Liphistius liz Lin & Li, 2023

Lin, Yejie & Li, Shuqiang, 2023, A new species of Liphistius Schiodte, 1849 (Araneae, Liphistiidae) from Yunnan, China, Biodiversity Data Journal 11, pp. 113290-113290 : 113290

Liphistius liz Lin & Li, 2023 sp. nov.

Materials

Type status: Holotype. Occurrence: catalogNumber: IZCAS-Ar44748 ; recordedBy: Yicheng Lin; individualCount: 1; sex: male; lifeStage: adult; occurrenceID: 5BCC41FF-4DC2-53C5-836F-F9BBC80D4BDE; Taxon : scientificName: Liphistius liz; Location : country: China; stateProvince: Yunnan; county: Lianghe ; locality: Jiubao Achang Township , Shizunao ; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; Identification: identifiedBy: Yejie Lin; dateIdentified: 2023; Event: year: 2023; month: 5; day: 13 Type status: Paratype. Occurrence: catalogNumber: IZCAS-Ar44749 ; recordedBy: Yicheng Lin; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: 2177DB32-CFCD-5FED-9AAF-D1629797C869; Taxon : scientificName: Liphistius liz; Location : country: China; stateProvince: Yunnan; county: Lianghe ; locality: Jiubao Achang Township , Shizunao ; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; Identification: identifiedBy: Yejie Lin; dateIdentified: 2023; Event: year: 2023; month: 8; day: 12 Type status: Paratype. Occurrence: catalogNumber: IZCAS-Ar44750 ; recordedBy: Yicheng Lin; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: 4FEE7ED6-6BCF-50BB-A7A5-D3C318237341; Taxon : scientificName: Liphistius liz; Location : country: China; stateProvince: Yunnan; county: Lianghe ; locality: Jiubao Achang Township , Shizunao ; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; Identification: identifiedBy: Yejie Lin; dateIdentified: 2023; Event: year: 2023; month: 8; day: 12 Type status: Paratype. Occurrence: catalogNumber: IZCAS-Ar44751 ; recordedBy: Yicheng Lin; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: 34FCBAD1-1985-59EA-8784-A3605859BC42; Taxon : scientificName: Liphistius liz; Location : country: China; stateProvince: Yunnan; county: Lianghe ; locality: Jiubao Achang Township , Shizunao ; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; Identification: identifiedBy: Yejie Lin; dateIdentified: 2023; Event: year: 2023; month: 8; day: 12 Type status: Paratype. Occurrence: catalogNumber: IZCAS-Ar44752 ; recordedBy: Yicheng Lin; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: BB3338CB-0A61-516F-BEA2-1CA2A06BA8E9; Taxon : scientificName: Liphistius liz; Location : country: China; stateProvince: Yunnan; county: Lianghe ; locality: Jiubao Achang Township , Shizunao ; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; Identification: identifiedBy: Yejie Lin; dateIdentified: 2023; Event: year: 2023; month: 8; day: 12

Description

Male (holotype, Figs 2 , 3 b, 4 , 7 A). Total length 7.55. Carapace 4.19 long and 3.83 wide, earthy yellow in ethanol (slightly lighter than in life), margin and fovea colour darker, without obvious dark stripes between coxal elevations (Fig. 7 A). Eye sizes and interdistances: AME 0.06, ALE 0.49, PME 0.25, PLE 0.35, AME-AME 0.08, AME-ALE 0.08, PME-PME 0.04, PME-PLE 0.06, AME-PME 0.02, ALE-PLE 0.05. Chelicerae reduced, brown, with several short macrosetae. Labium 0.73 long and 0.44 wide, fused with sternum. Sternum 1.98 long and 0.75 wide, posterior tip elongated. Opisthosoma 3.54 long and 2.29 wide, with ten tergites. Leg measurements: leg I 11.86 (3.26, 3.85, 3.17, 1.58), leg II 13.46 (3.83, 4.07, 3.51, 2.05), leg III 14.88 (3.53, 4.30, 4.47, 2.58), leg IV 19.41 (4.69, 5.51, 5.91, 3.30).

