewing by costal margin in males; forewing typically larger than 28 mm in males and 30 mm in females. A combination of the following nuclear genomic characters is diagnostic: aly 525.35.1: C 54 T, aly 214.21.1: C 303 T, aly 214.21.1: G 312 A, aly 26.5.3: C 294 T, aly 50.27.2: A 51 G. Barcode sequence of the holotype: Sample NVG- 21012 D 07, GenBank OR 578718, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCTGGAATAATTGGAACTTCTCTTAGATTATTAATTCGAACTGAATTAGGCACCCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACA ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTCGGAAATTGACTAGTACCTCTTATATTAGGAGCTCCTGATATAGCATTTCCACGAA TAAATAATATAAGATTTTGATTATTACCTCCATCATTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCTGGTACTGGTTGAACAGTTTACCCCCCTTTATCAGCAAATATTGC TCACCAAGGATCTTCTGTAGATTTAGCAATTTTTTCATTACATTTAGCAGGAATTTCCTCAATTTTAGGAGCTATTAACTTTATTACAACAATTATTAATATACGAATTAGAAATTTATCT TTTGATCAAATACCATTATTTATTTGAGCTGTAGGTATTACAGCTTTATTATTATTACTTTCTTTACCTGTTTTAGCAGGAGCTATTACTATATTACTTACTGATCGAAATTTAAATACAT CTTTTTTTGATCCTGCAGGAGGAGGTGATCCAATTCTTTATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFB3FF9B26E6FEE8FDECF039.taxon	materials_examined	Type material. Holotype: ♂ deposited in the Carnegie Museum of Natural History, Pittsburgh, PA, USA [CMNH], illustrated in Fig. 35, bears four printed (last two digits of the year handwritten) labels: three ID: | NVG- 21012 D 07 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Nascus (Bron) | lux Grishin]. Paratypes: 4 ♂♂, one from each locality Peru: Huanuco, Tingo Maria, 800 m, May-Jun- 1994, genitalia X- 5174 J. M. Burns 2002 (NVG- 17103 E 04, USNMENT 00913776); Brazil: Rondônia, 62 km S Ariquemes, Fazenda Rancho Grande, elevation 165 m, GPS − 10.53, − 63.80, 27 - Aug- 8 - Sep- 1994, Ron Leuschner leg. (NVG- 17103 G 06, USNMENT 00913805); Amazonas, Maues, Rio Preto, 15 - 25 - Nov- 2007 (NVG- 18088 H 10); and French Guiana: Roura, Coralie, GPS 4.5083, − 52.3750, L. Sénécaux & A. Docquin leg. 24 - Jul- 1992 (NVG- 18098 E 10, H 3956). Type locality. Brazil: Amapá, Rio Uaçá region (“ Uassa Swamp ”), which is by the border between Brazil and French Guyana.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFB3FF9B26E6FEE8FDECF039.taxon	etymology	Etymology. In Latin, lux means “ light ” and refers to the lighter (i. e., paler) overall appearance of this sunny species, light — instead of brown — tuft of scales on the hindwing (a beam of light), and a sprinkle of light scales between the postdiscal and submarginal brown bands on the ventral hindwing (a phenotypic character that typically separates this species from its closest relative). The name is a noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFB3FF9B26E6FEE8FDECF039.taxon	distribution	Distribution. Generally, in and around the Amazonian region in South America. This species has been recorded from French Guiana, Peru, Ecuador, and Brazil (Amapá, Amazonas, Rondônia).	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFB3FF9B26E6FEE8FDECF039.taxon	discussion	Comment. This name is proposed for Evans’ concept of “ Nascus solon solon ” (Evans misidentified Telemiades solon Plötz, 1882), and due to genetic differentiation, the two taxa Evans considered to be subspecies: “ Nascus solon corilla ” and “ Nascus solon solon ” are distinct species: Nascus corilla and Nascus lux sp. n., respectively.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFB1FFE62678F9C1FBAFF26B.taxon	description	http: // zoobank. org / 00 E 80 EF 8 - 25 B 0 - 4 A 36 - 97 FC-E 6157 CD 96 DE 5 (Figs. 37 part, 38, 39 a)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFB1FFE62678F9C1FBAFF26B.taxon	diagnosis	Definition and diagnosis. In addition to Cogia moschus (W. H. Edwards, 1882) (type locality in USA: AZ, Graham Co.) and Cogia caicus (Herrich-Schäffer, 1869) (type locality likely in Mexico: Oaxaca), genomic trees reveal a third lineage of similar genetic differentiation (Fig. 37 red) with Fst / Gmin / COI differences from the former and the latter, respectively: 0.49 / 0.009 / 0.9 % (6 bp) and 0.4 / 0.006 / 0.5 % (3 bp) that represents a species. This new species differs from its two close relatives by being darker overall, smaller (or lacking) hyaline spots, and darker palpi beneath. Male genitalia are variable, but the harpe typically is broader, rounder, and dorsally with more robust teeth on a shorter ridge near the ampulla; aedeagus with a smaller number of cornuti (Fig. 39). A combination of the following characters in the COI barcode is diagnostic: A 40 A, C 343 C, T 349 T, T 386 T, A 481 G, T 556 A. Barcode sequence of the holotype: Sample NVG- 22079 A 01, GenBank OR 578719, 658 base pairs: AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACTTCTTTAAGTTTATTAATTCGTACTGAATTAG GAACTCCAGGATCATTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTT TTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCCTTAATATTAGGAGCTCCTGATATAGC TTTTCCTCGTATAAATAATATAAGATTTTGATTACTTCCCCCATCATTAACATTATTAATTTCTAGAAGTATTGTAG AAAATGGTGCTGGTACTGGATGAACAGTATATCCCCCCCTTTCATCAAATATTGCACATCAAGGTTCATCAGTAGAT TTAGCTATTTTTTCTTTACATTTAGCTGGTATTTCATCTATTTTAGGTGCTATTAATTTTATTACTACAATTATTAA TATACGAATTAGAAATTTGTCATTTGATCAAATACCTTTATTTGTATGAGCAGTAGGAATTACAGCTTTATTACTTT TACTTTCTTTACCTGTATTAGCTGGTGCTATTACTATACTTTTAACAGATCGAAATCTTAATACATCATTTTTTGAT CCTGCTGGAGGAGGAGACCCTATTTTATATCAACATTTATTT Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity, Gainesville, FL, USA [MGCL], illustrated in Fig. 38, bears five printed labels: four white Fig. 39. Male genitalia of Cogia in lateral view (left valva separated and rotated [Antigua, Sacatepequez | Guatemala | September 16, 1993 | 180 °). a) C. chiagua sp. n. paratype, D. L. Lindsley], [Cogia Butler | caicus (Herrich-Schäffer) | caicus mini-slide 153, data in text. b) C. moschus (Herrich-Schäffer)], [D. L. Lindsley colln. | MGCL Accession | # stat. rest., Mexico: N Sonora, Morrison 2008 - 20], [DNA sample ID: | NVG- 22079 A 01 | c / o Nick V. leg., BMNH (E) 1236437, mini-slide 151. Photographs by N. V. G. © The Trustees of the Grishin], and one red [HOLOTYPE ♂ | Cogia chiagua | Grishin]. Natural History Museum London and are made Paratypes: 3 ♂♂, 1 ♀: 1 ♂ Mexico, Chiapas, Comitán, Laguna available under Creative Commons License 4.0 Chamula, 7100 ’, 13 - May- 1987, C. J. Durden leg. (NVG- 19124 H 05) (https: // creativecommons. org / licenses / by / 4.0 /). [TMMC] and Guatemala: 1 ♂ Panajachel, 2 - Jun- 1968, Beals leg. (NVG- 17109 F 09) [LACM] and Duenas, G. C. Champion leg. [BMNH]: 1 ♂ (BMNH (E) 1236437, genitalia mini-slide 153, Fig. 39 a) and 1 ♀.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFB1FFE62678F9C1FBAFF26B.taxon	etymology	Etymology. The name is a fusion of Chia [pas] + Gua [temala] for the known distribution of this species and is a feminine noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFB1FFE62678F9C1FBAFF26B.taxon	distribution	Distribution. Currently known from Mexico: Chiapas and from Guatemala.