Parapercis pariomaculata, Johnson, Jeffrey W. & White, William T., 2012

Johnson, Jeffrey W. & White, William T., 2012, Parapercis pariomaculata (Perciformes: Pinguipedidae), a new species of sandperch from Lombok and Bali, Indonesia and remarks on the validity of P. quadrispinosa (Weber 1913), Zootaxa 3319, pp. 57-68 : 61-67

Parapercis pariomaculata sp. nov.

New English name: Cheekspot Sandperch Figure 2 , Tables 1–2

Parapercis xanthozona (not of Bleeker 1849) Kuiter & Debelius 1994: 241, upper right fig. (Bali); Allen et al. 2003: 295 (Bali); Kuiter & Tonozuka 2003: 570, pl. A–C (Bali).

Holotype. MZB LM 589, 107.0 mm, Tanjung Luar fish landing site, southeast coast of Lombok, Indonesia, 8°45’S 116°35’E, W. White & Dharmadi, 4 Aug 2010 (genetic sample: CSIRO BW-A 10137, GenBank number: JN312841).

Paratypes. (n = 6) BPBM 20914, 2: 80.1–82.7 mm, Sanur, off Alit's Beach Bungalows, SE side of Bali, Indonesia, reef flat, spear, 0.5m, J.E. Randall, 19 July 1977; BPBM 29875, 108.8 mm, Ampenan fish market, Lombok, Indonesia, J.E. Randall, 6 Feb 1984; CSIRO H 7304-01, 107.2 mm, same data as holotype (genetic sample: CSIRO BW-A 10138, GenBank number: JN312842); CSIRO H 7304-02, 96.5 mm, same data as holotype (genetic sample: CSIRO BW-A 10139, GenBank number: JQ844110 ); QM I. 38952, 104.5 mm, same collection location as holotype, 24 Jan 2011.

Diagnosis. A species of Parapercis with dorsal-fin rays IV, 21; anal-fin rays I, 17; pectoral-fin rays 16–17 (usually 17); lateral-line scales 57–58; gill rakers 6–7 + 10–12 = 16–19; predorsal scales 11–12; scales on cheek cycloid, in 13–14 horizontal rows; 6 canine teeth in outer row at front of lower jaw; vomer with 2–4 rows of robust conical teeth; palatines edentate; angle of subopercle produced, with 4–5 small poorly defined spinules; 10 abdominal and 20 caudal vertebrae; some nape scales weakly ctenoid in males; pelvic fins short of, or reaching just beyond the vent in males; and fresh colouration including ten broad reddish-brown vertical bars on lower body between pectoral and caudal-fin bases, each bar with a black central smudge-like spot, a narrow light reddishbrown stripe interconnecting the series of spots, two small black spots, one above the other, within a triangular reddish-brown blotch traversing the suborbital, a white line across upper lip on each side just posterior to snout tip, posterior tip of maxilla white, caudal fin with irregular white blotching through middle third, several longitudinally-elongate black blotches below the white blotching, two irregular transverse rows of small black spots in distal two-thirds of fin, and about middle third of posterior caudal-fin margin black.

Description. Dorsal-fin rays IV, 21; anal-fin rays I, 17; all dorsal- and anal-fin rays branched, last to base; pectoral-fin rays 17 (16–17, usually 17), upper ray unbranched, others including lowermost branched; pelvic-fin rays I, 5; branched caudal-fin rays 14 (14–15); lateral-line scales 57–58, plus about 4 smaller pored scales on caudal-fin base; scales above lateral line to origin of dorsal fin 6, to base of anterior soft rays of dorsal fin 5 ½; scales below lateral line in a oblique row to origin of anal fin 12 (11–12); circumpeduncular scales 24–25; predorsal scales 11 (11–12), extending just anterior to a vertical from preopercular margin; horizontal row of scales from preorbital across cheek to edge of preopercle about 18, vertical rows below middle of eye 13–14; gill rakers on first arch 6 + 11 = 17 (6–7 + 10–12 = 16–19); branchiostegal rays 6; vertebrae 10 + 20.

