Metaphire ryunome, Blakemore, 2012

Blakemore, Robert J., 2012, New earthworm species from NIBR’s Jeju-do biosphere compared to historical and new Japanese types (Oligochaeta: Megadrilacea: Megascolecidae), Journal of Species Research 1 (2), pp. 133-150 : 145-147

publication ID

https://doi.org/ 10.12651/JSR.2012.1.2.133

persistent identifier

https://treatment.plazi.org/id/0D1D878E-FFE4-FFD2-FCBB-F9BBFC47A5CF

treatment provided by

Felipe (2024-07-31 14:51:51, last updated 2024-07-31 14:59:28)

scientific name

Metaphire ryunome
status

sp. nov.

Metaphire ryunome View in CoL sp. nov.

[Fig. 10.]

Material inspected. Holotype (H), NMST An457, mature posterior amputee specimen fixed and stored in 80% ethanol (EtOH), here dissected and figured (Fig. 10), from Hikone collected 2.II.2011 by RJB and Shiga Uni. students . Paratype (P) NMST An458, mature complete specimen with same collection details, in 80% EtOH .

Etymology. Japanese “dragon eyes”, for the appearance of the male pores.

146 JOURNAL OF SPECIES RESEARCH Vol. 1, No. 2

5 10 15 27lhs 20

Metaphire ryunome

1 mm

Fig. 10. Metaphire 18 lhs male pore of the paratype Diagnosis. Marginally in Metaphire with spermathecal pores 0.3 apart in 7/8/9. Genital markings small near or within spermathecal and male pores. Intestinal caeca simple, smooth from 27. Spermathecal diverticula elongate. Dorsal pores from 10/11.

Distribution. Japan, Shiga-ken, Hikone (ca. 35̊16′N 136̊16′E), Kaideima-cho, from ‘aze’ (dividing pathway) adjacently to rice paddy plots used by Shiga University.

Description. Length 30+mm (H) and 45 mm with 70 segments (P). Dorsum a faint brown colour with no mid-dorsal line, clitellum darker and ventrum pale. Dorsal pores from 10/11. Setae ca. 60 per segment. Spermathecal pores ca. 0.3 circumference apart in 7/8/9. Genital markings as small discs just posterior to spermathecal pores in papillae internal to eye-like secondary male pores on 18 just medi- an to primary male pore within small hollow construed as strictly non-superficial thereby just qualifying for Metaphire .

Internally, small stalked glands correspond to the external genital markings. Peptonephridia to 5/6, septa after this thin, 8/9 present (at least ventrally) going to base of gizzard, 9/10 absent, 10/11/12 slightly thickened. Nephridia meroic forests. Spermathecae in 8 and 9 each having spherical ampulla on short duct with elongate diverticulum (inseminated). Dorsal vessel single; hearts in 10-13. Holandric, testis in sacs in 10 & 11; seminal vesicles anteriorly in 11 & 12. Ovaries fan-shaped with funnels in

13; no ovisacs in 14. Prostate racemose on long muscular ducts. Oesophagus not dilated; intestinal origin in 16 with simple, smooth caeca from 27. Typhlosole and gut contents not recorded. Parasites not found.

mtDNA COI-5P Barcode result:

Hikone Metaphire ryunome Holotype (H) An457.

BOLD Systems (www.boldsystems.org/) data for holotype tagged An457.1 (compared to sub-samples An457.2 and to paratype (P) An458.1 and An458.2 all initially tagged as “ Metaphire robustus ” from preliminary identification by RJB).