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFCFFFE4250CF9AFFBBDF4CB.taxon	diagnosis	Definition and diagnosis. Inspection of genomic trees reveals that Celotes nessus (W. H. Edwards, 1877) (type locality USA: Texas, Bexar Co., San Antonio; lectotype sequenced as NVG- 15097 F 12) as currently circumscribed (Fig. 41 blue and red) is not monophyletic, and populations from the eastern part of the range (Fig. 41 blue) are sister to Celotes spurcus A. Warren, Steinhauser, Hernandez-Mejía & Grishin, 2008 (type locality in Mexico: Querétaro) (Fig. 41 green). While species, in general, do not have to be monophyletic, populations currently identified as C. nessus from the western part of the range (Fig. 41 red) are genetically differentiated from the eastern populations (which include nominotypical) at the level characteristic of distinct species, with Z chromosome Fst / Gmin of 0.32 / 0.008 and COI barcode difference a species distinct from C. nessus. This western species does not have a name because the only two junior synonyms of C. nessus: Spilothyrus notabilis Strecker, [1878] (type locality in the USA: Texas, vicinity of New Braunfels and San Antonio; two syntypes sequenced as NVG- 15039 C 06 and NVG- 15039 C 07) and Carcharodus radiatus Plötz, 1884 (type locality in USA: Texas, syntypes not located, attributed to a species by locality), are conspecific with the eastern species. This new species is distinguished from C. spurcus by approximately two times shorter process of valva (from the base of ampulla), which is similar in length to C. nessus, and from C. nessus by terminally broader harpe, wider separation between harpe and ampulla (broader gap between them), wider process of valva, broader valva narrowing less towards vinculum, and two small teeth on aedeagus shaft: by its bend and halfway between the bend and distal end (Fig. 43). A combination of the following nuclear genomic characters is diagnostic: aly 2284.30.1: G 1323 A, aly 40182.1.2: C 154 A, aly 40182.1.2: C 171 T, aly 1445.3.1: G 246 A, aly 1445.3.1: A 195 G. Barcode sequence of the holotype: Sample NVG- 22105 A 02, GenBank OR 578720, 658 base pairs: AACTTTATATTTCATTTTTGGAATTTGAGCAGGCATAGTAGGTACTTCTCTAAGTTTATTAATTCGAACTGAATTAGGAAATCCAGGATCTCTAATTGGGGATGATCAAATTTATAATACT ATTGTAACAGCACATGCCTTCATTATAATTTTTTTTATGGTAATGCCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATACTAGGAGCTCCTGATATAGCATTCCCACGTA TAAATAATATAAGATTTTGATTATTACCTCCTTCTTTAACACTTCTTATTTCAAGAAGTATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCTCTATCATCTAATATTGC TCATCAAGGTTCATCTGTTGACTTAGCTATCTTTTCTTTACATCTAGCAGGAATTTCATCAATCTTAGGAGCAATTAACTTCATTACAACTATTATTAATATACGAATTAGAAATTTATCA TTTGATCAAATACCTTTATTCGTATGAGCTGTAGGAATTACAGCATTACTTTTATTATTATCTTTACCTGTTTTAGCTGGAGCTATTACAATATTATTAACTGATCGAAATTTAAATACAT CTTTCTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATATCAACACTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFCFFFE4250CF9AFFBBDF4CB.taxon	materials_examined	Type material. Holotype: ♂ deposited in the California Academy of Sciences, San Francisco, CA, USA [CAS], illustrated in Fig. 42, bears seven printed labels (date on the first label handwritten): six white [Sabino Cany. | Santa Catalina Mts. | Pima Co. Arizona | 1. IV. 60], [collected by | Kilian Roever], [Collection of | J. W. Tilden], [JAMES W. TILDEN | COLLECTION – 1985 | Gift to the California | Academy of Sciences], [DNA sample ID: | NVG- 22105 A 02 | c / o Nick V. Grishin], [{QR Code} CASENT | 8568344], and one red [HOLOTYPE ♂ | Celotes sabinus | Grishin]. Paratypes: 13 ♂♂, 4 ♀♀: USA, Arizona: Mohave Co., 1 ♀ Hualapai Mts., lower el., 16 - Apr- 2008, Ken Davenport leg. (NVG- 20065 A 08, CSU _ ENT 1024696) [CSUC]; 1 ♂ nr. Wickieup, 30 - Mar- 1972, J. W. Tilden leg. (NVG- 22104 H 11, CASENT 8568341) [CAS]; 1 ♀ Yavapai Co., 8 mi SW of Prescott, 21 - Apr- 1976, James W. “ Bill ” Tilden leg. (NVG- 22105 A 03, CASENT 8568345) [CAS]; 1 ♂ Maricopa Co., Camp Creek on Cave Creek Rd., 12 mi NE of Jct. of Cave Creek and Scottsdale Rds., 8 - Apr- 1968, J. A. Miller leg., genitalia NVG 140320 - 91 (NVG- 2250) [TAMU]; 1 ♂ Gila Co., Sevenmile wash, 22 - Aug- 1960, P. A. Opler leg. (NVG- 22104 H 12, CASENT 8568342) [CAS]; 1 ♂ Pinal Co., Coronado National Forest, Santa Catalina Mts., Peppersauce Canyon, 26 - Mar- 2017, Q. Cong, J. Zhang, and N. V. Grishin leg. (NVG- 8304); Pima Co.: 1 ♂ Baboquivari Mts., Brown Canyon, 21 - Mar- 1938, J. W. Tilden leg., genitalia J. W. T. 25 - 15 (NVG- 22104 H 08, CASENT 8568338) [CAS] (Fig. 43 a); 1 ♂ Santa Catalina Mts., Molino Basin, 7 - Sep- 1951, C. D. MacNeill leg. (NVG- 22105 A 01, Fig. 43. Male genitalia of Celotes from USA, in lateral view. CASENT 8568343) [CAS]; Santa Cruz Co.: 1 ♂ a) Celotes sabinus sp. n. paratype, slide J. W. T. 25 - 15, AZ: Pena Blanca Canyon, 11 - Jul- 1981, Jim P. Brock Baboquivari Mts., Brown Canyon, 21 - Mar- 1938, DNA sample NVG- 22104 H 08. b) Celotes nessus, slide 25 - 16, TX: George leg. (NVG- 2115); 2 ♂♂ Walker Canyon nr. Pena West, 12 - Jun- 1940, DNA sample NVG- 22104 H 10. Specimens Blanca Lake, 16 - Aug- 1972, John Hafernik leg., are in CAS, collected and genitalia prepared by J. W. Tilden. genitalia NVG 140320 - 92 & - 93 (NVG- 2251 & Genital capsule is shown on the right, separated valva is on the left with aedeagus above it. Aedeagus of C. sabinus is shown NVG- 2252) [TAMU]; 1 ♂ Pajarito Mtns., Califor- in ventrolateral view as mounted on the slide. nia Gulch, 30 - Mar- 2016, N. Grishin leg. (NVG- 5997); 1 ♂ Patagonia, 24 - Mar- 1938, J. W. Tilden leg. (NVG- 22104 H 09, CASENT 8568339) [CAS]; 1 ♀ 3.5 mi SW of Patagonia, 6 - Aug- 1978, Jim P. Brock leg. (NVG- 2116); Mexico: Sonora: 1 ♂ 16 mi E of Tecoripa, 15 - Mar- 1984, Jim P. Brock leg. (NVG- 2114); 1 ♀ 8 mi W of Rio Yaqui, 16 - Mar- 1984, Jim P. Brock leg. (NVG- 2113); 1 ♂ ca. 8 mi NE of Bavispe, elevation ca. 4000 ’, 25 - Mar- 1998, Richard W. Holland leg. (NVG- 20066 B 02, CSU _ ENT 1024701) [CSUC]. Type locality. USA: Arizona, Pima Co., Santa Catalina Mountains, Sabino Canyon.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFCFFFE4250CF9AFFBBDF4CB.taxon	etymology	Etymology. The name is formed from the type locality of this species, Sabino Canyon, a place familiar to many naturalists, which is just northeast of Tucson at the foothills of the Santa Catalina Mountains in southeastern Arizona, where this species is common. The name is a masculine adjective. English name. Arizona streaky-skipper.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFCFFFE4250CF9AFFBBDF4CB.taxon	distribution	Distribution. Currently known from USA: Arizona and Mexico: Sonora and is likely present in southwestern New Mexico.