Body depth 6.5 (5.95–6.75) in SL; body subcylindrical, greatest width 0.9 (0.9–1.0) in body depth; head length 3.15 (3.15–3.3) in SL; snout pointed, its length 3.35 (3.1–3.35) in HL; orbital diameter 4.1 (4.15–4.6) in HL; eyes directed more laterally than dorsally, bony interorbital space narrow, 11.05 (10.2–12.25) in HL; caudal-peduncle depth 3.5 (3.4–3.55) in HL; caudal-peduncle length 4.05 (3.9–3.95) in HL.

Mouth oblique, lower jaw protruding, with curved canine teeth at front of lower jaw slightly projecting and barely visible when mouth is closed; upper jaw extending to a vertical from anterior margin of pupil, upper-jaw length 3.15 (2.85–3.2) in HL; upper jaw with 23–25 (20–25) outer curved canines on each side, first 8 or 9 clearly the largest, of these seventh (seventh or eighth) the largest, those following gradually reducing in size posteriorly, broad inner band of villiform teeth anteriorly, narrowing gradually to form only two rows at rear of jaw; front of lower jaw on each side with 3 enlarged curved canines in distinctly separate outer row, tooth nearest symphysis smallest, the others gradually increasing in size laterally, last in the series largest, broad inner band of villiform teeth extending posteriorly from symphysis to side of jaw just posterior to largest tooth in outer row, next 6 (6–7) teeth in single row, the first 3 (3–4) small, next 3 teeth strongly curved and abruptly increasing in size, then followed by single row of 11 (11–12) smaller slightly curved conical teeth. Vomer with up to 3 (2–4, usually 3) irregular crescentic rows of up to 13 (13–15) robust conical teeth anteriorly, medial teeth largest, second posterior row shorter, comprised of slightly smaller teeth, third row comprised of smaller scattered teeth; palatines edentate. Tongue spatulate with broadly rounded tip.

Gill membranes united with broad free fold, not attached to isthmus. Gill rakers short, the longest about 3–4 times in length of longest gill filament on first gill arch. Anterior nostril small, inconspicuous, situated anterior to mid-eye, slightly less than half distance from anterior margin of eye to snout tip, with membranous posterior flap, the latter folded around base to form partial tube, flap usually lying flat against snout in preserved specimens. Posterior nostril slightly more than half distance from anterior margin of eye to anterior nostril, dorsoposterior to, and about same width as anterior nostril, its opening simple, oval-shaped; internarial distance about 2.5 times width of posterior nostril.

Opercle with distinctly exposed, robust, pointed spine, angle of subopercle expanded and armed with 4–5 small poorly defined spinules; preopercle and remainder of subopercle entire, the margins naked and broadly rounded.

Lateral line continuous, ascending smoothly from opercle to below second or third soft dorsal-fin ray, then approximately following contour of back; scales ctenoid, except for those on most of cheeks (a few ctenoid scales present on cheeks near posterior margin of preopercle), breast and midline of belly, those on middle of sides with about 40 cteni; some scales on nape ctenoid, but cteni much reduced, scales anteriorly on the dorsal midline usually cycloid (smaller specimens with cycloid scales on nape); scales on cheek extending forward approximately to a line from maxilla below anterior margin of orbit to just behind posteroventral margin of orbit; no scales on dorsal, anal or pelvic fins; 3 or 4 rows of small feebly ctenoid scales on base of pectoral-fin rays; elongate ctenoid scales densely arranged on proximal two-thirds of caudal fin.

