Milanion (Milanion) virga Grishin, 2023

Zhang, Jing, Cong, Qian & Grishin, Nick V., 2023, Supplementary Materials and Appendix, Insecta Mundi 2023 (26), pp. 1-115 : 21-22

Milanion (Milanion) virga Grishin , new species

https://zoobank.org/ 2C440233-C0FA-49D4-9496-A451B5F57764

( Fig. 2 part, 41–42, 254–255)

Definition and diagnosis. As detailed above, Papilio clito Fabricius, 1787 and Milanion pilumnus var. hemestinus Mabille and Boullet, 1917 are junior subjective synonyms of Milanion hemes hemes (Cramer, 1777) and Milanion pilumnus Mabille and Boullet, 1917 , respectively. As a result of this, and because no other available name applies to it, the species that Evans (1953) called “ Milanion hemestinus ” was misidentified and is new. This new species keys to (E.46.3) in Evans (1953). It differs from its relatives by a combination of the following characters: a white spot in forewing cell CuA 2 -1A+2A, a dorsal hindwing white band about the same width as the brown marginal area, basal half of the ventral hindwing is white with a dark ray near costa from the base to costal margin (i.e., there is an elongated white spot near the base by costa); both gnathos and uncus arms are equally wide apart, tips of uncus not turned outwards; harpe broad, terminally rounded and with a spine in the middle at the dorsal margin. This species is not cryptic and is diagnosed reliably by phenotype. In DNA, a combination of the following base pairs is diagnostic in the nuclear genome: aly536.107.1:A81G, aly536.107.1:C93T, aly770.13.3:T153C, aly 1937.10.4:C88T, aly 1937.10.4:C112A, and COI barcode: T19C, T172C, A499C, A541C, T613C.

Barcode sequence of the holotype. Sample NVG-18027D10, GenBank OR837640, 658 base pairs: AACTTTATATTTTATTTTCGGAATTTGAGCAGGATTAGTAGGAACTTCTTTAAGTTTATTAATTCGAACTGAATTAGGAAATCCAGGATCTTTAATT GGAGATGACCAAATTTATAATACTATTGTAACTGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCAATCATAATTGGTGGATTTGGAAATT GATTAGTACCATTAATATTAGGAGCCCCAGATATAGCTTTCCCTCGAATAAATAACATAAGATTTTGATTATTACCCCCATCTCTTATATTATTAAT TTCAAGAAGTATTGTAGAAAATGGTGCAGGAACTGGATGAACAGTTTATCCACCTCTTTCAGCTAACATCGCTCATCAAGGTTCATCAGTAGATCTA GCAATTTTTTCTTTACATTTAGCTGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACTACTATTATTAATATACGAGTAAATAATTTATCAT TTGATCAAATACCCTTATTTGTGTGAGCTGTAGGTATTACAGCTTTACTTTTACTCCTATCATTACCCGTATTAGCAGGTGCTATTACTATATTATT AACTGATCGAAATTTAAATACATCATTTTTCGACCCAGCAGGAGGAGGAGATCCAATCTTATATCAACATCTATTT

Type material. Holotype: ♂ currently deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 41–42, bears the following five rectangular labels, four white: [ BRASIL: Rondonia | 62 km S Ariquemes | Fazenda Rancho | Grande, 165m | 10-32′S, 62-48′W | 29 Oct-10 Nov 1991 | Brian P. Harris], [ Milanion | hemes | hemes], [DNA sample ID: | NVG-18027D10 | c/o Nick V. Grishin], [USNMENT | {QR Code} | 01465169], and one red [HOLOTYPE ♂ | Milanion | virga Grishin ]. Paratypes: 5♂♂ and 2♀♀: 1♂ NVG-15094A11 the type locality, 27-Oct-1997, G. T. Austin leg. [ MGCL]; 1♂ NVG-18018H05 USNMENT_01450997 Ecuador: Orellana, Yasuni Research Station, Rios Tivacuno and Tiputini, elevation 220 m, GPS −0.675000, −76.396667, 30-Oct-1998, D. H. Ahrenholz leg., genitalia NVG-22032E07 [ USNM]; 1♂ NVG-18018H10 USNMENT_01465137 Peru: Madre de Dios, Tambopata Res., Rio La Torre, elevation 300 m, 6-Oct-1986, S. S. Nicolay leg., genitalia NVG-22032E02 [ USNM]; 1♂ NVG-18027B01 Peru: Middle Rio Ucayali, 6-Apr-1929, H. Bassler Collection [ AMNH]; 1♂ NVG-18018G09, USNMENT_01450989 Peru: 30 km SW of Pto. Maldonado, 300 m, 20-Oct-1983, S. S Nicolay leg. [ USNM]; 1♀ NVG-18018G10, USNMENT_01450990 Peru: Pto. Aldonado, 290 m, 15-Oct-1983, S. S Nicolay, leg. [ USNM]; 1♀ NVG-18019H07 French Guiana [ AMNH].

Type locality. Brazil: Rondônia, 62 km S Ariquemes, Fazenda Rancho Grande, elevation 165m, GPS −10.533, −62.800.

Etymology. The name is given for the pale streak at the base by the costa of the ventral hindwing characteristic of this species. In Latin, virga means rod or streak. The name is a noun in apposition.

Distribution. Widely distributed in tropical South America: Ecuador, Peru, French Guiana, and Brazil.