Palp (Figs 2 , 3 b, 4 ). Tibial apophysis of palp almost as high as wide, situated near retrolateral margin of tibia, with four megaspines. Cymbium with two clavate trichobothria retrolaterally (Fig. 4 D). Paracymbium large and thick, almost as wide as cymbium, cumulus distinctly elevated with many long setae (Fig. 4 ). Subtegulum curved in prolaterodorsal and ventral views, without obvious apophysis. Tegulum with a well-developed and denticulate distal edge. Half of the contrategulum strongly sclerotised, with a ventral process (Figs 2 , 3 b). Paraembolic plate slightly elevated. Embolus partly sclerotised, with some longitudinal ridges extending to the tip, margins of these ridges slightly dentated (Figs 2 , 3 b).

Female (paratype, Figs 1 , 5 , 7 B). Total length 10.32. Carapace 4.87 long, 4.16 wide, colour as in males, except shades being darker (Figs 1 , 7 B). Eye sizes and interdistances: AME 0.06, ALE 0.45, PME 0.27, PLE 0.31, AME-AME 0.06, AME-ALE 0.07, PME-PME 0.04, PME-PLE 0.05, AME-PME 0.04, ALE-PLE 0.05. Chelicerae robust, reddish-brown, with a few short stripes on dorsal side and several long macrosetae on retrolateral edge of fang groove. Labium 1.03 long, 0.52 wide. Sternum 242 long, 1.23 wide. Opisthosoma 5.92 long, 4.52 wide, with ten tergites. Leg measurements: leg I 8.60 (3.04, 2.77, 1.75, 1.04), leg II 8.63 (2.68, 3.16, 1.65, 1.14), leg III 9.80 (2.98, 3.14, 2.28, 1.48), leg IV 14.34 (3.93, 4.47, 3.83, 2.11).

Vulva (Fig. 5 ): Poreplate with four notobvious protuberances (two anterolateral and two posterolateral), two posterolateral protuberances not attached to ventral rim of poreplate. Central dorsal opening globular, receptacular cluster grape-shaped. Bulging margins on ventral poreplate only extending to the posterolateral corner of poreplate (Fig. 5 B) and distance between bulging margins almost as wide as poreplate. Genital atrium straight. Posterior area of posterior stalk located in the same plane of poreplate and almost as wide as poreplate (Fig. 5 A).

Diagnosis

Males of the new species resemble Liphistius nabang Yu, Zhang & Zhang, 2021 by the general shape of the embolus and tegulum with a clearly outlined distal edge (Fig. 3) and similar body colouration (Fig. 7 ) and the female with a similar-shaped poreplate plate. However, L. liz sp. nov. can be distinguished by the male with curved subtegulum (Fig. 2 ) [vs. subtegulum straight in L. nabang (see Yu et al. (2021), figs. 3A and B)] and tibial apophysis almost as high as wide (Fig. 4 ) [vs. wider than high in L. nabang (see Yu et al. (2021), figs. 3 D-F)]. Females of the new species can be distinguished from those of L. nabang by the straight genital atrium (Figs 5 , 6 ) [vs. genital atrium curved in L. nabang (see Yu et al. (2021), fig. 4)], posterior stalk and poreplate are located in the same plane (Figs 5 , 6 ) [vs. posterior stalk perpendicular to poreplate in L. nabang (see Yu et al. (2021), fig. 4)] and posterior stalk two times longer than wide [vs. posterior stalk four times longer than wide in L. nabang (see Yu et al. (2021), fig. 4)].

Etymology

The specific name refers to the short name for the Laboratory of Invertebrate Zoology (LIZ), Institute of Zoology, Chinese Academy of Sciences in Beijing; noun in apposition. LIZ was founded by Shen Jia-Rui (see Dai (1997)) in 1928, later led by Daxiang Song (see Marusik (2008)) from 1975 to 1995 and has been led by the senior author Shuqiang Li from 1995 to the present.

Distribution

China (Yunnan; Fig. 8 ).

