Cecropterus (Murgaria) dariensis Grishin, 2023

Zhang, Jing, Cong, Qian & Grishin, Nick V., 2023, Supplementary Materials and Appendix, Insecta Mundi 2023 (26), pp. 1-115 : 10-11

Cecropterus (Murgaria) dariensis Grishin , new species

https://zoobank.org/ 269C0E17-EE28-439C-8F7C-7247A6D6CC62

( Fig. 1 part, 17–18, 229–230)

Definition and diagnosis. Superficially somewhat resembles sympatric Cecropterus trebia (Möschler, 1879) but differs from it and other relatives by completely brown hindwing ventral surface (without white at the outer margin, but with whitish fringes) and 4 subapical hyaline spots on the forewing. It also resembles Spicauda Grishin, 2019 but differs in the hyaline spot in forewing cell M 3 -CuA 1, being dash-like and strongly offset from the cell base and discal hyaline band. Keys (imperfectly) to “ Urbanus carmelita carmelita ” (C.13. 22(b)) in Evans (1952) but differs from this species currently known as Cecropterus carmelita (Herrich-Schäffer, 1869) (type locality in Brazil) by vestigial, line-like and not scalloped white outer marginal band on the hindwing underside (the fringe in mostly white from the apex to vein CuA 1); differs also from the somewhat similar Cecropterus athesis ( Hewitson, 1867) by longer hindwing tails and hyaline spot in forewing cell CuA 2 -1A+2A being better aligned with the discal band, and by the lack of a darker-brown line along the outer margin of ventral hindwing, which is replaced with a vestigial white band. In male genitalia ( Fig. 229–230), most similar to Cecropterus doryssus (Swainson, 1831) (type locality in Brazil: Bahia) and relatives but differs from them by less angled harpe with rounder curve from ventral to posterior margin and with serrated dorsal margin that is more prominently expanded into a small distal lobe. This species is not cryptic and is unambiguously recognizable by its phenotype. The following base pairs are diagnostic in the nuclear genome: aly 2750.3.3:G39A, aly515.2.2:G496T, aly1651.24.15:C120A, aly235.4.4:T51C, aly23605.18.5:G118A, aly1038.17.30:C61C (not A), aly1038.17.30:A62A (not C), aly383.7.2:T54T (not A), aly 1042.3.1:A138A (not G), aly1651.24.15:C91C (not T), and COI barcode: T266C, T401C, T424A, A550G, T581C.

Barcode sequence of the holotype. Sample NVG-19121F09, GenBank OR837628, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAGTTGGAACTTCATTAAGTTTACTTATTCGAACTGAATTAGGAACTCCAGGATCTTTAATT GGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATT GATTAATCCCCCTTATATTAGGAGCCCCCGATATAGCTTTCCCCCGTATAAATAATATAAGATTTTGATTACTACCTCCATCTTTAACTCTTTTAAT TTCAAGAAGAATTGTAGAAAATGGTGCAGGTACTGGATGAACAGTTTACCCCCCTTTATCATCTAATATTGCTCATCAAGGAGCATCCGTAGATTTA GCAATTTTCTCACTACATCTTGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACTATTATTAACATACGAATTAATAATTTATCAT TTGATCAAATACCATTATTTATTTGAGCTGTTGGAATTACAGCTTTACTATTATTACTTTCATTGCCTGTTTTAGCTGGAGCTATTACTATACTACT AACTGATCGAAATTTAAATACTTCTTTTTTTGACCCAGCAGGTGGGGGAGATCCTATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution , Washington, DC, USA ( USNM), illustrated in Fig. 17–18, bears the following four rectangular labels, three white: [ PANAMA: 1000m. | Darien, Cana | 5. Jan. 1984 | Gordon Small], [DNA sample ID: | NVG-19121F09 | c/o Nick V. Grishin], [USNMENT | {QR Code} | 01602755], and one red [HOLOTYPE ♂ | Cecropterus | dariensis Grishin ].

Type locality. Panama: Darien Province, Cana, elevation 1000 m.

Etymology. The name reflects the type locality and is a masculine adjective.

Distribution. This species is currently known only from the holotype collected in Panama.