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFCFFFE4250CF9AFFBBDF4CB.taxon	discussion	Comment. We were surprised to learn that C. sabinus sp. n. is more distant from C. nessus than morphologically distinct C. spurcus, which is rather close to C. nessus genetically.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFCCFFE027E3FD2DFCE6F3B7.taxon	description	Cupithina Grishin, new subtribe http: // zoobank. org / 905 E 8110 - 34 EC- 4 CB 3 - A 0 C 0 - 3 F 9002414 D 3 E	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFCCFFE027E3FD2DFCE6F3B7.taxon	type_taxon	Type genus. Cupitha F. Moore, 1884. Definition. The tribe Astictopterini Swinhoe, 1912 splits into two clades containing approximately the same number of genera, each supported by 100 % of partitions (see Fig. 1 in Zhang et al. (2023 b) and Figs. 45, 46). Although neither clade is very prominent (branches separating them are not particularly long), both are most strongly supported. Therefore, to bring order to the genera in Astictopterini, we divide the tribe into two subtribes. The clade with the type species of the tribe contains generally larger species with more robust bodies and corresponds to the nominotypical subtribe. The second clade, with Cupitha (type species Cupitha tympanifera F. Moore, 1884, which is a junior subjective synonym of Pamphila purreea Moore, 1877), consists of smaller and frequently brighter patterned species and corresponds to the subtribe without an available name. This new and mostly Afrotropical subtribe is distinguished from its relatives by a combination of the following characters (Evans 1937; Evans 1949): palpi either porrect with convergent 3 rd segment or erect with thin and erect 3 rd segment; antennal club with pointed apiculus, either obtuse or hooked; caudal angle of hindwing discal cell not bent up: median vein and vein M 3 collinear, end of cell relatively straight, and vein 3 A usually shorter than vein CuA 2; thorax not shaggy beneath; coxae and tibiae of hindlegs not densely fringed; valvae symmetrical, uncus typically narrowing to a point, ovate, terminal part narrow, frequently needle-like, uncus usually not expanded terminally and not hourglass-shaped. Most confidently identified by DNA and a combination of the following nuclear genomic base pairs is diagnostic: aly 1775.3.2: A 50 G, aly 27.16.1: A 638 C, aly 27.16.1: C 644 G, aly 1603.20.3: G 76 C, aly 1651.28.7: A 167 G. Genera included. The type genus (i. e., Cupitha F. Moore, 1884), Acada Evans, 1937, Acleros Mabille, 1885, Andronymus Holland, 1896, Caenides Holland, 1896, Ceratricula Larsen, 2013, Fresna Evans, 1937, Gorgyra Holland, 1896, Gyrogra Lindsey & Miller, 1965, Hollandus Larsen & Collins, 2015, Hypoleucis Mabille, 1891, Melphina Evans, 1937, Melphinyet Larsen, 2012, Noctulana Larsen, 2012, Osmodes Holland, 1892, Osphantes Holland, 1896, Paracleros Berger, 1978 (see below), Paronymus Aurivillius, 1925, Parosmodes Holland, 1896, Platylesches Holland, 1896, Rhabdomantis Holland, 1896, Semalea Holland, 1896, Teniorhinus Holland, 1892, Xanthodisca Aurivillius, 1925 (see below), Zhang et al. (2023 b) belong to the nominotypical subtribe Astictopterina. Parent Taxon. Tribe Astictopterini Swinhoe, 1912.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFC9FFE0252CFCE5FD3FF5E2.taxon	type_taxon	Type species. Pamphila (?) mackenii Trimen, 1868. Definition. As discussed in the previous section, Acleros Mabille, 1885 (type species Cyclopides leucopyga Mabille, 1877) that includes Paracleros Berger, 1978 (type species Acleros biguttulus Mabille, 1889) splits into three prominent clades: the nominotypical Acleros, Paracleros, and the third clade not associated with any available genus-group names (Figs. 45, 46). The third clade represents a new subgenus that keys to 41. B. (a) (excluding a 2) or 41. B. (b) (b 1) in Evans (1937) and is distinguished from its relatives by darker distal half of ventral hindwing or if hindwing is more uniform in color then dorsal forewing is with broadly white inner margin; tegumen with uncus are narrow in lateral view, uncus in dorsal view is either bulb-shaped or continuously narrows to a point. A combination of the following nuclear genomic base pairs is diagnostic: aly 2627.4.1: T 63 A, aly 2627.4.1: C 69 T, aly 116.29.1: T 2049 A, aly 116.29.1: G 2814 A, aly 9673.4.1: A 480 G.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFC9FFE0252CFCE5FD3FF5E2.taxon	etymology	Etymology. The name of the other subgenus was formed by adding the prefix par - (i. e., besides, alongside) to the genus name. Similarly, we fuse the prefix iso - (i. e., similar, equal, the same) to the genus name. The name is a masculine noun in the nominative singular. Species included. The type species (i. e., Pamphila (?) mackenii Trimen, 1868), Acleros bibundica Strand, 1913, Acleros instabilis Mabille, 1889, Apaustus olaus Plötz, 1884, Acleros ploetzi Mabille, 1889, and a new species described below. Parent taxon. Genus Acleros Mabille, 1885.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFC8FFEE26CEFD23FC2FF5CB.taxon	description	(Figs. 45 – 46 part, 47)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFC8FFEE26CEFD23FC2FF5CB.taxon	diagnosis	Definition and diagnosis. Genomic trees reveal that two specimens from Western Africa identified as Acleros olaus (Plötz, 1884), stat. rest. (type locality in Congo, syntype sequenced as NVG- 18073 C 07) are not monophyletic with A. olaus and form a clade approximately equidistant from it and Acleros mackenii (Trimen, 1868) (type locality in South Africa, possible syntype sequenced as NVG- 20126 G 11) with Acleros instabilis Mabille, 1889, stat. rest. (type locality in Tanzania) (Figs. 45, 46), suggesting that these two specimens belong to a distinct species. Its genetic differentiation measured by Fst / COI barcode difference is: 0.31 / 5.5 % (36 bp) from A. olaus, 0.31 / 4.7 % (31 bp) from A. mackenii, and 0.41 / 5.3 % (35 bp from A. instabilis, which is substantial and provides strong support for these two specimens as combination of characters: forewing subapical spots are present, yellowish above and purplish beneath (not white in the specimens of the type series), diffuse, nearly in line (spot by costa is not strongly offset distad from others), other forewing spots are crisper, with sharper defined edges, the spot in cell CuA 2 - 1 A + 2 A on ventral forewing is with equally sharp edges (not more diffuse and disappearing towards the outer margin), forewing spot in cell CuA 1 - CuA 2 is closer to the spot in cell CuA 2 - 1 A + 2 A than in A. olaus. Due to variability in phenotype, this rather cryptic species is confidently identified by DNA: in the nuclear genome: aly 164.2.2: C 73 A, aly 173.7.6: A 182 T, aly 8937.5.1: A 305 G, aly 1260.26.1: A 247 G, aly 