Origin of dorsal fin just posterior to a vertical from tip of opercular flap, the predorsal length 3.0 (2.9–3.0) in SL; first 3 dorsal-fin spines progressively longer, the first 6.65 (6.5–9.0) in HL; third dorsal-fin spine longest, 4.45 (4.5–5.1) in HL; fourth dorsal-fin spine shortest, 8.9 (9.05–9.45) in HL; membrane from fourth spine to first soft ray not notched, attached at tip of fourth dorsal-fin spine; 3rd to 15th dorsal-fin soft rays about equal in length, the longest ray 2.5 (2.45–2.6) in HL; origin of anal fin below base of 5th soft dorsal-fin ray, preanal length 1.9 (1.95– 2.0) in SL; anal-fin spine slender, closely attached to first soft ray, 6.25 (6.1–7.2) in HL; longest soft anal-fin ray usually the 7th, 2.65 (2.55–2.75) in HL; caudal fin truncate to slightly rounded, length 5.1 (5.15–5.6) in SL; pectoral fins rounded, 9th or 10th ray usually longest, 4.95 (4.7–5.3) in SL, shorter than pelvic fins; origin of pelvic fins in advance of upper base of pectoral fins and approximately on a vertical from upper corner of operculum, prepelvic length 3.5 (3.5–3.9) in SL; pelvic-fin spine closely attached to first soft ray, its termination fleshy and difficult to accurately determine; fourth soft pelvic-fin ray longest, reaching vent (just anterior to vent in largest paratype, to anal-fin origin in smallest paratype), 4.5 (4.4–4.85) in SL.

Colour when fresh. Upper half of body in holotype ( Fig. 2 A) pale grey, mottled profusely with tan, numerous scales with dark brown edges. A series of 10 faint brown blotches longitudinally above lateral line, interconnected by slightly curved whitish chevrons. A broad light reddish-brown stripe from upper pectoral-fin base to straight part of lateral line, extending to caudal-fin base. Lower body between pectoral-fin base and caudal peduncle with a series of 10 broad dark reddish-brown bars, each tenuously connected with the series of faint blotches above. Each bar includes a distinct black smudge-like spot at its centre, on a horizontal from just below pectoral-fin tip. A dark reddish-brown longitudinal stripe interconnecting the series of 10 spots extends from lower edge of pectoral-fin base to caudal-fin base, midway between lateral line and lower edge of caudal peduncle. Belly creamy white. Head dull purple-grey from upper lip, snout, preorbital, interorbital and naked occipital region. Dorsal part of snout, interorbital, occiput, upper preopercle and opercle scattered with numerous small to medium-sized dark reddishbrown spots. A white line traversing upper lip on each side just posterior to tip of snout, rear of maxilla white. A thin white line from lower margin of eye angled slightly forward diagonally to white rear portion of maxilla. Posteroventral edge of orbit narrowly lined in dark brown, containing a small oval-shaped black spot near its lower terminus. Two small black spots within a triangular red-brown blotch that fully traverses the suborbital, upper spot just below centre of eye, lower situated posteroventrally below posterior margin of pupil and behind posterior tip of maxilla. Spinous dorsal fin membrane black, except for small whitish areas distally between second and third dorsal spines and proximally between third and fourth spines. Soft dorsal fin with 3 equidistant longitudinal rows of black spots, spots in proximal row largest, at anterior base of each ray, spots in middle row situated at midheight of fin, in centre of each membrane, spots in submarginal distal row smallest, remainder of dorsal-fin membrane translucent yellowish. Anal fin with a single row of black spots, starting in membrane between third and fourth rays, the row at two-thirds height of fin, fin rays containing spots also with faint dark tips, remaining membrane reddish, particularly in distal half of fin. Caudal fin with scattered diffuse brown spots in upper and lower thirds of the fin, irregular white blotching through middle third of fin, several longitudinally-elongate black blotches basally and centrally below the white blotching, two irregular transverse rows of small black spots in distal two-thirds of fin, membrane of lower 3 or 4 rays uniformly reddish brown, and about middle third of posterior caudal-fin margin black. Pectoral fins faintly reddish to translucent. Pelvic fins mostly faintly reddish, with a broad white marginal band distally and with distal third of membrane between inner two rays dusky. Some paratypes differ by having translucent pectoral fins (versus faintly reddish in holotype), pelvic fins uniformly white (versus reddish, with dusky membrane between several inner rays of distal third in holotype), and a row of diffuse vertically-elongate brown spots in membranes along the base of the anal fin (versus absent in holotype).

