Plecotus sardus, Mucedda & Kiefer & Pidinchedda & Veith, 2002

Mucedda, Mauro, Kiefer, Ndreas, Pidinchedda, Rmanno & Veith, Ichael, 2002, A new species of long · eared bat (Chiroptera, Vespertilionidae) from Sardinia (Italy), Acta Chiropterologica 4 (2), pp. 121-135 : 123-129

Plecotus sardus sp. nov.

Derivatio nominis

The specific name sardus refers to the island of Sardinia (Italy, Mediterranean Sea) where the taxon is found.

Specimens Examined

Holotype

Adult male, skin, skull and baculum, from the collection of the Department of Zoology and Biological Anthropology of the University of Sassari (Dipartimento di Zoologia e Antropologia Biologica? DZAB 0023 ); found dead by M. Mucedda and E. Pidinchedda on September 22, 2001 in the interior of a cave at Lanaitto̕s Valley, Oliena District, Nuoro Province, middle-east Sardinia , Italy (40°15̕29"N, 9°29̕13"E, 150 m a.s.l.). Measurements (in mm): HB, 45; Tail, 51; Ear, 37.5; TL, 18.5; TW, 6.5; FA, 41.2; TH, 6.0; CL, 3.1; HF, 7.7; F2, 35.8; F3, 71.8; F4, 57.0; F5, 56.0; CaL, 18; SL, 17.10; CBL, 15.90; SH, 7.80; IOW, 3.65; M 3 ̅M 3, 6.25; M 3 ̅M 3, 4.00; C̅M 3, 5.75; C̅M 3, 6.20; ML, 11.30; MW, 9.30; CsupL, 1.50; MBD, 4.75; ZW, 9.20; MDB, 1.20; BL, 0.80; BW, 0.71.

Other specimens

One juvenile; found dead by M. Mucedda and E. Pidinchedda in the interior of a cave at Baccu Addas valley, Baunei district, province of Nuoro. Five individuals, 1 ♂ and 4 ♀♀? mist-netted by M. Mucedda, E. Pidinchedda and M. L. Bertelli near the Omodeo Lake (Ula Tirso District, Oristano Province), and subjected to morphometric measurements (see Table 2 ), drawing of wing patterns and photography ( Fig. 2 ), and then released. We took tissue samples for genetical analysis from all these individuals.

Diagnosis

Plecotus sardus sp. nov. is unambiguously identifiable through DNA sequence analysis. The partial 16S rRNA sequence of the holotype (GenBank Accession No.

AY175822 ) reads: tattagaggcactgcctgcccagt gactccagttaaacggccgcggtatcctgaccgtcaaagg tagcataatcatttgttctctaaatagggacttgtatgaatgg ccccacgagggtttaactgtctcttacttttaatcagtg aaattgacactcccgtgaagaggcgggaattaaaaaata agacgaWaagaccctatggagctttaattaattaactcac aaattataatactaatctacaagagacaagctaaacttgatt gagttaacaatttNNgttggggcgaccttggaataaagatc aacctccgagatagatctactaagacctacaagtcaaggtt atatactatacattgatccgccaatagcgatcaacgaaaca agttaccctagggataacagcgcaatcctatttaagagtcc atatcgacaattagggtttacgacctcgatgttggatcagga catcccaatggtgcagcagctattaatgtgttcgtttgttcaa cgattaaagtcctacgtgatctgagt.

It differs in 24 substitutions (21 transitions, tis, and 3 transversions, tvs) from P. auritus (GenBank AY134013 ), 21 substitutions (19 tis and 2 tvs) from P. alpinus ( AY134017 ), 44 substitutions (37 tis and 7 tvs) from P. austriacus ( AY134022 ), and 40 substitutions (35 tis and 5 tvs) from P. kolombatovici ( AY134025 ), respectively.