24.4.2: G 63 T and in the COI barcode: T 38 A, T 91 C, T 376 A, G 380 A, A 514 C, T 571 C. Barcode sequence of the holotype: Sample NVG- 22017 G 12, GenBank OR 589638, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGAGCAGGTATAATAGGATCATCTTTAAGATTATTAATTCGTACAGAATTAGGTAACCCTGGATCCTTAATCGGAGATGATCAAATTTATAATACA ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTCTTATATTAGGAGCTCCTGATATAGCTTTCCCCCGAA TAAATAATATAAGATTTTGAATACTTCCCCCATCTTTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCTGGAACTGGCTGAACTGTTTACCCCCCTCTTTCTTCTAATATTGC ACATCAAGGATCATCAATTGATTTAGCTATTTTTTCTTTACATTTAGCCGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGAATTAAAAATATATCA TTTGATCAATTACCTTTATTTATTTGATCCGTAGGTATTACTGCTTTACTTTTACTTTTATCTCTACCTGTTTTAGCAGGTGCTATCACAATACTTCTTACTGACCGAAACTTAAATACTT CTTTTTTCGATCCTGCCGGAGGAGGAGATCCTATTTTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFC8FFEE26CEFD23FC2FF5CB.taxon	materials_examined	Type material. Holotype: ♂ deposited in the Zoologische Staatssammlung München, Germany [ZSMC], illustrated in Fig. 47 a, bears six labels: 2 nd blue, last red, and others white [43390], [Togo | Misahöhe | 1893 | E. Baumann S.], [363 | 7. XII. 93 | A. olaus], [olaus | Plötz], [DNA sample ID: | NVG- 22017 G 12 | c / o Nick V. Grishin], and [HOLOTYPE ♂ | Acleros (Isocleros) | togo Grishin]. Paratype: ♀ Liberia: Monrovia, Firestone Plantation, Dec- 1946, Harry A. Beatty leg. (NVG- 22047 H 11) [CUIC] (Fig. 47 b). Type locality. Togo: Misahöhe.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFC8FFEE26CEFD23FC2FF5CB.taxon	etymology	Etymology. The name is given for the country with the type locality. The name is a noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFC8FFEE26CEFD23FC2FF5CB.taxon	distribution	Distribution. Western Africa, recorded from Togo and Liberia. Taxonomic rearrangement of species currently in the genus Meza Hemming, 1939 The genus Meza Hemming, 1939 (type species Hesperia meza Hewitson, 1877) currently consists of 10 species. Genomic trees reveal that the genus is not monophyletic (Figs. 45, 46) and partitions according to the three sections of the identification key provided by Evans (1937): (i) no secondary sexual characters; (ii) male dorsal hindwing with a hair tuft that overlays bases of veins CuA 1 and CuA 2 and (iii) hair tuft enters a pouch either at the end of discal cell or along the median vein. The type species M. meza — section (i), no tuft — belongs to the tribe Ceratrichiini Grishin, 2019 and other species (with tuft) belong to two clades in the tribe Astictopterini Swinhoe, 1912. Section (ii) consists of three species and is sister to the genus Fresna Evans, 1937 (type species Hesperia netopha Hewitson, 1878). Although this clade is prominent, it is at the tree level of a subgenus (Figs. 45, 46). We include these species in Fresna, forming the following new combinations: Fresna larea (Neave, 1910), comb. nov., Fresna leucophaea (Holland, 1894), comb. nov., and Fresna mabea (Holland, 1894), comb. nov. All the remaining species are from section (iii) and are dispersed within the clade corresponding to the genus Paronymus Aurivillius, 1925 (type species Hesperia ligora Hewitson, 1876) (Figs. 45, 46). We assign them to this genus, forming new combinations: Paronymus banda (Evans, 1937), comb. nov., Paronymus cybeutes (Holland, 1894), comb. nov., Paronymus elba (Evans, 1937), comb. nov., Paronymus gardineri (Collins & Larsen, 2008), comb. nov., Paronymus indusiate (Mabille, 1891), comb. nov., Paronymus mabillei (Holland, 1893), comb. nov. As a result, Meza becomes monotypic to consist of only the type species M. meza, while other species currently in Meza are transferred to Fresna or Paronymus.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFC7FFEF255FF966FD53F1D6.taxon	type_taxon	Type species. Parnara leucophaea Holland, 1894. Definition. As discussed above, Meza Hemming, 1939 (type species Hesperia meza Hewitson, 1877) was not monophyletic, and some of its species formed a clade sister to Fresna Evans, 1937 (type species Hesperia netopha Hewitson, 1878) (Figs. 45, 46). To restore the monophyly, we placed these species in Fresna. However, they are genetically and morphologically distinct from other Fresna and constitute a new subgenus. Species of this new subgenus key to 44. B. in Evans (1937) and are distinguished from similar-looking species (e. g., Meza and Paronymus) by the following characters: male dorsal hindwing with a hair tuft that overlays bases of veins CuA 1 and CuA 2 (does not enter a pouch either at the end of discal cell or along the median vein as in Paronymus; Meza lacks the tuft) and uncus narrowly squared at the tip in dorsal view, not terminating in a sharp point (as in Paronymus), and not bulb-shaped (as in Meza). A combination of the following nuclear genomic base pairs is diagnostic: aly 1249.14.7: T 1966 C, aly 1249.14.7: C 2004 T, aly 536.106.2: A 3984 G, aly 1656.5.1: A 135 C, aly 8937.7.1: A 198 C.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFC7FFEF255FF966FD53F1D6.taxon	etymology	Etymology. The name indicates that these species started in the genus Me [za] and ended in [Fre] sna. The name is a feminine noun in the nominative singular. Species included. The type species (i. e., Parnara leucophaea Holland, 1894), Meza leucophaea bassa Lindsey & L. Miller, 1965 (see below), Parnara larea Neave, 1910, and Parnara mabea Holland, 1894. Parent taxon. Genus Fresna Evans, 1937.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFC5FFEC2665FF3EFB25F76E.taxon	description	Genomic sequencing of the holotype (NVG- 18073 A 05) places it as sister to Paronymus semilutea (Mabille, 1891) (type locality in Nigeria, syntype sequenced as NVG- 21118 G 05) (Figs. 45, 46), being distinct from it due to genetic differentiation, e. g., COI barcode difference of 2.1 % (14 bp). Therefore, we propose Paronymus punctata (Holland, 1896), comb. nov. The holotype of P. punctata is not conspecific with the species Evans (1937) identified as C. punctata: e. g., the holotype has ventral forewing nearly uniformly brown without pale areas by the inner margin characteristic of Evans’ C. punctata; smaller forewing and ventral hindwing spots, and brownish tuft of hair-like scales by the base of dorsal hindwing. Evans’ C. punctata lacks androconia and is a species of Ceratrichia Butler, 1870 (type species Papilio nothus Fabricius, 1787); it does not have a name. This new species is described below.