Milnesium tardigradum,

Michalczyk, Łukasz, Wełnicz, Weronika, Frohme, Marcus & Kaczmarek, Łukasz, 2012, Redescriptions of three Milnesium Doyère, 1840 taxa (Tardigrada: Eutardigrada: Milnesiidae), including the nominal species for the genus, Zootaxa 3154, pp. 1-20: 11-15

publication ID

http://doi.org/ 10.5281/zenodo.214356

persistent identifier

http://treatment.plazi.org/id/03A987E9-733D-FFC8-1AB7-7177FBDCE18D

treatment provided by

Plazi

scientific name

Milnesium tardigradum
status

sensu stricto

Milnesium tardigradum  sensu stricto Doyère, 1840

( Figs 12–15View FIGURE 12View FIGURES 13 – 15, Table 3)

Material examined. Neotype, 46 neoparatypes (all females), 2 exuvia with eggs mounted in Hoyer’s medium and eight additional specimens used for molecular analysis ( COI and ITS 2 region sequencing): Zeesen, Wildau, Germany, 52 ° 16 ' 52 ''N and 13 ° 38 ' 23 ''E, 37 m asl, moss and lichen sample from a roof, 11.02. 2011, coll. Marcus Frohme.

Description (measurements in Table 3). Body white/transparent in small individuals and yellowish to brownish in large ones. Eyes were present in 70 % of examined individuals (fixed in Hoyer’s medium). Cuticle smooth, without granulation or pores ( Fig. 12View FIGURE 12). Two lateral and six peribuccal papillae present (ventral papilla smaller than other papillae).

Buccal apparatus of the Milnesium  type ( Fig. 13View FIGURES 13 – 15). Six peribuccal lamellae around the mouth opening present. Buccal tube cylindrical (anterior and posterior diameters similar). Pharyngeal bulb elongated, pear-shaped and without placoids or septulum.

Claws of the Milnesium  type, slender ( Figs 14–15View FIGURES 13 – 15). Primary branches on all legs with small, but distinct accessory points detaching from the branch at its greatest curvature. Secondary branches with rounded basal thickenings. Secondary branches of external claws I –III and posterior claws IV with two points, and secondary branches of internal claws I –III and anterior claws IV with three points (i.e. claw configuration: [2-3]-[3 - 2]). Single, long transversal, cuticular bars under claws I –III present ( Fig. 14View FIGURES 13 – 15).

CHARACTER N RANGE MEAN SD Neotype

µm pt µm pt µm pt µm pt Posterior base + secondary branch 14 16.0 – 10.6 44.9 – 36.2 13.7 40.3 1.5 2.1 10.6 36.2 Eggs are oval, smooth and deposited in exuvium (in the two exuvia we found there were 6 and 8 eggs respectively).

AGATATTGGGATATTATATTTTATTTTTGGTATTTGATGTGCTTTTGGTGGATCAGCCTTAAGTATGTTAATTCGT CTTGAGTTGTCTCAACCTAATACAATACTAATAAGTGAAGATATTTATAATGCGTTTATTACAAGTCATGCATTAG TAATAATTTTTTTTTTTGTTATACCTGTTTTAATTGGGGGCTTTGGAAATTGATTAGTTCCTTTAATAATTAGTTC ACCAGATATAGCTTTTCCACGAGTTAATAATGTCAGATTTTGAATATTGGTTGCTTCATTTATGTTATTAGTGTAT AGAATATTTTGTGGAGAGGGTGTTGGTGCTGGTTGGACTCTTTACCCTCCATTAACTAATATTTATGGCCATAGAA GAACAGCAGTTGATTATGCAATTTTATCATTACACATTGCTGGTGCTTCTTCTATTTTTAGAGCTATGAATTTTTT AACTACAATTTTTAATATACATTATTTTGGAGTTCGTATAGATAAGTTGCCTTTATTTGTTTGGTCAATTTTTATT ACAGCCTTGTTATTAGTGTTAGCTCTTCCGGTATTGGCTGGGGCTATTACTATATTGATTGCAGATCGTAATTTTG ATACTTCCTTTTTTGATCCTGCAGGGGGAGG

