Watsonidia fulgida, Grados, 2019

Grados, Juan, 2019, A new species of the genus Watsonidia Toulgoët, 1981 (Lepidoptera, Erebidae, Arctiini): example of polymorphism in the Amazon of Peru, Zootaxa 4691 (1), pp. 33-46 : 35-39

Watsonidia fulgida sp. nov.

( Figs. 1–8 )

Diagnosis: It is a similar species to W. reimona , according to the wing color pattern. It can be differentiated from it by the following: on the forewings, the short black line originated at the lower distal part of the second black round line which involves the discal cell is not present, the black line of the apex is continuous whereas, in W. reimona it is interrupted; termen is black in all its extension whereas, in W. reimona the anterior half is black. In ventral view of the genital capsule, the distal parts of the valvae are somewhat square in W. fulgida , whereas in W. reimona , they are oval. In W. reimona , the lateral prolongation of the tegumen is glabrous, wide at its base, decreasing in thickness towards the distal part and bears a sharp end; in W. fulgida the prolongation is thin and elongated in almost all its extension, bearing spicules in the distal third.

Description of morphotype 1: Male ( Figs.1–2 ). Forewing span: 14–15 mm (n = 18). Head: Proboscis light brown. Frontoclypeus white. Vertex and postgena mustard. Palpi mustard, curved towards the head and reaching the medial part of the frontoclypeus. First palpomere with piliform scales towards its base; second palpomere similar in length to the first, wider towards the distal part; third palpomere small. Ocellus black and antennal alveolus whitish mustard. Bipectinated antennae. Scape, pedicel and axis of the flagellum, white. First three proximal rami small. Middle rami similar in size to the axis. Fifth distal part of the flagellum does not present rami. Cervical scales mustard. Thorax: Patagia white with mustard scales on the anterior surface. Tegula white, with a black spot posterolateral to surface of the patagia, arising from the central part of the anterior surface, reaching the medial part, and becoming somewhat wider. Posterior part of the patagia mustard. Mesoscutum and mesoscutellum white.A mustard spot at the central anterior part of the mesoscutum and a black spot at the central posterior part. A black spot in the central part of the mesoscutellum. Metascutellum and thoracic pleura white. First pair of legs white with black spots and sparse white scales on the internal side of the femur, tibia and tarsi. Epiphysis brown. Second pair of legs white, with a thin black line along the external surface of the tibia and the tarsi. Tibial spurs white. Third pair of legs white. Tymbal organ covered by white scales on the katepisternum. Forewing (dorsal): White with costal margin black at the first proximal third. Black line at the base of the wing. A first semicircular black line involving the discal cell; from the first proximal third of the wing, and extending to the distal part, ending where R 2+3+4+5 arises. Mustard line near the base of the wing, ventral to the black costal margin, reaching the black semicircular line. Second semicircular black line at the apex, including the distal quarter of the costal directing ventrally from the beginning of R 4 -R 5, passing through the proximal part of R 5 -M 1, the medial portion of the M 1 -M 2, and extending throughout the distal half of M 2 -M 3. Black termen reaching the tornus and projecting itself in an oblique line crossing the distal part of the anal cell, the subdistal parts of the 1A-2A and the Cu 2 -1A extending to the subdistal part of the first semicircular line. Mustard spot between the second and third semicircular lines, extending from the ventral part of the costal margin up to the M 2 -M 3. A third semicircular black line begins at the proximal part of the 1A-2A, runs through the Cu 2 -1A to the medial part, directs ventrally and extends from the 1A-2A, involves the anal cell and its posterior margin, towards the proximal side of it. A mustard spot between the first and third black semicircular lines; extending from the distal part and limited by a black oblique line arising from the tornus, to the posterior margin, limited by 2A. A mustard spot in the anal cell between the base of the wing and the third semicircular line. Forewing (ventral): White with a faint mustard line at the costal margin.A second black line present on the dorsal side, towards the apex, faintly visible. A small mustard spot in the proximal part of the R 5 -M 1. Hindwing (dorsal surface): White with mustard scales extending from cell M 1 -M 3 to anal cell, more prominent in the latter. Hindwing (ventral surface): White with mustard scales in the anal cell. Abdomen: Mustard on the dorsal side, with white piliform scales on the lateral and posterior sides of the last sternite. White on the ventral surface. Male genitalia ( Figs. 3–6 ) (Genitalia # JGA 849): Tegumen somewhat sclerotized and its anterior margin shaped like an inverted “V”; presenting elongated, thin and sclerotized extensions that go beyond the tip of valvae towards the postero-lateral parts and bear spicules at the distal third; posterior margin straight. Union of the tegumen and uncus membranous. Uncus narrow at the base; setae present at the lateral parts of the proximal two thirds; sharp and sclerotized at the distal end; in lateral view, the central part twice the width at base. Valvae in lateral view, rectangular, wide and sclerotized, with a slight invagination in the medial part of the dorsal side; a large invagination at the distal end, forming a spoon shaped cavity; setae present along the ventral margin. Juxta triangular and weakly sclerotized. Transtilla with small sclerotized areas on each side. Aedeagus elongated and somewhat sclerotized. Caecum penis somewhat developed. Vesica membranous extending towards the dorsal part and presenting a sclerotized area towards the base of the dorsal part; minute spicules present on the dorsal area; cornuti at the distal central part, with tiny spicules on the area below the cornuti.

