Coptotriche serjaniphaga Remeikis & Stonis

Stonis, Jonas R., Diškus, Arūnas, Remeikis, Andrius, Fernández-Alonso, José L., Baryshnikova, Svetlana V. & Solis, M. Alma, 2021, Documenting trumpet leaf-miner moths (Tischeriidae): new Neotropical Coptotriche and Astrotischeria species, with notes on Sapindaceae as a host-plant family, Zootaxa 5047 (3), pp. 300-320: 301-305

publication ID

https://doi.org/10.11646/zootaxa.5047.3.4

publication LSID

lsid:zoobank.org:pub:65A22984-EBA7-4788-B044-B23BC59939D4

persistent identifier

http://treatment.plazi.org/id/71EE7F8A-D544-41E7-829E-1D75743783E2

taxon LSID

lsid:zoobank.org:act:71EE7F8A-D544-41E7-829E-1D75743783E2

treatment provided by

Plazi

scientific name

Coptotriche serjaniphaga Remeikis & Stonis
status

sp. nov.

Coptotriche serjaniphaga Remeikis & Stonis   , sp. nov.

urn:lsid:zoobank.org:act:71EE7F8A-D544-41E7-829E-1D75743783E2

( Figs. 11–18 View FIGURES 11–18 )

Type material. Holotype: ♂, PERÚ, Dept. Apurímac, Curahuasi , 13°32ꞌ02ꞌꞌS, 72°42ꞌ59ꞌꞌW, ca. 2700 m, mining larva 25.v.2018, leg. Arotaype-Puma ( NRC).  

Diagnosis. Externally, this new species is similar to the Peruvian C. carmencita Stonis & Diškus   described and illustrated in Stonis et al. 2019a: figs. 23, 24, 57–62, 115–120). However, C. serjaniphaga   sp. nov. is a significantly larger moth, 9 mm in wingspan ( C. carmencita   , 5.6–5.8 mm). Coptotriche serjaniphaga   sp. nov. differs in the dark golden ochre forewing, thorax, and frontal tuft ( C. carmencita   is a pale, entirely ochreous yellowish moth). In C. serjaniphaga   , dark scales form two   small, irregular, subapical spots; the tornal spot ( Fig. 15 View FIGURES 11–18 ) is distinctive (in C. carmencita   , forewing is irregularly speckled with dark scales which are especially abundant along the tornal margin of forewing).

The host-plant genus Serjania Mill.   (possibly S. squarrosa Radlk.   ) is distinctive (see Discussion). Additionally, C. serjaniphaga   sp. nov. has been discovered in temperate areas of the Peruvian Andes and C. carmencita   occurs in the subtropical, humid habitats of the Peruvian “selva alta” which seems to be a transitional corridor between the montane regions and tropical lowlands, or the Amazonian selva or “selva baja”.

Male ( Figs. 14, 15 View FIGURES 11–18 ). Forewing length 4.25 mm; wingspan 9.0 mm (n = 1).

Head. Frons yellowish ochre; palpi golden cream; pecten brownish cream; frontal tuft glossy golden cream, laterally golden ochre; collar golden ochre; antenna distinctly longer than one half the length of forewing; flagellum pale grey, golden glossy, with relatively short, very fine, inconspicuous sensilla.

Thorax. Tegula, thorax, and forewing concolorous, glossy, dark golden ochre, sparsely speckled with dark greybrown scales; forewing with two small, irregular, subapical spots; the tornal spot is indistinctive ( Fig. 15 View FIGURES 11–18 ); fringe ochre, with incomplete and inconspicuous fringe line comprised of dark brown scales; forewing underside grey, golden glossy, with weak purple iridescence, without spots or androconia. Hindwing pale grey to grey on upper side and underside, with weak purple iridescence, without androconia; fringe grey, ochre glossy. Legs pale yellow-ochre, dark grey to blackish grey on upper side. Abdomen lost.

Female. Unknown.

DNA barcode. We barcoded hind legs of the holotype. The aligned length of the dataset is 674 bp: AA- CATTATATTTTATTTTTGGTATGTGAGCAGGTATAGTAGGAACATCATTAAGATTATTAATTCGAG- CAGAATTAGGAACTGCAGGATCCTTAATTGGAGATGATCAAATTTATAACACTATTGTTACAGCCCAT- GC TTTTATTATAATTTTTTTTATA G TTAT GCC AATTATAATT GG A GG ATTT GG TAATT G ATTA G TTCCATTAATATTAGGTGCCCCTGATATAGCATTCCCCCGTCTTAATAATATAAGATTTTGATTAT- TACCTCCATCTTTATTACTTTTAATTTCCAGAAGAATTGTAGAAAATGGAGCAGGAACTGGATGAA- CAGTATACCCCCCACTTTCATCAAATATTGCCCATACAGGAAGATCAGTAGATCTTGCTATTTTTTCC CTTCATTTAGCTGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACTACAATAATTAATATAC- GATCACAAGGAATATCATTTGATCAAATACCTTTATTCGTATGAGCAGTTGCAATTACAACAGTAT- TATTATTATTATCTTTACCTGTTTTAGCTGGTGCTATTACAATATTATTAACAGATCGTAATTTAAA- CACATCTTTTTTTGATCCTGCTGGAGGAGGAGACCCTATTTTATATCAACATTTATTTTGATTTTTTGGT- CATC. Sequence is available in GenBank under voucher/sample ID OK017167 View Materials   .

Bionomics ( Figs. 11–13, 16–18 View FIGURES 11–18 ). Host plant is Serjania Mill.   , possibly S. squarrosa Radlk.   ( Sapindaceae   ). Larvae mine leaves in May. The blotch mine ( Figs. 11–13 View FIGURES 11–18 ) is irregular, white at the beginning, cream, transparent, with no or very little frass further along; fully developed mines usually bend (distort) the mined leaf ( Fig. 11 View FIGURES 11–18 ). Pupation inside the leaf mine. Adults fly in June.

Distribution. The species is known from the single locality, Curahuasi, Dept. Apurímac, central Peru, at an elevation of about 2700 m.

Etymology. The species is named after the host-plant genus Serjania   , Sapindaceae   , a novel host-plant taxon for the Tischeriidae   , combined with the Ancient Greek phago (eater, feeder).

Remarks. Unpublished molecular data of mtDNA COI sequences provide strong support for this new species. In our unpublished molecular analysis of Tischeriidae   , C. serjaniphaga   sp. nov. always appeared as a very distinct, separate clade, close but not fully matching with Coptotriche   . A phylogenetic tree will be published separately with a molecular analysis of Tischeriidae   (Stonis et al. in prep.).

NRC

Division of Biological Sciences, National Research Council of Canada

GC

Goucher College