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFC5FFED26E6FBF1FEFBF15E.taxon	diagnosis	Definition and diagnosis. As shown above, Evans misidentified Paronymus punctata Holland, 1896, comb. nov. The distinctive species he considered “ Ceratrichia punctata ” does not have a name and is new. This new species keys to 31. A. (b) (b 2) (a 3) in Evans (1937) and is identified by a combination of brown dorsal forewing with white dots, single (upper) dot in discal cell, ventrally with pale-yellow area by inner margin; most of dorsal hindwing is yellow with costal third brown, ventrally pale yellow, not white, broadly brown at the outer margin and with submarginal dots encircled with brown, such dot in the discal cell, and (frequently replaced with brown spots) 3 – 4 additional dots around.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFC5FFED26E6FBF1FEFBF15E.taxon	materials_examined	Type material. Holotype: ♂ deposited in the African Butterfly Research Institute, Nairobi, Kenya [ABRI], collected in Central African Republic: Zomea, Oct- 1982, ABRI- 2019 - 2412, and its photographs can be found in Williams (2023 a), as the male “ Ceratrichia punctata ” (misidentification). Paratypes: 2 ♂♂ 2 ♀♀: 1 ♀ with the same data as the holotype but Sep- 1996 and ABRI- 2019 - 2413; others in BMNH: 1 ♂ 1 ♀ from Cameroon and 1 ♂ from Angola. Type locality. Central African Republic: Zomea.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFC5FFED26E6FBF1FEFBF15E.taxon	etymology	Etymology. This species was previously misidentified as “ punctata ”, which means “ dotted ” in Latin. A Latin synonym of “ punctata ” is “ notata ”, which is adopted as the name of this species. The name “ notata ” can also be translated as “ noted ”, and this species is noted for its larger white dots and bright colors and for the confusion about its name due to misidentification that genomic analysis of primary type specimens helped to resolve. The name is a feminine adjective.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFC5FFED26E6FBF1FEFBF15E.taxon	distribution	Distribution. Western Africa, recorded from Cameroon, Central African Republic, and Angola. are species distinct from Paronymus semilutea (Mabille, 1891) Genomic trees reveal that sister taxa Ceratrichia indeterminabilis Strand, 1912 (type locality Equatorial Guinea [not Cameroon!]: Benito [river] area, Monte Alen, syntypes sequenced as NVG- 18073 A 07 and NVG- 18073 A 08) and Ceratricula semilutea congdoni Larsen, 2013 (type locality in Uganda) prior to this publication treated as subspecies of Ceratricula semilutea (Mabille, 1891) (type locality Nigeria: Lagos, syntype sequenced as NVG- 21118 G 05) that we placed in Paronymus Aurivillius, 1925 (type species Hesperia ligora Hewitson, 1876) (see above), are not monophyletic with C. semilutea (Figs. 45, 46) and are well differentiated from it genetically with COI barcode difference of 3.0 % (20 bp) and 3.6 % (24 bp), respectively, and from each other of 3.3 % (22 bp). Therefore, we propose to treat them as species-level taxa: Paronymus indeterminabilis (Strand, 1912), stat. rest. and Paronymus congdoni (Larsen, 2013), stat. nov.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFC4FFEA2516FB77FBADF7D2.taxon	description	(Figs. 45 – 46 part, 48)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFC4FFEA2516FB77FBADF7D2.taxon	diagnosis	Definition and diagnosis. The mitochondrial genome tree reveals that a specimen from Malawi identified as Semalea vibius (Hewitson, 1878), comb. nov. (type locality in Gabon) is sister to both S. vibius and Semalea rega (Mabille, 1889), comb. nov. (type locality in Sierra Leone) (Fig. 46), suggesting that it is a third species distinct from them. We sequenced primary type specimens of all four names associated with S. rega and confirmed their synonymy (Figs. 45, 46). Specimens from western Africa (Cameroon, Congo) serve as references for S. vibius. Therefore, the third species is new. In the COI barcode, it differs from S. vibius by 1.1 % (7 bp), which is larger than the difference between S. vibius and S. rega of 0.6 % (4 bp). Despite this moderate difference in the barcode, Fst / Gmin of 0.35 / 0.008 for S. vibius and S. rega indicate that they are distinct species, in agreement with phenotypic distinction. However, we could not compute these statistics for the new species because it is known from a single specimen (at least two specimens are needed). This new species is distinguished from its relatives by the lack of subapical spots on the forewing, larger forewing orange patch that reaches closer to the outer margin, palpi beneath and cheeks more orange than yellow in color, and largely brown ventral hindwing, which is unspotted, and sparsely overscaled with orange. Due to variability in phenotype, confidently identified by DNA: in the nuclear genome: aly 281.6.2: A 130 G, aly 281.6.2: C 131 T, aly 1249.8.1: T 514 C, aly 1603.31.1: A 370 C, aly 37338.23.1: C 264 T, aly 54.4.1: T 1461 T (not A), aly 6648.1.2: A 161 A (not C), aly 5294.20.2: T 630 T (not C), aly 386.8.2: A 506 A (not T), aly 393.3.1: A 492 A (not G) and in the COI barcode: T 88 C, T 118 C, T 139 A, T 202 C, T 547 T, T 610 T, T 646 T. Barcode sequence of the holotype: Sample NVG- 19043 B 12, GenBank OR 589640, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGAGCAGGTATATTAGGAACATCTTTAAGTTTATTAATTCGAACTGAATTAGGTAATCCTGGCTCATTAATTGGAGATGATCAAATTTATAACACA ATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTCCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCACGAA TAAATAATATAAGATTTTGATTACTTCCCCCCTCCCTTACCTTATTAATCTCAAGAAGAATTGTAGAAAATGGAGCTGGAACTGGATGAACTGTCTATCCCCCCCTTTCATCTAATATTGC TCACCAAGGTTCTTCTGTTGATTTAGCAATCTTTTCTTTACATTTAGCAGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAAAAATTTATCT TTTGATCAACTACCTTTATTTGTTTGATCTGTTGGTATTACTGCTTTACTTCTTCTTCTTTCTTTACCTGTTTTAGCTGGAGCTATTACAATATTATTAACTGATCGTAATCTTAATACTT CTTTTTTTGACCCTGCTGGAGGAGGAGACCCTATTCTTTATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFC4FFEA2516FB77FBADF7D2.taxon	materials_examined	Type material. Holotype: ♂ deposited in the American Museum of Natural History, New York, NY, USA [AMNH], illustrated in Fig. 48, bears five labels: four white [11 - viii- 40. | ♂ | Vizara | 2600 ’. | Nyasaland | R. C. Wood], [vibius | vibius | ♂], [DNA sample ID: | NVG- 19043 B 12 | c / o Nick V. Grishin], [{QR Code} | AMNH _ IZC 00337937], and one red [HOLOTYPE ♂ | Semalea malawi | Grishin]. Type locality. Malawi: ca. 9 mi E of Nkhata Bay, Vizara Rubber Plantation, elevation 2600 ’.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFC4FFEA2516FB77FBADF7D2.taxon	etymology	Etymology. The name is given for the country with the type locality. The name is a noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFC4FFEA2516FB77FBADF7D2.taxon	distribution	Distribution. Currently known only from the holotype collected in Malawi.