Colour in alcohol. Holotype ( Fig. 2 C) and paratypes with upper half of body profusely mottled light brown on a pale background, numerous scales with darker edges. Lower body between pectoral fin base and caudal peduncle with a series of 10 broad dusky bars, each containing a distinct black smudge-like spot at its centre. A faint brown longitudinal stripe interconnecting the series of 10 spots extends from lower edge of pectoral-fin base to caudal-fin base, midway between lateral line and lower edge of caudal peduncle. Belly pale cream. Head dark grey from upper lip, snout, preorbital, interorbital and naked occipital region. Dorsal part of snout, interorbital, occiput, upper preopercle and opercle scattered with numerous small to medium-sized dark brown spots. A pale line traversing upper lip on each side just posterior to tip of snout, rear of maxilla white. A faint pale line from lower margin of eye angled slightly forward diagonally to white rear portion of maxilla. Posteroventral edge of orbit lined in dark brown. Two small black spots on suborbital, uppermost just below centre of eye, lower situated posteroventrally below posterior margin of pupil and behind posterior tip of maxilla. Tongue white. Peritoneum pale. Spinous dorsal fin membrane dusky, except for small pale area near base of fourth spine. Soft dorsal fin with 3 equidistant longitudinal rows of black spots, spots in proximal row largest, at anterior base of each ray, spots in middle row at midheight of fin in centre of each membrane, spots in submarginal distal row smallest. Anal fin with a single row of black spots, starting in membrane between third and fourth rays and continuing at two-thirds height of fin, fin rays containing spots with faint dark tips. Caudal fin with scattered diffuse dusky or brown spots in upper and lower thirds of fin, irregular white blotching through middle third of fin, several longitudinally-elongate black blotches basally and centrally below the white blotching, two irregular transverse rows of small black spots in distal twothirds of fin, membrane of lower 3 or 4 rays uniformly grey, about middle third of posterior caudal-fin margin black. Pectoral fins faintly dusky. Pelvic fins pale with distal third of membrane of inner rays slightly dusky.

Etymology. From the Greek pario for cheek and Latin maculata for spotted, in reference to the two small but distinctive black spots on the cheek.

Distribution. Known from reef and rubble bottom off the southeast and northeast coasts of Bali (Sanur, Padang Bai and Tulamben) and coast of Lombok (Tanjung Luar), Indonesia, in depths of 0.5 to 15 m.

CO1 sequence. Holotype:

GTTTTTGGTGCTTGACCCGCTATAGTAGGAACAGCTTTAAGCCTTCTTATTCGAGCAGAACTAAGT CAACCAGGTGCTCTTCTAGGAGACGACCAAATTTATAATGTTATCGTTACAGCCCATGCCTTCGTAATA ATTTTCTTTATAGTAATGCCTATTATAATCGGGGGCTTCGGTAACTGATTAGTCCCTCTGATAATTGGAGC TCCGGACATAGCATTCCCCCGTATAAACAATATAAGCTTTTGACTTCTCCCTCCTTCCCTCCTTCTTCTC TTAGCCTCTTCCGCAGTAGAGGCCGGAGCCGGAACTGGATGAACCGTGTATCCCCCTCTAGCCGGAA ACCTAGCTCACGCAGGGGCATCAGTAGACTTAACCATTTTCTCCCTGCATTTAGCTGGCATTTCATCTA TTTTAGGGGCCATCAACTTCATCACAACTATTCTTAATATGAAACCTCCAGCAGTCACCCAATATCAGA CCCCTCTCTTTGTCTGAGCCGTTCTAATCACTGCTGTCCTCCTCCTCCTCTCCCTCCCCGTCCTAGCCG CAGGAATTACAATGCTCTTAACAGATCGAAATCTAAATACAACTTTCTTCGATCCAGCAGGAGGAGGA GACCCCATCCTTTATCAACACCTA (642 bp).