DNA barcode

CTGCGATGGTTATATTCAACAAATCACAAAGATATTGGAACTATATATTTAATTTTTGGTGTATGATCTGCCATAATCGGAACTGCACTAAGATTATTAATTCGAGCAGAATTAGGTCAACCAGGAAGATTAATCGGAGACGATCAAACATATAATGTAATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATAATAATTGGAGGTTTTGGAAATTGATTAATCCCTCTTATACTAAGAGCCCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGATTATTACCCCCCTCTATCACCCTCTTATTGATTTCATCCATAGTAGAAAGAGGCTCCGGCACAGGTTGGACTATTTATCCCCCTATTGCTAGCATAGAATTTCACCCTGGTATATCTATTGATTATACTATTTTTTCATTACACCTTGCCGGGGCCTCTTCAATCTTAGGCGCAATTAATTTTATTACCACTATTATTAACATACGACCAAGAGGTATATTAATAGAGCGAGTACCATTATTTGTTTGATCTATTCTTATTACCGCAAGCCTACTGTTACTATCTTTACCTGTATTAGCTGGTGCGATTACTATGCTATTAACAGATCGAAATTTTAACACGTCATTTTTTGATCCAGCAGGAGGTGGTGACCCTATCCTATTCCAACATTTATTTTGATTTTTTGGTCATCCAGAAGTTTACATTCTTATTATTCCAGGTTTTGGGATAATTTCACATATTGTAAGACACAACGCTGGAAAAAAAGAACCTTTTGGGTCTTTAGGCATAATTTATGCAATATCCGCTATTGGATTACTAGGGTTTGTAGTCTGAGCACACCATATATTTACAGTAGGTATAGATGTTGATACACGAGCTTATTTCACAGCAGCAACCATAATTATTGCAATCCCCACAGGAATTAAAATTTTTAGATGATTAGCTACTCTTCATGGTACTAATTTAATCATAAGTACTTCCCTAATATGGTCTATTGGATTTATCTTCCTATTCACTATTGGTGGATTAACAGGCGTAATCCTAGCTAATTCATCTATTGATATTGTTCTTCATGATACATACTATGTAGTAGCTCATTTTCATTATGTTTTATCAATAGGAGCAGTTTTTGCAATTATAGCAAGAATTATTCACTGATTCCCTTTATTTTTTGGATTTTCATTTAATCAAACTTTATTAAAAATTAACTTTTTTTCCATATTTATTGGTGTAAATATAACCTTTTTCCCACAACACTTCTTAGGATTAAATGGAATACCACGACGATATTCAGATTACCCTGATATATTTATATCATGAAATGTAATTTCATCTTTAGGAAGAATTTTATCTTTTCTAGCAGTAATTATATTTATTTTAATTGTATGAGAAAGAATTATATCGAACCGTAATATTTATATTCCTACTCAATCACCTTCTTCAGTTGAATGAACTCAAAATATTCCTCCTTCTAATCATACCTTTAATCAACTCAATATACTCATTTTCTAA (GenBank accession number OR721885).

Compared material examined

Liphistius nabang : Holotype: ♂ (MHBU-ARA-00020000), CHINA, Yunnan Province, Dehong Dai and Jingpo Autonomous Prefecture, Yingjiang County, Nabang Town, 24.7521°N, 97.563°E, 265 m elev., 2 August 2019, leg. Quanyu Ji.

Variation

Vulvae of two paratype females, see Fig. 6 .

Figures

Figure 1. Liphistius liz sp. nov., paratype female, in life.

Figure 2. Dissected bulb of Liphistius liz sp. nov., holotype male. A prodorsal view; B ventral view. Abbreviations: CT, contrategulum; E, embolus; PeP, paraembolic plate; ST subtegulum; T, tegulum, vp, ventral process of contrategulum.

Figure 4. Palp of Liphistius liz sp. nov., holotype male. A dorsal view; B retrolateral view; C ventral view; D clavate trichobothria. Abbreviations: cu, cumulus; PC, paracymbium; TiA, tibial apophysis.

Figure 5. Vulva of Liphistius liz sp. nov., paratype female. A dorsal view; B ventral view. Abbreviations: ALP, anterolateral protuberance on poreplate; BM, bulging margin on ventral poreplate; CDO, central dorsal opening; DOP, dorsal opening of posterolateral protuberance on poreplate; GA, genital atrium; PLP, posterolateral protuberance on poreplate; PPl, poreplate; PS, posterior stalk; RC, receptacular cluster.

Figure 6. Vulvae of Liphistius liz sp. nov., paratype females. A, C dorsal view; B, D ventral view.

Figure 7. Habitus of Liphistius liz sp. nov., dorsal view. A holotype male; B paratype female.

Figure 8. Distribution records of Liphistius from China. 1 L. nabang; 2 L. liz sp. nov.