AACTCTATACTTTATTTTAGGAATTTGAGCCGG AATAATCGGAGCTGGGATAAGCCTACTTATCCG CATTGAACTAAGTCAACCGGGGTCTTTCCTTGG AAGAGACCAGTTATATAATACGATTGTAACAGC ACATGCATTCCTCATAATTTTCTTCTTAGTAATA CCAGTATTTATTGGGGGGTTCGGAAACTGGTTG CTACCACTAATACTAGGAACACCAGATATAGCA TTCCCCCGACTAAATAACATAAGATTTTGACTA CTCCCCCCTTCCCTAATTCTCCTAGTGAGATCAG CTGCCGTAGAAAAAGGAGCAGGTACAGGTTGA ACAGTATACCCACCCCTAGCAAGAAATATAGC ACATGCGGGCCCCTCAGTAGATCTTGCAATCTT CTCACTACATTTAGCAGGTGCCTCGTCAATTTT AGGAGCTATTAATTTTATTACCACAGTGATCAA TATACGATGGTCAGGACTACGACTAGAACGAA TTCCATTATTTGTTTGAGCAGTAATAATTACTGT AGTACTACTACTATTATCACTCCCTGTACTAGC CGGTGCAATTACTATACTACTAACAGACCGAAA TCTTAACACATCCTTCTTTGATCCAGCTGGTGGT GGAGACCCAATTCTATACCAACACTTATTC BLASTn and megaBLAST analyses:

An457.1 vs. An457.2 vs. An458.1 vs. An458.2=100%, i.e. specimens same species.

Sequence identity of An457.1 with A. tralfamadore type is no better than 85%, meaning they are different species.

Results of megaBLAST of An457.1 show that it is 99% similar to “ Amynthas incongruus ” voucher EF077552 from China; and is just 85% identified with “ Amynthas tristriatus ” voucher EF077538 from China, or with “ Amynthas robustus ” vouchers DQ224191 and AB542533 from Taiwan and Japan, respectively (i.e., similar to A. tralfamadore result).

Remarks. Although coming closest to the restricted definitions of either A. masatakae or A. robustus ( Figs. 1 View Fig & 2) the most noticeable differences are lack of markings either mid-ventrally in 18 or paired near spermathecal and/or male pores, respectively. On the basis of the morphology differing from the types of A. robustus or A. masatakae , and because the mtDNA COI barcodes differ from what workers in Japan and Taiwan label as “ A. robustus ” (including masatakae ?), these Hikone specimens are thus newly named. However, it is entirely possible that the COI vouchers from Japan and Taiwan represent some other valid or invalid synonyms of A. robustus as restored herein.

Metaphire ryunome is morphologically comparable to Kobayashi’s (1937) Korean “ masatakae ” and to Pheretima reisuiensis Kobayashi, 1938: 139 from “Zenra-nandô” (=South Cholla) that too has spermathecal pores in 7/8/9; however, its anterior markings are more median in intersegmental furrows, amongst many other differences such as its dorsal pores from 11/12 and setae numbering 25-60. Kobayashi (1938) figures and describes “ Secondary male pore represented as a large eye-like aperture ” within which the primary male porophore is found. On the basis of this, it qualifies for genus Metaphire in a new combination as M. reisuiensis .

Possibly both species are transitional from Amynthas Kinberg, 1867 to Metaphire Sims & Easton, 1972 , the former having superficial male pores and often complex genital markings, the latter having non-superficial male pores often with intromittent organs in “copulatory pouches” of various depths thus having less need of genital markings to adhere, attach and help co-locate superficial pores of concopulants.

Kinberg, J. G. H. 1867. Annulata nova. Ofersigt af Kongl. Vetenskaos-Akademiens Forhandlingar, Stockholm 23 (4): 97 - 103.

Kobayashi, S. 1937. Preliminary survey of the earthworms of Quelpart Island. Science Report of the Tohoku Imperial University (B) 11 (3): 333 - 351.

Kobayashi, S. 1938. Earthworms of Korea I. The Science Reports of the Tohoku Imperial University, Fourth Series (Biology) 13 (2): 89 - 170.

Sims, R. W. and E. G. Easton. 1972. A numerical revision of the earthworm genus Pheretima auct. (Megascolecidae: Oligochaeta) with the recognition of new genera and an appendix on the earthworms collected by the Royal Society North Borneo Expedition. Biological Journal of the Linnaean Society 4: 169 - 268.

Gallery Image

Fig. 1. Amynthas masatakae lectotype (912), dorsal view of prostomium, ventral view of body with spermathecae and prostatic ducts in situ, intestinal caeca and an enlargement of 9 lhs spermatheca from a separate vial [boxed are X2 details of spermathecal pore 7/8 lhs and male pore 18 lhs of paralectotype (913)] -lhs; Nogeyama specimen [boxed X2 enlargement of its pores in 7/8/9 lhs] - rhs.