Female ( Figs. 7–8 ): Forewing span: 15–17 mm (n=14). Patterns of wing and body color similar to the male, differing on the following characters: antennae with minute rami; hindwings elongated and somewhat triangular; frenulum composed of three bristles. Female genitalia ( Figs. 11–12 ) (Genitalia # JGA 851): Pheromone glands present. Eighth tergite uniformly sclerotized. Anal papillae well developed bearing setae throughout the area, denser on the proximal and dorsal surfaces; in lateral view, height 1.5 times its width. Posterior apophyses four times larger than the anterior ones. Ostium and antrum in central position, the latter sclerotized. Antevaginal lamella somewhat sclerotized. Postvaginal lamella membranous. Ductus bursae membranous, wide and flattened; distal third somewhat sclerotized. Cervix bursae somewhat sclerotized, wider than long. Corpus bursae membranous, somewhat globose; in dorsal view, oval, somewhat narrower to the left side. A small signum at the dorsal side and another at the posterior of the right side. Ductus seminalis arising from the left side of the cervix bursae.

Type material: HOLOTYPE male ( Figs. 1–2 ): PERU, CUSCO: Cashiriari, 11°52’S, 72°39’W, 690 m, 04– 05.xii.1997, J. Grados (11:00 pm–12:00) . 30 Paratypes (16 males and 14 females): PERU, UCAYALI, 1 male, Masisea, C.C.N.N., Betel, 08°25’29.94’’S, 74°15’42.81’’W, 138 m, 08.viii.2009, C. Carranza ; 1 female, Puerto Putin , 08°44’59.2’’S, 74°08’19.52’’W, 122 m, 17.vii.2008, M. Alvarado ; 1 female, Río Tamaya , 08°51’41.9’’S, 74°04’20.6’’W, 150 m, 07–08.vii.2008, M. Alvarado . JUNIN: 2 females, Mazamari , 11°20’33’’S, 74°33’04’’W, 1100 m, 28–29.v.2011, P. Hocking leg . CUSCO: 1male, 12 km O de Sonampiato, 11°39’52.07’’S, 73°14’35.01’’W, 887 m, 29.v.2011, C. Espinoza ; 1 male, San Martín C, 11°47’S, 72°41’W, 480 m, 06.iv.1997, J. Grados ; 1 male, Pagoreni , 11°42’S, 72°54’W, 470 m, 02.x.1998, G. Valencia ; 1 male, 7.5 km SO de Puerto Huallana ( Río Picha ), 11°49’21’’S, 72°11’24’’W, 441 m, 05–07.ix.2017, J. Gonzáles ; 2 males, Cashiriari , 11°52’S, 72°39’W, 690 m, 