Discussion Parapercis pariomaculata is most similar to P. clathrata ( Fig. 3 ), sharing similar morphology, meristic formulae, and general colouration, including 10 reddish-brown vertical bars with black centres on lower sides. It differs mainly through several features of the colouration, including two small but distinct dark brown to black spots on the suborbital (several much larger diffuse dark brown spots and blotches in P. clathrata ), the lack of an ocellated black spot above the gill opening in males, or smaller non-ocellated black spot in the same position in females (versus present in P. clathrata ), and arrangement of black and white blotching and pigmentation on posterior margin of the caudal fin (white blotched area through middle of fin poorly defined, solid black blotches mostly restricted to lower third of fin, and middle third of posterior margin of fin broadly edged in black, versus white blotch through middle of fin relatively well defined, solid black blotches extending from base of caudal fin posteriorly along both upper and lower edges of central white area, sometimes also transversely across middle of fin, and posterior margin of fin not broadly edged with black pigment in P. clathrata ). It also differs slightly in the number of vomerine teeth rows (2–4 (usually 3, rarely 2) rows versus 3–5 (usually 4, rarely 5) rows in P. clathrata ) and in the lateral-line scale count (modally 57 in type series versus 58 in P. clathrata ( Table 2)). Among other species from southeast Asia and northern Australia with four dorsal-fin spines, P. millepunctata (Günther) has a lower modal gill raker count (total gill rakers 13–17, modally 15 versus 16–19, modally 17 in P. pariomaculata ( Table 2)), a more regularly blotched colouration on the body, including a network of roughly hexagonal and inverted ushaped white markings, connecting below with upper margins of the dark vertical bars on the lower body, and the caudal fin has a large central black blotch covering the proximal half to two-thirds of the fin, followed by a distinct white blotch centroposteriorly (versus markings on body and caudal fin as described above in P. pariomaculata ).

Parapercis pariomaculata is also clearly separated by DNA barcoding, being 12.8 and 13.3% divergent from its most closely related congeners, P. clathrata and P. xanthozona , respectively using the CO1 marker (www.boldsystems.org).

Comparative materials: Parapercis clathrata (34: 34–154 mm) AMS B. 8059, 136.5 mm, Moluccas, Ambon, Indonesia, F. Day, 1865; AMS I.20385-008, 5: 34–133 mm, Flying Fish Cove, Christmas Island, 10º30’S 105º40’E, rotenone, G. Allen & R. Steene, 1 June 1978; AMS I.21914-026, 87 mm, Caban Is., Philippines, 13º35’N 120º50’E, rotenone, D. Hoese, E. Murdy, C. Ferraris, 1 June 1978; AMS I.22582-018, 116 mm, Escape Reef North, Qld, Australia, 15º49’S 145º50’E, 14–17 m, rotenone, AMS-WAM party, 29 Oct 1981; AMS I.30465-050, 3: 94– 129 mm, Holmes Reef West, lee side, Qld, Australia; 16º30’30”S 149º30’E, 3–10 m, rotenone, J.M. Leis, T. Trnski & party, 13 Jan 1990; AMS I.39023-036, 4: 35–104 mm, Santa Cruz Is., Duff Is. Taumako Is., offshore shoal W of Tahua, Solomon Islands, 9º54’S 167º11’E, 10–15 m, rotenone, AMS Team, 22 Sept 1998; AMS I.39283-001, 128 mm, “Logans Barge” reef front off Agat, Guam, spear, J. Shepard, 28 Oct 1977; AMS I.40134-009, 130 mm, Mindoro Is., 5 km W of Del Monte Point, Philippines, 13º30’54”N 120º21’52”E, spear, MIN Team, 25 May 2000; AMS I.40161-053, 92 mm, Mindoro Is., Philippines, 13º10’40”N 120º35’12”E, 30 m, rotenone, MIN Team, 3 June 2000; BPBM 8134, 4: 81.5–110 mm, Enewetak Atoll, E side, channel to lagoon, Marshall Islands, 1.2–9.1 m, rotenone, J.E. Randall, 2 Dec 1967; BPBM 9567, 3: 74.5–126.6 mm, Ngemelachel Is., patch reef at W entrance to Malakal Harbour, Palau Islands, 1.2–1.8 m, rotenone, A.R. Emery, 21 Apr. 1970; BPBM 18766, 2: 59–116, Negombo, Sri Lanka, reef & adjacent sand & rubble, 8 m, spear, J.E. Randall, 30 Mar 1975; BPBM 22873, 150.5 mm, E side Ko Pu, Thailand, rubble bottom, 16 m, spear, J.E. Randall, 17 Feb 1979; BPBM 23279, 118 mm, N side of island off San-Shien-Tai, N of Cheng Kung, E coast of Taiwan, 17 m, rotenone, J.E. Randall, 13 July 1978; CSIRO H 7304-03, 126 mm, Tanjung Luar fish landing site, southeast coast of Lombok, Indonesia, 8°45’S 116°35’E, W. White & Dharmadi, 4 Aug 2010 (genetic sample: CSIRO BW-A 10135, GenBank number: JQ844109 ); NTM S.15418-003, 108.3 mm, Tahulandang, Sangir Is., Indonesia, 2º21.4’N 125º21.38’E, 3–13 m, B. Russell, 26 Apr 2001; QM I. 10231, 154 mm, Warroora Station, near Carnarvon, Western Australia, 23º29’S 113º48’E, spear, N. Coleman, 7 July 1972; QM I. 31131, 129 mm, NW side Fairfax Island, Qld, Australia, 23º52’S 152º22’E, 8 m, handline, J. Johnson, 23 Feb 1998; QM I. 38536, 131 mm, Nan-Fang-au, Yilan, NE Taiwan, H. Ho, 6 July 2007.