Like P. alpinus , P. sardus sp. nov. combines typical morphological features of both P. auritus and P. austriacus ( Table 3 ). It is similar to P. auritus in its brownish colour of dorsal pelage, length of thumb and length of thumb-claw; similar to P. austriacus in its whitish colour of ventral pelage, broadest width of tragus and length of forearm ( Table 3 ); and similar to P. alpinus in the shape of the penis ( Fig. 3 ). However, P. sardus sp. nov. differs from all other European Plecotus spp. in the length of the tragus and the shape of the baculum ( Fig. 4 ). Additionally, it differs from P. kolombatovici in the forearm and ear lengths ( Table 3 ).

Description

Plecotus sardus sp. nov. is larger than both P. auritus and P. kolombatovici , reaching the size of specimens of P. austriacus and P. alpinus . The dorsal fur is brown rather than reddish as in some P. auritus . The hair is very fine and woolly, ca. 10 mm long and tri-coloured: to the first 6 mm are very dark brown-grey, the next 2.5 mm are whitish-light brown, and the terminal portion (1.5 mm) brown. The ventral pelage is whitish, tending to pale brown. The hair is ca. 7 mm long and bi-coloured: the basal 2/3 is dark brown, the terminal 1/3 is whitish. The brown colour of dorsal fur spreads slightly towards the neck and the change in colour between dorsal and ventral fur is abrupt and evident.

The wing membranes are brown, tending slightly towards reddish. The plagiopatagium inserts at the base of the 5th toe. The tail is 51 mm long, with about 2.5 mm of the last caudal vertebra extending beyond the uropatagium. The calcar is 18 mm long and slightly bent, with a small lobe at the tip; it reaches approximately half the length of the edge of the uropatagium. The hind foot is similar in size to that of P. alpinus , and almost as large as in P. auritus , but the hairs on the toes are shorter than in P. auritus .

The ears are large, ca. 37.5 mm long, pale-brown with a reddish hue. The tragus is very large, 18.5 mm long, pale brown tending towards yellowish-white, and it is more or less straight (see Fig. 2 ). It is the longest tragus among the European longeared bats and is one of the most important characters for distinguishing this species from other European Plecotus ( Table 3 ). The maximum tragus width is 6.5 mm, which is similar to P. austriacus .

The muzzle is narrower and less swollen than in P. auritus . Its colour is pale rosybrown, without the dark mask typical for P. austriacus . The protuberances over the eyes are 1 mm wide ( Table 3 ), with a few long and straight hairs. Evident under the chin is a glandular wart that lacks hairs.

The penis is almost cylindrical, only slightly rounded, and pointed only at the tip ( Fig. 3 ). Although the shape of the penis resembles that of P. alpinus , the shape of the baculum is clearly different ( Fig. 4 ). The shape of the baculum resembles that of P. auritus , but is smaller and proportionally wider at the base, 0.80 mm long and 0.71 mm wide. The proximal part is ventrally concave.

According to the skull of the holotype ( Fig. 5 ), P. sardus sp. nov. is different in its C̅M 3 and C̅M 3 lengths from other European Plecotus species, except P. austriacus . The upper canine from P. sardus sp. nov. is as small as in P. auritus ( Table 3 ). Compared to the upper canine and the 2nd upper premolar, the 1st upper premolar is very small.

Distribution

The species is currently known only from the type locality and two additional locations on Sardinia. These three localities are separated by a distance of about 60 km and occur within the most wooded regions of the island. Two localities, including the type locality, are situated in limestone mountain regions of middle-east Sardinia. There are numerous natural caves, included in the ̒National Park of Gennargentu and Orosei Gulf̕, which is relatively close to the sea coast. The third locality is situated at a low elevation above sea level in the central part of the island, where the Tirso River is fed from an artificial lake.

Figures

FIG. 2. Plecotus sardus sp. nov. [note the shape and length of tragus (an individual released after capture)]

FIG. 3. Shape of the penis (dorsal view) from the five European Plecotus spp.

