Emesis (Emesis) bartica, Grishin, 2024

Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V., 2024, Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae), Insecta Mundi 2024 (82), pp. 1-48 : 7-8

Emesis (Emesis) bartica Grishin, new species

http://zoobank.org/ 5C122118-275F-4682-A81C-F499174B98C3

( Fig. 1 part, 13–14)

Definition and diagnosis. Genomic analysis of Emesis [Fabricius], 1807 reveals that a specimen from Guyana ( Fig. 1 aquamarine) is genetically differentiated from its sister Emesis (Emesis) aerigera ( Stichel, 1910) (type locality in Brazil: Sao Paulo, syntype sequenced as NVG-18054D07) ( Fig. 1 brown) at the species level, e.g., their COI barcodes differ by 4.0% (26 bp). Therefore, this specimen represents a new species. This new species is phenotypically similar to E. aerigera and differs from it by narrower metallic bands with less interconnected and aligned spots, a metallic postdiscal spot in the forewing cell M 1 -M 2 being stronger offset basad from the band, and forewings with slightly less hooked apex. In addition to the holotype of the new species ( Fig. 13–14 ), we also illustrate a syntype, a male, of E. aerigera (NVG-18054D07 Brazil: Sao Paulo, Casa Branca, 1890, Garbe leg. [MFNB]) ( Fig. 11–12 ). Furthermore, see iNaturalist observation 160938035 of E. aerigera female from Brazil: Santa Catarina for comparison (iNaturalist 2024). Due to unexplored phenotypic variation in this species and males still unknown, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne 2800.4.2:T142A, cne6221.18.5:T129C, cne6221.18.5:A144G, cne15953.4.2:T15A, cne15953.4.2:A51G, cne 2337.3.4:A45A (not T), cne 2337.3.4:T48T (not C), cne7747.1.14:C116C (not G), cne7747.1.14:C120C (not G), cne4614.6.1:C264C (not T), and COI barcode: T49T, T103C, A238A, T373C, T442C, T553C.

Barcode sequence of the holotype. Sample NVG-18048H03, GenBank PQ203546, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCTGGTATAGTAGGTACATCTTTAAGTTTATTAATTCGTATAGAATTAGGAACTTCTG

ATAATTGGAGGATTTGGTAATTGGTTAGTTCCTCTTATATTAGGAGCCCCTGATATAGCATTCCCACGTATAAATAATATAAGAT TTTGATTATTACCCCCATCCTTATTTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCC CCCACTTTCATCTAATATTGCTCATGGAGGCTCTTCAGTAGATTTAGCTATTTTTTCTTTACATTTAGCAGGTATTTCTTCTATT TTAGGAGCAATTAACTTTATTACAACTATTATTAATATACGAATTAATAATATATCTTTTGATCAAATACCTTTATTTGTTTGAT CTGTAGGAATTACTGCTCTTTTATTATTACTATCTCTTCCCGTATTAGCAGGAGCTATTACTATATTATTAACAGATCGTAATTT AAATACATCTTTTTTTGACCCAGCAGGTGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♀ deposited in the National Museum of Natural History , Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 13–14 , bears the following four printed rectangular labels, three white: [Bartica | Bartica District | British Guiana], [DNA sample ID: | NVG-18048H03 | c/o Nick V. Grishin ], [USNMENT | {QR Code} | 01466572], and one red [HOLOTYPE ♀ | Emesis (Emesis) | bartica Grishin]. The holotype lacks its abdomen.

Type locality. Guyana: Cuyuni-Mazaruni Region, Bartica.

Etymology. The name is given for the type locality and is a feminine noun in apposition. Furthermore, the name Bartica comes from an Amerindian word, possibly Arawakan or Cariban, that means “red earth,” and seems suitable for this reddish-colored species.

Distribution. Currently known only from the holotype collected in Guyana.

Emesis (Emesis) nobilata Stichel, 1910 is a species distinct from Emesis (Emesis) fatimella Westwood, 1851

Genomic analysis reveals that Emesis fatima nobilata Stichel, 1910 (type locality in Costa Rica, syntype sequenced as NVG-18052D01) currently regarded as a subspecies of Emesis (Emesis) fatimella Westwood, 1851 (type locality in Suriname and Brazil: Amazonas) ( Callaghan and Lamas 2004) is genetically differentiated from it at the species level ( Fig. 1 ), e.g., their COI barcodes differ by 2.9% (19 bp). In the presence of recognizable phenotypic differences—males of E. fatimella nobilata have darker ground color and larger, more diffuse spotting compared to the nominate subspecies—we propose to treat Emesis (Emesis) nobilata Stichel, 1910 , new status, as a species-level taxon.

Figures

Figure 1. Phylogenetic trees of Emesis (Emesis) species inferred from protein-coding regions in a) the nuclear genome (autosomes), based on 4,040,316 positions, b) the Z chromosome, based on 247,785 positions, and c) the mitochondrial genome: E. cereus (purple), E. cronina stat. rest. (green), E. aerunda sp. n. (orange), E. orichalceus (olive), E. bartica sp. n. (aquamarine), E. aerigera (brown), E. nobilata stat. nov. (cyan), E. panamella sp. n. (magenta), E. fatimella (blue), and E. fatimellina sp. n. (red). Ultrafast bootstrap (Minh et al. 2013) values are shown at nodes. For each specimen, the name adopted in this work is given first, and a comment about the previous taxonomic placement (if different) is shown in square brackets, supplemented with the DNA Sample number, type status (see Materials and Methods for abbreviations), general locality, and year of collection. See Table S1 in the supplemental file (Zhang et al. 2024a) or NCBI database entries for additional data about these specimens. Synonyms are given in parentheses preceded by “=”. The type status refers to this synonym if the synonym name is provided. The same notations are used throughout this work in other figures showing phylogenetic trees.

Figures 7–26. Holotypes (unless indicated) of Emesis (Emesis) and Emesis (Mandania), data in text. In Fig. 7–80, dorsal and ventral sides are denoted by odd and even numbers, respectively (except 42 and 44, which are dorsal); type status and sex are shown in each view, F indicates flipped image (left-right inverted). 7–8) E. (E.) aerunda sp. n. 9–10) E. (E.) orichalceus non-type specimen NVG-18045D03. 11–12) E. (E.) aerigera syntype NVG-18054D07. 13–14) E. (E.) bartica sp. n. 15–16) E. (E.) fatimellina sp. n. 17–18) E. (E.) panamella sp. n. 19–22) E. (M.) russula sudesta ssp. n.: 21–22) Paratype NVG-18045H11. 23–24) E. (M.) mandora sp. n. 25–26) E. (M.) manduza sp. n.