Parapercis millepunctata (19: 38–129 mm) AMS I.17068-005, 8: 38–127 mm, Madang Harbour, S edge of Massas Is., Papua New Guinea, 5º10’S 145º51’E, 2 m, rotenone, B. Collette & party, 2 June 1970; AMS I.17490- 0 56, 3: 69–122 mm, Savo Is., SW corner, Solomon Islands; 9º09’S 159º48’E, 1 m, spear, J.E. Randall, 18 July 1973; AMS 21647-003, 5: 62–129 mm, Moorea, 100 m E of Irioa Is., French Polynesia, 17ºS 149ºW, 1 m, rotenone, B. Goldman & R. Galzin, 21 June 1976; AMS I.28950-006, 2: 91–105 mm, Moorea, 300–400 m E of Tareu Pass into Opunohu Bay, reef slope, French Polynesia, 17º29’06”S 149º51’18”W, 8–12 m, rotenone, T. Trnski, A. Lefevre & R. Galzin, 22 Feb 1989; NTM S.13401-028, 105.5 mm, Cartier Reef, Timor Sea, 12º32.25’S 123º31.8’E, 9–11 m, B. Russell, 4 May 1992.

Parapercis xanthozona (5: 75–139 mm) CSIRO H 7305-03, 109 mm, Tanjung Luar fish landing site, southeast coast of Lombok, Indonesia, 8°45’S 116°35’E, W. White & Dharmadi, 23 Jan 2011 (genetic sample: CSIRO BW- A11421, GenBank number: JQ844111 ); CSIRO CA 3607, 82 mm, E of Monte Bello Is., Western Australia, 20º31’S 116º05’E, 30 m, trawl, CSIRO, 22 Jan 1983; NMNZ P.29458, 78 mm, Sache Croissant Reef, Noumea, New Caledonia; NMNZ P.29583, 75 mm, Sache Croissant Reef, Noumea, New Caledonia; NTM S.11332-006, 139 mm, Batu Nampar, Lombok, Indonesia, 8º51’S 116º 24’E, B. Russell, 7 Aug 1984; QM I. 38818, 125 mm, Off N side of Holbourne Is., Qld, Australia, 19º43’ 30”S 148º21’06’E, 25 m, handline, J. Johnson, 21 Sept 2010 (genetic sample: CSIRO BW-A 11735, GenBank number: JQ844112 ).

Figures

FIGURE 2. Type specimens of Parapercis pariomaculata. A. Holotype, MZB LM 589, 107 mm SL, male (fresh), B. Paratype, BPBM 20914, 80 mm SL, female, (fresh) (Photo: J. E. Randall), C. Holotype, MZB LM 589, 107 mm SL, male (preserved) (Photo: P. Waddington).

FIGURE 3. Parapercis clathrata. A. CSIRO H 7304 - 03, 126 mm SL, male, southeast coast of Lombok, Indonesia (fresh), B. BPBM 18766, 119 mm SL, male, Negombo, Sri Lanka (fresh) (Photo: J. E. Randall).