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFC3FFEB27D7FB45FD7BF2E9.taxon	description	The type locality of Osmodes staudingeri Holland, 1896, currently treated as a junior subjective synonym of Semalea rega (Mabille, 1889), comb. nov. (type locality in Sierra Leone) was given in the original description as “ Valley of the Ogové ” (Holland 1896), which is in Gabon, frequently spelled as Ogooué River Valley. This species was described from the female holotype in Holland’s collection, which is in CMNH: “ Type [not types] in my collection ” and “ I do not know the male of this species. The solitary female in my collection …, ” which was illustrated (Holland 1896). N. V. G. found a female in CMNH with the following five labels, white, but the 4 th (without any text) red: [Efulen, | Kamerun, | A. I. Good | C. M. Acc. 4454], [Osmodes | staudingeri | ♀ type Holl.], [unknown | to Mabille], [], [DNA sample ID: | NVG- 20125 A 08 | c / o Nick V. Grishin]. The female matches the original description perfectly and agrees with the illustration rather closely. Provided that it carries its identification label (2 nd label) in Holland’s handwriting, it is the holotype of O. staudingeri. However, the locality label does not mention “ Valley of the Ogové, ” but points to Cameroon: Efoulan (in current spelling). This is a more likely locality because this species is not otherwise known from Gabon but recorded from Cameroon (Williams 2023 b). Therefore, we hypothesize that the locality in the original description is erroneous, and the locality label on the holotype points to its provenance. Hence, the type locality of O. staudingeri is Cameroon: Efoulan, and genomic sequencing of the holotype confirms this taxon as a junior subjective synonym of S. rega (syntype in MFNB sequenced as NVG- 18073 A 03) (Figs. 45, 46). from Xanthoneura corissa (Hewitson, 1876) Two phenotypically different subspecies, Xanthoneura corissa corissa (Hewitson, 1876) (type locality in Kalimantan) and Xanthoneura corissa patmapana (Fruhstorfer, 1911) (type locality in Java), are genetically differentiated (Figs. 45, 46) and differ by 4.1 % (27 bp) in their barcodes. Therefore, we propose treating Xanthoneura patmapana (Fruhstorfer, 1911), stat. nov. as a species distinct from Xanthoneura corissa (Hewitson, 1876).	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFC2FFEB2527FE17FD1FF71D.taxon	type_taxon	Type species. Carystus telesinus Mabille, 1878. Definition. Genomic trees reveal that while Xanthoneura Eliot, 1978 (type species Hesperia corissa Hewitson, 1876) is monophyletic (and we keep it as a single genus), it deeply splits into two clades: the nominotypical and unnamed that represents a new subgenus. Members of this new subgenus key to J. 10.23. in Evans (1949) and are distinguished from their relatives by the 3 rd segment of palpi stout and bent forward, ventral hindwing largely unmarked (or with a central spot), veins not yellower, forewing with a spot in cell M 2 - M 3 right above the spot in cell M 3 - CuA 1, these two spots together give an appearance of a single larger spot; uncus in dorsal view much narrower than long, narrowing in the middle, divided, arms small knob-like, not widely separated. A combination of the following nuclear genomic base pairs is diagnostic: aly 577.16.2: T 174 C, aly 577.16.2: T 198 A, aly 577.16.2: A 216 G, aly 1591.7.3: A 333 C, aly 1222.40.2: A 15 G.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFC2FFEB2527FE17FD1FF71D.taxon	etymology	Etymology. The species of this subgenus are from [Phi] lippin [es] + a. The name is a feminine noun in the nominative singular. Species included. The type species (i. e., Carystus telesinus Mabille, 1878) and Xanthoneura obscurior de Jong & Treadaway, 2007. Parent taxon. Genus Xanthoneura Eliot, 1978.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFC2FFE826A6F9A8FC02F255.taxon	description	Afrotropical species of Astictopterus C. Felder & R. Felder, 1890 belong to Isoteinon C. Felder & R. Felder, 1862 Genomic trees reveal that Afrotropical species currently placed in Astictopterus C. Felder & R. Felder, 1860 (type species Astictopterus jama C. Felder & R. Felder, 1860) are not monophyletic with it and Felder & R. Felder, 1862) (Fig. 45, 46). Therefore, to restore monophyly, we transfer these species from Astictopterus to Isoteinon, forming the following new combinations: Isoteinon anomoeus (Plötz, 1879), comb. nov. (type locality in Ghana), Isoteinon bruno (Evans, 1937), comb. nov. (type locality in Tanzania), Isoteinon inornatus (Trimen, 1864), comb. nov. (type locality in South Africa), and Isoteinon punctulata (A. Butler, 1895), comb. nov. (type locality in Tanzania).	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFC1FFE8255FFCB1FD66F514.taxon	type_taxon	Type species. Zophopetes ganda Evans, 1937. Definition. Described by Evans (1937) in the genus Zophopetes Mabille, 1904 (type species Pamphila dysmephila Trimen, 1868) and kept in it since, Z. ganda (type locality in Ivory Coast) is not monophyletic with Zophopetes and instead is in the same clade with Leona Evans, 1937 (type species Hesperia leonora Plötz, 1879) and its subgenus Mopala Evans, 1937 (type species Ismene? orma Plötz, 1879): sister to the subgenus Leona in the nuclear genome tree (Fig. 45) and sister to both Leona and Mopala, but less confidently, in the mitochondrial genome tree (Fig. 46). In either case, it is closely related to them both and yet genetically differentiated from them at approximately the same level as they are from each other. Therefore, similarly to Mopala, the lineage with Z. ganda represents a subgenus of Leona. This new subgenus keys to 53. A. in Evans (1937) and is distinguished from its relatives by males with a brand (from the base of vein CuA 1 to near vein 1 A + 2 A) and an apical spot on dorsal forewing (both absent in Zophopetes), ventral hindwing uniformly pale-brown with small dark-brown-framed spots (not like Leona and Mopala); upturned harpe, uncus in dorsal view narrower than in Zophopetes, especially in the middle, with smaller knob-shaped arms. A combination of the following nuclear genomic base pairs is diagnostic: aly 1038.19.1: T 165 C, aly 1405.10.1: T 456 C, aly 925.11.3: A 69 G, aly 587.17.1: T 205 A, aly 2127.3.3: A 24 G, aly 1838.61.1: T 618 T (not C), aly 1838.61.1: T 675 T (not A), aly 4305.26.4: C 31 C (not G), aly 27.16.1: C 354 C (not A), aly 614.16.1: A 1098 A (not G).	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFC1FFE8255FFCB1FD66F514.taxon	etymology	Etymology. The name is a feminine noun in the nominative singular, a tautonym of the type species name. Species included. Only the type species. Parent taxon. Genus Leona Evans, 1937.