AACGAAAATAAACCTGATAGCTACGTGTTTGCTATCGATTGTTTGTCATTCTCTACTGGCCTGCTTCTGTCTTCTC AGAGCAGAGCCAGGTTAAGGCTGACAGATGAAGTTTCGACCCTATGACGAGCGTGCTTCTTGATCTGTAGCAGATC GGAAGCCGACGCGTATCCATACATTTTGTGTACAAAGGACTGTATGATGAAAGTAGGTTGGCGGTCGCTGATGGGC GCTCTATTATCGCTTAGCTAGCAGTGCATGCGGCAGTTTTGCACAGATTGCTAGCGGTGTTTAGAGACGCTTGGCT AACCGAACGACAGTCCATTTTCCTTGTACGCAATCGGTATTGGAGCCATACGCGCTTCGGCTTTGAGTACAGATAT CAGTACGCTGAATTGTCATAGGTTGTAGACTGTATGCGTGCTTAACGCGTTACACACTCATTACGT

Neotype locality. Zeesen, Wildau, Germany, 52 ° 16 ' 53 ''N and 13 ° 38 ' 23 ''E, 37 m asl, moss and lichen from a roof.

Distribution. All previous records of M. tardigradum  will now need to be re-examined; therefore not much can be stated regarding the species geographic distribution. Nevertheless, we can hypothesise that M. tardigradum  s.s. is likely to be found throughout Europe, but it may also have a wider, Palearctic or Holoarctic range. Etymology. Louis Doyère named the genus after a French zoologist, Henri Milne-Edwards. The specific name comes from Spallanzani (1777), who first described specimens of Milnesium  as ‘Tardigrado’.

Type depositories. Neotype and 46 neoparatypes mounted in Hoyer’s medium are preserved at the Department of Animal Taxonomy and Ecology, A. Mickiewicz University, Umultowska 89, 61- 614 Poznań, Poland.

Comparison with the original description. Specimens we designated as a new type series correspond well with the description and drawings in Doyère (1840). The cuticle appears to be smooth, buccal tube cylindrical and the claw configuration is [2-3]-[3 - 2]. Although in Doyère (1840) the claws were drawn without accessory points, we have assumed they were present M. tardigradum  s.s., and have based our assumption on two reasons: (1) Doyère (1840) did not draw accessory points in any of his figures (e.g. all known Ramazzottius  and Macrobiotus  species have accessory points, whereas in Doyère’s drawings of these genera such structures were not shown); (2) only five, of seventeen known Milnesium  species, do not have accessory points and none of these were for European records.

Differential diagnosis. Apart from M. tardigradum  s.s., there are four other described Milnesium  species with the claw configuration [2-3]-[3 - 2]. M. tardigradum  s.s. differs specifically from:

M. krzysztofi  by having smooth dorso-lateral cuticle (reticulated in M. krzysztofi  ).

M. reductum Tumanov, 2006  by the presence of accessory points on the primary branches of claws (accessory points absent in M. reductum  ).

M. reticulatum  by having smooth dorso-lateral cuticle (reticulated and with gibbosities in M. reticulatum  ) and six peribuccal lamellae (four in M. reticulatum  ).

M. tetralamellatum  by having six peribuccal lamellae (four in M. tetralamellatum  ).

In other words, smooth cuticle, the presence of accessory points on the primary branches of all claws, six peribuccal lamellae and cylindrical buccal tube create a unique combination of characters within the group of Milnesium  species with the [2-3]-[3 - 2] claw configuration. Thus, we conclude that it is most unlikely that any synonym species of M. tardigradum  s.s. have been described since Doyère (1840).

TABLE 3. Measurements and pt values of selected morphological structures of fifteen randomly chosen specimens from the neotype population of Milnesium tardigradum s. s. (N = number of specimens or structures measured; RANGE = the smallest and the largest structure found among all specimens measured; SD = standard deviation).

        1609   1078   1314   153    
      35%               35%  
COI

University of Coimbra Botany Department

Kingdom

Animalia

Phylum

Annelida

Class

Polychaeta

Order

Phyllodocida

Family

Aphroditidae

Genus

Milnesium

Loc

Milnesium tardigradum

Michalczyk, Łukasz, Wełnicz, Weronika, Frohme, Marcus & Kaczmarek, Łukasz 2012
2012
Loc

M. reductum

Tumanov 2006
2006