04–05.xii.1997, J. Grados (2:00–3:00 am)(Light trap MV / UV) ; 1 male, idem except, 06.xii.1997 ; 1 male, idem except (GENITALIA # 850– JGA) ; 1 female, Las Malvinas, 11°52’S, 72°56’W, 360 m, 20.ix.1997, J. Grados (Light trap MV / UV) . MADRE DE DIOS: 1 male, CICRA, Río Los Amigos , 12°33’S, 70°06’W, 280 m, 06.xi.2006, A. Asenjo ; 2 males, idem except, 17.xi.2006 ; 1 female, idem except, 27.xi.2006 (GENITALIA # 851– JGA)(Genitalia # 968– JGA) ; 1 male, idem except, 16.i.2007 (GENITALIA # 849– JGA) ; 1 male, idem except, 12°34’7.35’’S, 70°05’56.8’’W, 380 m, 08.xii.2005, J. Grados leg. (Genitalia # 972– JGA) ; 1 female, Albergue Posada Amazonas, 12°47’S, 69°14’W, 300 m, 05.xii.2003, A. Lescano ; 1 male, idem except, 13.xii.2003 ; 1 female, idem ex- cept, 12°48’17’’S, 69°17’35’’W, 280 m, 03.x.2004, T. McCabe ; 1 female, Tambopata Research Center, 13°08’S, 69°36’W, 300 m, 13.v.2001, J. Grados (Light trap MV) ; 1 female, Albergue Refugio Amazonas, Río Tambopata , 12°52’30’’S, 69°24’35’’W, 231 m, 09.x.2016, D. Couceiro ; 2 females, idem except, 22.x.2016 ; 1 female, idem except 24.vi.2017 ; 1 female, idem except, 16.vii.2017, Wendy and Joshua Villanueva ; 1 female, idem except, 20.x.2017, D. Couceiro ; 1male, idem except, 05.viii.2018. PUNO: 1 male, P.N. Bahuaja-Sonene, 13°11’42’’S, 70°07’56’’W, 330 m, 03.vi.2013, J. Grados, E. Razuri & J. Barrientos (Genitalia # 1000– JGA) ; 1 male, idem except, 13°11’35’’S, 70°07’56’’W, 05.vi.2013 . Additional material examined. PERU, MADRE DE DIOS: 1 female, Rio Tambopata Res : 30 air km. SW Pto. Maldonado, 290 m, 11–15.xi.1979, J.B. Heppner (subtropical moist forest) ( USNM) ; 4 males, idem except, 6–10.xi.1979 .

Etimology: fulgida is a feminine adjective in singular nominative meaning bright. The name was chosen by Wendy and Joshua Villanueva, participants of the Citizen Science project.

Distribution: Known in Peru from the departments of Ucayali, Junín, Cusco and Madre de Dios (Peruvian Amazon).

Barcoding: The mitochondrial DNA sequence (COI) of one of the paratypes (Voucher MUSM-Arctiinae VBC # 359) is as follows:

AACTTTATATTTTATCTTTGGTzATCTGAGCTGGAATAGTAGGAACTTCTCTAAGTTTATTAATTC- GTGCTGAATTAGGAAATCCTGGATCTTTAATTGGAGACGATCAAATTTATAATACAATTGTAACT- GCCCATGCTTTTATTATAATTTTCTTTATAGTAATACCAATTATAATTGGAGGATTTGGTAATTGATTA GTACCTTTAATACTAGGAGCCCCAGATATAGCATTCCCTCGAATAAATAATATAAGTTTTTGACTCTTACCCCCAT- C AT TA A C AT TAT TA AT T T C A A G A A G A AT C G TA G A A A AT G G A G C A G G A A C A G G AT G A A C A G - TATACCCCCCACTTTCATCTAATATTGCTCATGGAGGAAGTTCCGTAGATTTAGCTATTTTTTC ATTACACTTAGCTGGAATTTCATCAATTTTAGGAGCCATCAATTTTATTACAACAATTATTAATATAC- GATTAAATAATTTATCATTTGATCAAATACCTTTATTTATTTGAGCTGTAGGTATTACAGCTTTTT- TATTATTATTATCATTACCTGTTTTAGCTGGAGCTATTACAATATTATTAACAGATCGTAATCTTA- ATACTTCATTTTTTGATCCTGCTGGAGGAGGAGACCCAATTCTCTACCAACATTTATTC

Remarks: Watsonidia reimona was described by Schaus (1933) from two male and one female specimens from Buena Vista ( Colombia), a male was designated as Holotype. The information provided by Watson (1971) is as follows: holotype male; “Collection Wm. Schaus; S.C. Patchett Coll; Buena Vista, Colombia; Type No. 34388 U.S. N.M.; Glaucostola reims Schaus. Type; Arctiidae genitalia slide no. AW253; Holotype male Glaucostola reigns Schaus A.W. 1967 .”

Watsonidia was proposed by Toulgoët (1981), composed of four species: W. reimona (Glaucostola) , W. pardea (Glaucostola) , W. porioni and W. navatteae . He designated Watsonidia reimona as the type species of the genus ( Schaus 1933) (= Glaucostola reimona Schaus, 1933 ). When describing the species W. porioni, Toulgoët (1981) compared the genital capsule of the new species with a male specimen from Apuya, Napo River ( Ecuador), which he identified as W. reimona (nec W. reimona ).

Comparing the color pattern and the genital traits of the specimen used, deposited and photographed by Toulgoët (1981: 65, Figs. 1, 2 and 5 ) with the holotype of W. reimona ( Watson 1971: 124, plate 20: f; plate 50: c,d), different characters can be seen, indicating they correspond to distinct species. In his publication Toulgoët (1981) considered he was representing W. reimona but he did not realize it was an unknown species.

Description (stained morphotype): Male ( Figs. 27, 30, 33 ). Forewing span: 14–15 mm (n = 5). Except for the black spot on the forewings, the stained morphotype is similar to the male of the white one ( Figs. 27,30, 33 ). The male genitalia ( Fig. 28–29, 31–32, 34–35 ) is similar to the white morphotype. Valvae and lateral processes of the tegumen are variable, and the range of variability is continuous in both morphotypes.

Female ( Figs. 9–10 ): Forewing span: 13–15 mm (n=4). Wing and body color pattern similar to the male, differing in the following characters: antennae with minute rami; hindwings elongated; frenulum composed of three bristles. Except for the black spot on the forewings, it is similar to the female of the white morphotype. Female genitalia ( Figs. 13–14 ) (Genitalia # 853–JGA): There are no differences between this and the genitalia of the white morphotype.

Material examined: PERÚ: CUSCO: 1 male, Pagoreni , 11°42’S, 72°54’W, 470 m, 02.x.1998, G. Valencia (GENITALIA # 852— JGA) ; 1 male, Segakiato, Río Camisea , 11°48’S, 72°52’W, 330 m, 08.x.1997, J. Grados (Light trap MV) ; 1 female, 1.3 km SSO de Las Malvinas , 11°51’30’’S, 72°57’00’ W, C. Espinoza . MADRE DE DIOS: 1 male, Río Los Amigos , CICRA, 12°33’S, 70°06’W, 280 m, 25.xi.2006, A. Asenjo (Genitalia # 977– JGA) ; 1 female, Albergue Refugio Amazonas, Río Tambopata , 12°52’30’’S, 69°24’35’’W, 231 m, 12.xi.2016, D. Couceiro (GENITALIA # 853— JGA) ; 1 female, idem except, 20.x.2017 ; 1 male, ídem except 12.v.2018, J. Shoobridge et al .; 1male, ídem except, 05.viii.2018 (Genitalia # 1001– JGA) ; 1 male, Rio Tambopata Res : 30 air km. SW Pto. Maldonado, 290 m, 11–15.xi.1979, J.B. Heppner (subtropical moist forest)( USNM) ; 1 male, idem except 21–25.xi.1979 ( USNM) .