FIG. 4. Dorsal view comparing the bacular shape of: (a) P. sardus sp. nov., (b) P. alpinus (Kiefer and Veith, 2002); (c) P. auritus (Topál, 1958); (d) P. teneriffae (Ibáñez and Fernandez, 1985); (e) P. kolombatovici (Đulić, 1980); (f) P. austriacus christii (Qumsiyeh, 1985); (g) P. austriacus wardi (Strelkov, 1988); and (h) P. austriacus (Topál, 1958). All bacula are redrawn in the same scale

FIG. 5. Cranium (dorsal, ventral, and lateral views) and mandible of the holotype of P. sardus sp. nov.

Tables

TABLE 2. Body measurements of Plecotus sardus sp. nov.

Sar 13 Sar 22 Character ♂̅holotype ♂			Sar 2 ♀	Sar 15 ♀	Sar 20 ♀	Sar 21 ♀	×	SD	n
Forearm length	41.2	41.1	42.3	42.2	42.2	40.9	41.65	0.65	6
Thumb length	6.0	6.0	6.0	6.0	6.4	6.0	6.07	0.16	6
Claw length	3.1	2.0	2.4	2.5	2.5	2.6	2.52	0.35	6
Ear length	37.5	38.0	38.6	39.0	̅	̅	38.28	0.66	4
Tragus length	18.5	18.0	18.0	19.8	18.9	19.2	18.73	0.71	6
Tragus width	6.5	6.2	6.0	6.4	6.5	6.4	6.33	0.20	6
Hind foot length 7.7		7.5	7.0	7.6	6.8	6.7	7.22	0.44	6

TABLE 3. Morphological characteristics of European Plecotus spp. (data from Hȃussler and Braun, 19911; Spitzenberger et al., 20022; Kiefer and Veith, 20023; A. Kiefer and O. von Helversen, unpubl. data4; authors̕ own data5)

Character	auritus	austriacus	kolombatovici	alpinus	sardus sp. nov.
Colour of dorsal fur	brown to reddish4	grey4	brownish4	greyish-brown2	brown5
				pale grey3
Colour of ventral fur	yellowish-brown to creamy3 grey3		whitish4	white3, white-grey2	whitish to pale brown5
Forearm length	35.1̅43.52	33.9̅42.12	36.2̅39.32	39.6̅43.52	40.9̅42.35
	37.5̅39.71	38.4̅42.01		39.7̅42.23
	36.0̅43.54			40̅454
Tragus width	4.5̅5.51, <5.54	5.7̅6.31,>5.54	4.5̅5.04	5.5̅6.03, 4	6.0̅6.55
Tragus length	12.0̅13.71, <15.54	13.5̅16.11, 14̅164	12̅144	16̅194	18.0̅19.85
Ear length	35.0̅38.01	35.0̅39.01	29.7̅34.12	34̅38.32	37.5̅39.05
	26.2̅40.42	28.6̅412
Thumb length	>6.54	<6.54	<6.54	>6.53, 6.5̅7.03	6.0̅6.45
Claw length	>24	<24	<24	>23, 2.0̅2.83	2.0̅3.15
Hind foot length	8.2̅8.91,>94	6.8̅7.91, 7̅84	<84	>8.5̅9.03, 84	6.7̅7.75
C̅M3	5.3̅5.51	5.8̅6.31	5.16̅5.422	5.36̅5.742	5.755
	4.85̅5.612	5.40̅6.292
C̅M3	5.8̅6.01 5.42̅6.002	6.4̅6.71 6.14̅6.832	5.53̅5.832	5.82̅6.162	6.205
Upper canine length	1.43̅1.852	1.93̅2.182	1.61̅1.752	1.77̅1.992	1.505
Size of the protuberances	large (> 2 mm)5	small (<1 mm)5	small (<1 mm)5	medium (ca. 1̅2 mm)5	medium (ca. 1̅2 mm)5
over the eyes					(smaller than in alpinus )
Penis shape	narrowing towards	club̅shaped4	club̅shaped4	almost cylindrical,	almost cylindrical,
	the end4			pointed only at the tip4	pointed only at the tip5
Triangular pad at the chin	no2, 4	no2, 4	no2, 4	yes2, 4	no5