Terebellides atlantis Williams, 1984

Barroso, Maria, Moreira, Juan, Capa, Maria, Nygren, Arne & Parapar, Julio, 2022, A further step towards the characterisation of Terebellides (Annelida, Trichobranchidae) diversity in the Northeast Atlantic, with the description of a new species, ZooKeys 1132, pp. 85-126 : 85

publication ID	https://dx.doi.org/10.3897/zookeys.1132.91244
publication LSID	lsid:zoobank.org:pub:4168C32E-37A7-4912-A909-4912E69030AA
persistent identifier	https://treatment.plazi.org/id/03F3107D-0D36-5CBF-8734-7954AD5ED893
treatment provided by	ZooKeys by Pensoft
scientific name	Terebellides atlantis Williams, 1984
status

Treatment

Figs 3C View Figure 3 , 8 View Figure 8 , 9 View Figure 9 , 10C View Figure 10 , 11 View Figure 11 , 12 View Figure 12

Terebellides atlantis Williams, 1984: 121-123, fig. 4, table 1.

Terebellides atlantis Species 16 - Nygren et al. 2018: 18-22, figs 6, 10.

Material examined.

15 specimens (Suppl. material 1), Barents Sea (ZMBN116454, ZMBN116455, ZMBN116458, ZMBN116459, ZMBN116460, ZMBN116462, ZMBN116463, ZMBN116465, ZMBN116467, ZMBN116468, ZMBN116470, ZMBN116471, ZMBN116472, ZMBN116474); Norwegian coast (ZMBN116476).

GenBank accession numbers of material examined (COI).

MG025258, MG025259, MG025260, MG025261, MG025262, MG025263, MG025264, MG025265, MG025266, MG025267, MG025268, MG025269, MG025270, MG025271, MG025272, MG025273, MG025274, MG025275, MG025276, MG025277, MG025278, MG025279, MG025280, MG025281, MG025282, MG025283, MG025284, MG025285, MG025286, MG025287, MG025288, MG025289, MG025290, MG025291, MG025292, MG025293, MG025294, MG025295, MG025296, MG025297, MG025298, MG025299, MG025300, MG025301, MG025302, MG025303, MG025304, MG025305, MG025306, MG025307, MG025308, MG025309, MG025310, MG025311, MG025312 .

Diagnostic features of studied material.

Complete individuals ranging from 10.0-16.0 mm in length (Fig. 9 View Figure 9 ). Branchial dorsal lobes lamellae provided with well-developed papillary projections and branchial ventral lobes (Fig. 8A, B View Figure 8 ) provided with long filaments (sometimes broken), 175.0 µm in length. Between 10-11 lamellae on dorsal lobes. Lateral lappets present on TC 1-4; dorsal projection of thoracic notopodia on TC 2-4 (Fig. 8A View Figure 8 ). Geniculate chaetae in TC 5, acutely bent, with well-defined capitium (Fig. 8C View Figure 8 ). Ciliated papilla dorsal to thoracic notopodia not observed. From TC 7, neuropodia with one row of type 3 thoracic uncini per torus, with rostrum/capitium length ratio of ~ 2:1 and capitium with a first row of three or four medium-sized teeth, followed by several smaller teeth (Fig. 8D View Figure 8 ). Abdomen with 23-28 pairs of neuropodia with type 2 uncini (Fig. 8E, F View Figure 8 ).

Colour pattern.

MG staining pattern characterised by compact green colourant in SG 1-6, J-shaped glandular region in SG 3-5 and striped pattern in SG 7-14 (Fig. 12 View Figure 12 ). Similar to pattern 9.

Nucleotide diagnostic features.

All sequences of Terebellides atlantis share and are distinguished from other available Terebellides sequences in unique combinations of nucleotides (underlined) at the given position of our alignment: 60-84: TATTCGTATTGAGCTAGGGCAACCT, 132-150: ACATGCATTTTTAATAATC, 171-189: TTTTATTGGTGGATTTGGT, 213-231: GGGAGCTCCTGATATAGCC, 264-294: ACTACCACCAGCCTTAATCTTATTAGTAAGC, 345-363: ATTATCTGATAATATGGCT, 384-399: CCTTGCTATTTTTTCA, 477-484: GCTACGAC, 549-573: TCCAGTCTTAGCTGGTGCAATCACT, 558-591: CCGT, 615-630: TCCAGCTGGTGGTGGT.

Type locality.

Atlantic Ocean, off New England, 39°56.5'N, 70°39.9'W ( Williams 1984).

Distribution and bathymetry.

Barents Sea, Greenland Sea, South Iceland, Norwegian coast and shelf; 219-2750 m deep (Figs 10C View Figure 10 , 11 View Figure 11 , Suppl. material 1).

Remarks.

Terebellides atlantis is a small species, reaching up to 16 mm in length. It is characterised by the lack of papillae on margins of branchial lamellae, and by having branchiae of type 3 and filaments in ventral branchial lobes, thoracic uncini of type 3 and abdominal uncini of type 2 (Table 1 View Table 1 ). The most similar species to T. atlantis are T. shetlandica and T. lavesquei sp. nov. but T. atlantis differs from the latter in the size and type of branchiae (see remarks for T. lavesquei sp. nov. above). Branchial lobes are often missing as previously highlighted by Parapar et al. (2011). Finally, T. atlantis has the widest geographical distribution and depth range (219 to 2750 m) among Group B species.