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFC1FFE9254FF90EFD46F107.taxon	type_taxon	Type species. Proteides balenge Holland, 1891. Definition. Currently, Gretnini Grishin, 2019 is a monotypic tribe consisting of a single genus Gretna Evans, 1937 (type species Hesperia cylinda Hewitson, 1876). Inspection of genomic trees reveals that Grenta balenge (Holland, 1891) (type locality in Gabon) is strongly differentiated genetically from the Distant, 1886 (type species Isma obscura Distant, 1886) from Iambrix Watson, 1893 (type species Nisoniades salsala F. Moore, 1866) or Hyarotis F. Moore, 1881 (type species Papilio adrastus Stoll, 1780) from Quedara Swinhoe, 1919 (type species Quedara comoplea Swinhoe, 1919) and is at the tree level corresponding to genera. Therefore, the lineage with G. balenge represents a genus-level taxon (Fig. 49). This new genus keys to 57. B. in Evans (1937) and is distinguished from its relatives by the subapical forewing spot in cell R 5 - M 1 being offset distad from others, uncus with processes at its base directed sideways (one on each side, no processes in Gretna), and deeper separation between harpe and ampulla that is more expanded than in Gretna. A combination of the following COI barcode base pairs is diagnostic: T 206 C, A 494 T, A 520 C, A 562 C, A 586 T.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFC1FFE9254FF90EFD46F107.taxon	etymology	Etymology. The name is a feminine noun in the nominative singular, formed from the type species name. Species included. Only the type species. Parent taxon. Tribe Gretnini Grishin, 2019.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFC0FFF6255FFAAAFD53F3BF.taxon	type_taxon	Type species. Hesperia lacida Hewitson, 1876. Definition. Within a smaller genus Gretna Evans, 1937 (type species Hesperia cylinda Hewitson, 1876) due to removal of Balenga balenge Holland, 1891, comb. nov. (type locality in Gabon), we note the genetic differentiation of a clade sister to that with the type species (Fig. 49). This clade diverges from other Gretna at least at the tree level corresponding to subgenera (if not genera), i. e., approximately the same as Isma Distant, 1886 (type species Isma obscura Distant, 1886) from Idmon Nicéville, 1895 (type species Baoris unicolor Distant, 1886, a junior homonym, available name for this species is Iambrix distanti Shepard, 1937) (Fig. 49), and we regard it as representing a subgenus. This new subgenus keys to 53. A. (a) (b 1) in Evans (1937) and is distinguished from its relatives by an undivided and much narrower uncus, almost spike-shaped in dorsal view; better developed (and hyaline) spot in the middle of dorsal hindwing, prominent spot in forewing cell CuA 2 - 1 A + 2 A, and clearly defined whitish bands or area on ventral hindwing. A combination of the following COI barcode base pairs is diagnostic: T 56 C, T 154 C, T 379 A, T 553 A, T 556 A.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFC0FFF6255FFAAAFD53F3BF.taxon	etymology	Etymology. The name is a feminine noun in the nominative singular and is a fusion of species names in this subgenus: Zar [emba] + [lac] ida. 1884. Parent taxon. Genus Gretna Evans, 1937.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFDFFFF6257FFBEFFD44F5A4.taxon	type_taxon	Type species. Parnara tulsi Nicéville, 1884. Definition. Genomic trees reveal that the lineage of Caltoris tulsi (Nicéville, 1884) (type locality in India) originates in rapid radiation and is not strongly grouped with any other single genus. Complemented with its strong genetic differentiation from others (Fig. 50), it represents a genus-level taxon. This new genus keys to M. 7.12. in Evans (1949) and is distinguished from its relatives by forewing without tuft of scales beneath and spots in discal cell, ventral hindwing in its basal half and ventral forewing along costal margin overscaled with pale purplish (not ocherous) scales; uncus rounded at its distal end, only slightly knobbed on the sides, ampulla expanded and pointed dorsad (not rounded at its apex). A combination of the following nuclear genomic base pairs is diagnostic: aly 2643.5.1: T 192 C, aly 2613.4.2: G 2377 C, aly 1877. 13.1: A 892 T, aly 1877.13.1: T 938 C, aly 1877.13.1: A 1195 T.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFDFFFF6257FFBEFFD44F5A4.taxon	etymology	Etymology. The name is a feminine noun in the nominative singular formed from the type species name. Species included. Only the type species. Parent taxon. Tribe Baorini Doherty, 1886.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFDDFFF42523FD02FD36F6E0.taxon	type_taxon	Type species. Parnara perobscura H. H. Druce, 1912. Definition. As discussed above and shown in the trees (Fig. 50), the newly expanded genus Gegenes Hübner, 1819 (type species Papilio pumilio Hoffmansegg, 1804) can be partitioned into five subgenera. The species previously called Torbenlarsenia perobscura (H. H. Druce, 1912) (type locality in Ghana) is not monophyletic with Hesperia holtzi Plötz, 1882 (type locality in Angola), which is the type species of Torbenlarsenia Kemal & Koçak, 2020, and belongs to a distinct clade that we define as one of the five subgenera. It does not have a name. This new subgenus keys to 68. B. (b) (a 1) (a 2) (a 3) in Evans (1937) and is distinguished from its relatives by long, finger-like flanges at the base of uncus and thinner, more terminally rounded tooth of harpe projecting anteriad. A combination of the following nuclear genomic base pairs is diagnostic: aly 151.39.1: A 351 T, aly 1139.20.2: A 245 C, aly 1412.8.1: G 430 C, aly 1412.8.1: C 431 A, aly 1349.7.9: G 58 T.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFDDFFF42523FD02FD36F6E0.taxon	etymology	Etymology. The name is a feminine noun in the nominative singular and refers to long flanges from the base of uncus that identify this subgenus. Species included. The type species (i. e., Parnara perobscura H. H. Druce, 1912) and Pamphila detecta Trimen, 1893. Parent taxon. Genus Gegenes Hübner, 1819.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFDDFFF52558FA06FD36F262.taxon	type_taxon	Type species. Hesperia havei Boisduval, 1833. Definition. As discussed above and shown in the trees (Fig. 50), the newly expanded genus Gegenes Hübner, 1819 (type species Papilio pumilio Hoffmansegg, 1804) can be partitioned into five subgenera. The lineage with the species currently called Borbo havei (Boisduval, 1833) (type locality in Madagascar) corresponds to the last one (others discussed above). This new subgenus keys to 68. B. (b) (b 1) (c 2) in Evans (1937) and is distinguished from its relatives by narrower uncus terminally rounded in dorsal view with approximately parallel sides (not concave, and not gradually narrowing distad) and ampulla expanded distad and rounded, nearly reaching the distal end of harpe, which is with a sharp, tooth-like process directed anterodorsad at its base. A combination of the following nuclear genomic base pairs is diagnostic: aly 1952.2.12: C 46 T, aly 1952.2.12: T 48 A, aly 310.6.1: G 1542 C, aly 4196.3.1: T 1023 C, aly 4196.3.1: G 1039 T, aly 127.59.2: T 289 T (not C), aly 6209.2.1: T 1095 T (not G), aly 813.4.5: A 855 A (not C), aly 275211.12.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFDDFFF52558FA06FD36F262.taxon	etymology	Etymology. The name is a feminine noun in the nominative singular formed from the type species name. Species included. Only the type species. Parent taxon. Genus Gegenes Hübner, 1819.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFDCFFF5260BFEFEFBB7F06C.taxon	description	On the distribution of Euphyes vestris (Boisduval, 1852) and Euphyes kiowah (Reakirt, 1866)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
