Megaselia winnizona, Brown & Hartop & Wong, 2022
publication ID |
https://doi.org/ 10.1093/isd/ixac008 |
persistent identifier |
https://treatment.plazi.org/id/08253846-FF96-BC1F-FF33-334CFD5274F7 |
treatment provided by |
Felipe |
scientific name |
Megaselia winnizona |
status |
sp. nov. |
Megaselia winnizona View in CoL New Species Fig. 30 View Figs .
urn:lsid:zoobank.org:act:FE0F6E2B-EF88-48C6-8AF4-10C4563F3CCD
Holotype. Male. COSTA RICA: Guanacaste: Pailas II, PL12- 3 , 10.7631°N, 85.3344W °, 820 m, 18.ix.2014, leg. D. Janzen, W.Hallwachs, Malaise trap PL12-3 [ LACM ENT 366292 About LACM ] ( BIOUG30118 View Materials -A06) ( LACM). GoogleMaps
Holotype Barcode ACATTATATTTTATTTTTGGAGCATGAGC TGGAATAGTAGGAACTTCTCTAAGAATCCTAATTCGAGCT GAATTAGGACACCCAGGAGCTTTAATCGGAGATGATCAAA TCTATAACGTAATTGTAACTGCCCATGCATTTATTATAATTT TTTTTATAGTTATACCTATCATAATAGGAGGATTTGGAAATT GATTAGTTCCTTTAATATTGGGAGCTCCTGATATAGCTTTT CCTCGTATAAATAATATAAGATTTTGAATACTTCCTCCTTC ATTAACCTTACTGTTAGCAAGCAGAATAGTAGAAAATGGA GCTGGGACAGGGTGAACTGTATACCCTCCTTTATCCTCTA GAATTGCTCATAGAGGTTCATCTGTAGATCTTGCAATTTTT TCTCTCCATTTAGCAGGAATCTCTTCAATTTTAGGAGCAGT AAATTTTATTACTACAATTATTAATATACGTTCTTCAGGAAT CACTTTTGACCGAATACCTTTATTTGTTTGATCAGTAGGGA
TTACTGCCTTACTTTTGCTTCTTTCTTTACCTGTATTAGCA GGA---------------------------------------------------------------------
Other Specimens. Sixteen further specimens from the Pailas II traps, mostly from Malaise trap PL12-3.
300058-A11, 300083-E09, 300032-A07
Diagnosis. The barcode of this species is most similar to that of M. paulizona from Colombia, from which it differs by 7.35% minimum p-distance. The wings of the two species are similar ( Fig. 17 View Figs , Table 3), but the forecoxa of M. winnizona is yellowish- brown, unlike the dark brown forecoxa of M. paulizona . One further difference of M. winnizona from other species in the complex, including M. paulizona , is that the ventral setae of the abdomen are noticeably coarser and have darkened sockets.
This species is in BOLD as BOLD:ADB8601.
Distribution. Costa Rica.
Etymology. Named for Winnie Hallwacks, a tropical biologist working in Costa Rica.
Other Megaselia sulphurizona -group specimens. The following specimens exist in the pinned collections of the LACM and USNM. When technology allows us to reliably sequence older material, they should be barcoded to extend our knowledge of the distribution and phenology of the Megaselia sulphurizona group. Especially interesting in this regard would be the specimen from Tamaulipas, Mexico, which is outside the range of any of the species discussed in this paper. We also have seen (in Malaise trap samples) specimens of white-belted Megaselia from Bolivia.
MEXICO: Tamaulipas: Co., Estación Los Cedros, Gómez Farías, 23.05°N, – 99.15°W, 340 m, 1 male, iii.2002, Malaise trap, A.Cordoba- Torres (LACM), USA: California: Los Angeles Co., Charmlee Park, 34.05°N, – 118.88°W, 396 m, 2 male, 6–13.vii.1996, Malaise trap, B.V.Brown (LACM), Monrovia, 34.16°N, – 118°W, 213 m, 1 male, 3–5.x.2002, Malaise trap, suburban backyard, B.Brown (LACM), 1 male, 21.vi.2002, Malaise trap, B.V.Brown (LACM), 1 male, 18–20. xii.2004, Malaise trap, B.Brown (LACM), Monrovia, Wallace Residence, 34.16°N, – 118°W, 523 m, 2 male, 19–26.i.2019, Malaise trap, B.V.Brown (LACM), Topanga Canyon, 1 male, 27.xi–5.xii.1993, Malaise trap, B.Brown,G.Hendler (LACM), 4 male, 12.vii–14.viii.1994, Malaise trap, B.Brown,G.Hendler (LACM), Walker Ranch, Placerita Canyon, 2 male, 7.x.1999, Malaise trap, B.Brown,I.Swift (LACM), 1 male, 8–17.ix.1998, Malaise trap, B.Brown,I.Swift (LACM), 2 male, 28.x–18.xi.1998, Malaise trap, B.Brown,I.Swift (LACM), 1 male, 7.i.2000, Malaise trap, B.Brown,I.Swift (LACM), 7 male, 16–28.x.1998, Malaise trap, B.Brown,I.Swift (LACM), 2 male, 20.vi–21.vii.1999, Malaise trap, B.Brown,I.Swift (LACM), Riverside Co., Magnesia Springs Canyon, near Indio, 33.726°N, – 116.435°W, 223 m, 1 male, 5.iv.1945, A.L.Melander (LACM), San Bernardino Co., San Bernardino National Forest, 1 male, 20.vii.1995, Malaise trap, B.V.Brown (LACM), Shasta Co., 25 km W Redding, 2 male, 27–30.vi.1986, Malaise trap, B.Brown,T.Spanton (LACM), Idaho: Custer Co., Lookout Mountain, Priest Lake, 1 male, 20.viii.1919, A.L.Melander (USNM), Washington: Whatcom Co., Blaine, 1 male, 7.viii.1917, A.L.Melander (USNM).
LACM |
Natural History Museum of Los Angeles County |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.