Barcoding: The mitochondrial DNA sequence ( COI) of one specimen is as follows (Voucher MUSM-Arctiinae VB # 200):

AACTTTATATTTTATCTTTGGTATCTGAGCTGGAATAGTAGGAACTTCTCTAAGTTTATTAATTC- GTGCTGAATTAGGAAATCCTGGATCTTTAATTGGAGACGATCAAATTTATAATACAATTGTAACT- GCCCATGCTTTTATTATAATTTTCTTTATAGTAATACCAATTATAATTGGAGGATTTGGTAATTGATTAG- TACCTTTAATACTAGGAGCCCCAGATATAGCATTCCCTCGAATAAATAATATAAGTTTTTGACTCT- TACCCCCATCATTAACATTATTAATTTCAAGAAGAATCGTAGAAAATGGAGCAGGAACAGGATGAA- CAGTATACCCCCCACTTTCATCTAATATTGCTCATGGAGGAAGTTCCGTAGATTTAGCTATTTTTTCA TTACACTTAGCTGGAATTTCATCAATTTTAGGAGCCATCAATTTTATTACAACAATTATTAATATACGAT- TAAATAATTTATCATTTGATCAAATACCTTTATTTATTTGAGCTGTAGGTATTACAGCTTTTTTATTATTAT- TATCATTACCTGTTTTAGCTGGAGCTATTACAATATTATTAACAGATCGTAATCTTAATACTTCATTTTTT- GATCCTGCTGGAGGAGGAG

Figures

FIGURES 1–2. Watsonidia fulgida Grados, sp. nov. 1. Holotype male, dorsal. 2. Holotype male, ventral. Scales=5 mm.

FIGURES 3–6. Genitalia of Watsonidia fulgida Grados, sp. nov. Male. (Genitalia # JGA–849). 3. Dorsal view. 4. Ventral view. 5. Lateral view. 6. Aedeagus. Scales= 1 mm.

FIGURES 7–10. Watsonidia fulgida Grados, sp. nov. Females. Figs. 7–8. White form (Refugio Amazonas Lodge). 7. Dorsal view. 8. Ventral view. Figs. 9–10. Stained form (Refugio Amazonas Lodge). 9. Dorsal view. 10. Ventral view. Scales=5 mm.

FIGURES 11–14. Genitalia of Watsonidia fulgida Grados, sp. nov. Females. Figs. 11–12. White form. (Genitalia # JGA–851). 11. Dorsal view. 12. Ventral view. Figs. 13–14. Stained form. (Genitalia # JGA–853). 13. Dorsal view. 14. Ventral view. Scales= 1 mm.

FIGURES 27–35. Adults and genitalia of Watsonidia fulgida Grados, sp. nov. Stained form. Males. Figs. 27–29. Adult. (Genitalia # JGA–852). 27. Adult, dorsal view. 28. Genitalia, dorsal view. 29. Genitalia, ventral view. Figs. 30–32. Adult. (Genitalia # JGA–977). 30. Adult, dorsal view. 31. Genitalia, dorsal view. 32. Genitalia, ventral view. Figs. 33–35. Adult. (Genitalia # JGA–1001). 33. Adult, dorsal view. 34. Genitalia, dorsal view. 35. Genitalia, ventral view. Scales of adults=5 mm. Scales of genitalia=1 mm.