03F1878BFFDAFFF12622FCC6FC95F1C5.taxon	description	The distribution of L. arabus as recorded on iNaturalist (2023) is disjoint, showing a cluster of observations in southeastern Arizona and the major range from Sinaloa – Durango – Coahuila – Nuevo Leon – south Texas southwards (Fig. 54 c). These two disjoint areas in the distribution correspond perfectly to the two distinct species revealed by genomic sequencing (plus specimens from both clades in Sonora, Mexico where no iNaturalist observations existed) (Fig. 54). Sequenced specimens from near the type locality of L. arabus provide the name for the southeastern Arizona and Sonora (except southernmost) cluster (Fig. 54 blue). The type locality of Lerodea dysaules falls well within the major range, and the sequenced specimen from Guerrero belongs to the second species along with other specimens across the major range (Fig. 54 red), providing an available name for this species. Therefore, we reinstate Lerodea dysaules Godman, 1900, stat. rest. as a species-level taxon. In conclusion, L. arabus is the northwestern species, and L. dysaules is the southeastern species. The two species may meet in southern Sonora, Mexico, and the westernmost record of L. dysaules is from Alamos, Sonora (sequenced as NVG- 21056 A 02) (Fig. 54 red). Curiously, genomic sequencing suggests that populations from Mexico Baja California Sur are L. arabus (Fig. 54). As for the phenotypic assessment, both species are variable in wing patterns, and if identification is possible, it should be done within each pattern form, comparing specimens with similar patterns between species. Generally, ventral overscaling in L. dysaules is more mottled in appearance, especially extending towards the apex but turning towards mid-costa and is bordered by more diffuse small pale spots (if the spots are present at all), these spots are also diffuse and frequently connected into a band even if the central brown patch is absent. In L. arabus, pale ventral overscaling is more uniform, without apparent mottling, the hindwing brown patch (if expressed) is larger and frequently extending towards the apex (at least the area between the patch and the apex is darker than the central submarginal area), giving the patch a more triangular appearance; if postdiscal small pale spots are expressed, their edges are better defined, and the spots are more contrasty on the background, better separated from each other, especially in specimens lacking the patch, and the spot in cell Sc + R 1 - RS may be particularly prominent. To aid in the identification of these species, we provide COI barcodes of specimens from near the type localities: Lerodea arabus from USA: AZ, Pima Co. [LACM], sample NVG- 22094 F 10, GenBank OR 578721: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACATCATTAAGTCTTTTAATTCGAACAGAATTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTACAATACT ATTGTGACAGCTCACGCTTTTATTATAATTTTTTTCATGGTAATACCTATTATAATTGGTGGATTTGGTAATTGATTAGTTCCTCTAATATTAGGTGCCCCAGATATAGCTTTCCCACGAA TAAATAATATAAGATTTTGAATACTGCCACCTTCCTTAATATTATTAATTTCAAGTAGAATTGTAGAAAATGGTGCAGGAACAGGTTGAACTGTATATCCTCCTCTTTCTTCTAATATTGC CCACCAAGGAGCCTCAGTTGACTTAGCGATTTTTTCATTACATTTAGCAGGTATTTCATCTATTTTAGGAGCTATTAACTTTATTACTACTATTATTAATATACGAATTAAAAATTTATCA TTTGATCAAATACCTTTATTTGTTTGATCAGTAGGAATTACAGCATTATTATTACTTTTATCTCTACCTGTTTTAGCAGGTGCTATTACCATACTTTTAACTGACCGAAATTTAAACACTT CATTTTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT Lerodea dysaules from Mexico: Guerrero [MGCL], sample NVG- 21085 D 09, GenBank OR 578722: AACTTTATACTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACATCTTTAAGTCTTTTAATTCGAACAGAATTAGGCAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTAACAGCCCATGCCTTTATTATAATTTTTTTTATAGTTATGCCTATTATAATTGGAGGATTTGGTAATTGACTAGTTCCTTTAATATTAGGAGCACCTGACATAGCATTCCCACGAA TAAATAATATAAGATTTTGAATACTACCACCTTCTCTAATATTATTAATCTCAAGTAGAATTGTAGAAAATGGTGCAGGTACAGGTTGAACAGTATATCCCCCTCTTTCATCTAATATTGC ACATCAAGGAGCCTCAGTTGACCTTGCAATTTTTTCTCTTCATTTAGCTGGTATTTCATCCATTTTAGGAGCTATTAATTTTATTACTACTATTATTAACATACGAATTAAAAATTTATCA TTCGATCAAATACCTTTATTTGTCTGATCTGTAGGAATTACAGCATTATTATTACTTTTATCTTTACCTGTCTTAGCAGGAGCTATTACTATACTTTTAACCGATCGAAACCTTAATACTT CATTCTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT [No genus] osibius Draudt, 1924 is an unavailable name The name “ osibius ” was published by Draudt (1921 – 1924) below a specimen illustration on the plate 113 B entitled “ AGRIAS-ERYNNIS ”, row c image 4 from the left, out of 7. No other mention of the name in the genus Agrias, and the species illustrated last (i. e., bottom right: row c image [7], current name Hesperia colorado (Scudder, 1874 )) was placed by Draudt (1923 b) in the genus Erynnis. The species illustrated next to last (row c, images [5] and [6], current name Turesis complanula (Herrich-Schäffer, 1869), misidentified as “ lucasi ”) was placed by Draudt (1923 a) in the genus Turesis. Only two genera are mentioned in the title of this plate (Agrias and Erynnis), but at least three are illustrated. Therefore, it remains unclear which genus “ osibius ” was placed in (Agrias, Turesis [not mentioned on the plate], Erynnis, or some other genus). Mielke (1993) listed “ osibius ” (as “ osybius ”) in combination with the genus Turesis Godman, 1901 (type species Hesperia lucas Fabricius, 1793) and treated it as a valid species (Mielke 2004; Mielke 2005). However, the name “ osibius ” by Draudt is unavailable because it was not proposed “ in unambiguous combination with a generic name ” as demonstrated above (fails ICZN Code Art. 11.9.3) and therefore cannot be used as a valid name for any species. Finally, we were not able to unambiguously determine the identity of the specimen illustrated by Draudt (1921 – 1924) (among others, it might have been Rhinthon Godman, 1900 or Niconiades Hübner, [1821]), but it does not seem to belong to Turesis due to details in its wing pattern, such as a postdiscal arc of increasing in size pale spots on ventral hindwing, that are not characteristic of Turesis.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Butterfly classification and species discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11 (3): 1-94
